Starting /dee2/code/volunteer_pipeline.sh SRR6958363 current disk space = 1549187055616 free memory = 1599939228 SRR6958363 SRAfilesize 9cc7d046851cb01c1b4fad30b8eb157f SRR6958363.sra SRR6958363.sra file validated SRR6958363 is paired end SRR6958363 is conventional basespace SRR6958363 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958363_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.9045 28.0 18.0 32.0 18.0 33.0 2 26.213 27.0 18.0 31.0 18.0 33.0 3 28.66875 29.0 27.0 31.0 25.0 33.0 4 29.95725 32.0 30.0 33.0 25.0 33.0 5 31.35 33.0 32.0 33.0 27.0 33.0 6 35.7235 37.0 36.0 38.0 31.0 38.0 7 36.2835 38.0 37.0 38.0 33.0 38.0 8 36.49 38.0 37.0 38.0 34.0 38.0 9 36.85275 38.0 38.0 38.0 35.0 38.0 10-14 37.02420000000001 38.0 38.0 38.0 35.6 38.0 15-19 37.141000000000005 38.0 38.0 38.0 36.0 38.0 20-24 37.094649999999994 38.0 38.0 38.0 35.8 38.0 25-29 36.870650000000005 38.0 38.0 38.0 35.2 38.0 30-34 36.786649999999995 38.0 38.0 38.0 34.6 38.0 35-39 36.56275 38.0 38.0 38.0 34.2 38.0 40-44 36.5336 38.0 38.0 38.0 33.8 38.0 45-49 36.4862 38.0 37.8 38.0 33.8 38.0 50-54 35.87185 38.0 37.0 38.0 31.4 38.0 55-59 35.80655 38.0 36.8 38.0 30.2 38.0 60-64 36.4379 38.0 37.8 38.0 33.8 38.0 65-69 36.38934999999999 38.0 37.4 38.0 33.8 38.0 70-74 36.120099999999994 38.0 37.0 38.0 32.4 38.0 75-79 35.44475 38.0 36.0 38.0 29.2 38.0 80-84 35.312400000000004 38.0 35.8 38.0 28.6 38.0 85-89 35.6294 38.0 36.2 38.0 30.6 38.0 90-94 35.56515 38.0 36.0 38.0 30.6 38.0 95-99 34.80775 38.0 34.8 38.0 26.8 38.0 100-104 33.965599999999995 38.0 34.0 38.0 21.4 38.0 105-109 33.601749999999996 37.8 33.8 38.0 20.6 38.0 110-114 33.6546 38.0 34.0 38.0 20.6 38.0 115-119 33.52225 37.8 33.6 38.0 20.6 38.0 120-124 32.7399 37.2 31.8 38.0 17.4 38.0 125-129 32.34225 36.8 31.0 38.0 15.0 38.0 130-134 31.4069 35.8 30.0 38.0 13.8 38.0 135-139 29.994850000000003 34.6 26.2 38.0 12.6 38.0 140-144 28.44135 33.0 22.0 38.0 6.0 38.0 145-149 26.2137 32.8 13.6 38.0 2.0 38.0 150-151 19.828 24.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 2.0 14 1.0 15 1.0 16 2.0 17 1.0 18 6.0 19 4.0 20 10.0 21 11.0 22 17.0 23 22.0 24 19.0 25 41.0 26 54.0 27 67.0 28 86.0 29 128.0 30 137.0 31 177.0 32 222.0 33 286.0 34 418.0 35 686.0 36 998.0 37 599.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.2436069986541 8.506056527590848 6.029609690444145 32.2207267833109 2 27.500000000000004 10.15 32.95 29.4 3 21.25 15.375 25.525 37.85 4 25.8 22.85 23.25 28.1 5 26.55 25.15 23.3 25.0 6 25.45 28.9 23.150000000000002 22.5 7 18.7 24.55 37.6 19.15 8 22.075 22.925 28.9 26.1 9 21.65 22.45 31.1 24.8 10-14 23.62 25.900000000000002 25.275 25.205 15-19 23.995 24.465 25.569999999999997 25.97 20-24 23.87 25.224999999999998 25.474999999999998 25.430000000000003 25-29 24.335 24.315 25.509999999999998 25.840000000000003 30-34 23.91 24.75 25.540000000000003 25.8 35-39 23.655 24.615000000000002 25.130000000000003 26.6 40-44 23.755000000000003 24.735 25.474999999999998 26.035000000000004 45-49 24.12 24.295 25.31 26.275 50-54 24.404999999999998 23.73 25.474999999999998 26.39 55-59 24.035 24.375 25.515 26.075 60-64 24.245 24.375 25.509999999999998 25.869999999999997 65-69 24.55 23.94 25.3 26.21 70-74 24.5 24.165 25.205 26.13 75-79 24.02 23.895 25.41 26.674999999999997 80-84 24.044999999999998 23.945 25.990000000000002 26.02 85-89 24.375 23.990000000000002 25.5 26.135 90-94 23.925 24.745 25.355 25.974999999999998 95-99 24.51 24.135 25.555 25.8 100-104 24.060000000000002 23.810000000000002 25.91 26.22 105-109 24.415 24.310000000000002 25.785000000000004 25.490000000000002 110-114 24.654999999999998 23.885 25.324999999999996 26.135 115-119 24.58 24.115000000000002 25.424999999999997 25.88 120-124 24.38 24.215 25.629999999999995 25.775 125-129 24.37 24.145 24.935 26.55 130-134 24.01 24.685000000000002 24.7 26.605 135-139 24.625 24.355 25.1 25.919999999999998 140-144 24.685000000000002 24.94 24.925 25.45 145-149 24.795 24.610000000000003 24.965 25.629999999999995 150-151 26.1 23.125 25.074999999999996 25.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 1.0 27 0.5 28 1.5 29 3.0 30 3.5 31 5.0 32 5.5 33 8.5 34 18.0 35 27.5 36 34.5 37 50.5 38 67.5 39 83.0 40 105.0 41 139.0 42 158.5 43 170.5 44 195.5 45 197.0 46 201.5 47 201.0 48 194.5 49 184.5 50 164.0 51 152.5 52 138.0 53 118.0 54 110.5 55 105.0 56 93.0 57 94.0 58 88.0 59 79.0 60 84.0 61 83.5 62 79.5 63 70.5 64 66.0 65 63.0 66 53.5 67 48.0 68 42.0 69 44.0 70 40.5 71 31.5 72 26.0 73 18.5 74 13.0 75 11.0 76 8.0 77 5.0 78 3.0 79 2.0 80 2.5 81 2.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.124999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21815889029004 98.35000000000001 2 0.7061790668348046 1.4000000000000001 3 0.05044136191677175 0.15 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.7 0.0 0.0 0.0 0.0 120-121 1.95 0.0 0.0 0.0 0.0 122-123 2.1375 0.0 0.0 0.0 0.0 124-125 2.425 0.0 0.0 0.0 0.0 126-127 2.5999999999999996 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.4375 0.0 0.0 0.0 0.0 132-133 3.8125 0.0 0.0 0.0 0.0 134-135 4.237500000000001 0.0 0.0 0.0 0.0 136-137 4.637499999999999 0.0 0.0 0.0 0.0 138-139 5.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTGT 10 0.0068396386 144.9375 6 CAGAATC 10 0.0068396386 144.9375 2 >>END_MODULE SRR6958363 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958363_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.25675 33.0 33.0 34.0 31.0 34.0 2 32.0335 33.0 33.0 34.0 30.0 34.0 3 32.085 33.0 33.0 34.0 30.0 34.0 4 32.1095 33.0 33.0 34.0 31.0 34.0 5 32.0395 33.0 33.0 34.0 31.0 34.0 6 35.74875 38.0 37.0 38.0 30.0 38.0 7 35.8015 38.0 37.0 38.0 31.0 38.0 8 35.66125 38.0 37.0 38.0 29.0 38.0 9 35.7585 38.0 37.0 38.0 30.0 38.0 10-14 35.73309999999999 38.0 37.2 38.0 30.0 38.0 15-19 36.12925 38.0 37.6 38.0 32.6 38.0 20-24 36.4029 38.0 38.0 38.0 33.6 38.0 25-29 36.45615 38.0 38.0 38.0 34.0 38.0 30-34 36.42455 38.0 38.0 38.0 34.0 38.0 35-39 36.21135 38.0 38.0 38.0 33.6 38.0 40-44 35.9915 38.0 37.8 38.0 33.0 38.0 45-49 35.983050000000006 38.0 37.8 38.0 32.6 38.0 50-54 36.076499999999996 38.0 37.8 38.0 33.0 38.0 55-59 35.936400000000006 38.0 37.6 38.0 32.4 38.0 60-64 35.6707 38.0 37.0 38.0 31.0 38.0 65-69 35.298950000000005 38.0 36.6 38.0 28.6 38.0 70-74 35.05845 38.0 36.0 38.0 28.0 38.0 75-79 35.18195 38.0 36.0 38.0 28.6 38.0 80-84 35.135400000000004 38.0 36.0 38.0 28.6 38.0 85-89 35.01559999999999 38.0 36.0 38.0 28.4 38.0 90-94 34.50865 38.0 35.2 38.0 25.4 38.0 95-99 33.8597 38.0 34.2 38.0 19.8 38.0 100-104 33.128249999999994 37.8 33.0 38.0 16.2 38.0 105-109 32.73375 38.0 31.2 38.0 15.0 38.0 110-114 32.50019999999999 37.8 31.0 38.0 15.0 38.0 115-119 31.92085 37.2 30.4 38.0 14.4 38.0 120-124 31.0608 36.8 28.4 38.0 12.6 38.0 125-129 30.164949999999997 35.8 26.8 38.0 11.8 38.0 130-134 28.8759 34.0 23.0 38.0 11.0 38.0 135-139 28.33625 33.2 21.2 38.0 3.8 38.0 140-144 27.70645 33.0 20.0 38.0 2.0 38.0 145-149 25.3207 32.6 10.2 38.0 2.0 38.0 150-151 18.485125 17.5 2.0 34.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 5.0 4 2.0 5 1.0 6 2.0 7 2.0 8 3.0 9 5.0 10 3.0 11 2.0 12 7.0 13 1.0 14 7.0 15 10.0 16 13.0 17 14.0 18 8.0 19 18.0 20 16.0 21 35.0 22 26.0 23 44.0 24 47.0 25 52.0 26 58.0 27 68.0 28 71.0 29 120.0 30 131.0 31 172.0 32 189.0 33 282.0 34 359.0 35 561.0 36 891.0 37 758.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.05 18.275 10.299999999999999 30.375000000000004 2 27.025 23.95 26.650000000000002 22.375 3 22.85 25.900000000000002 26.5 24.75 4 26.224999999999998 30.275000000000002 20.575 22.925 5 27.35 31.75 19.775000000000002 21.125 6 22.825 35.425000000000004 18.8 22.95 7 23.7 20.200000000000003 32.9 23.200000000000003 8 24.2 23.275000000000002 24.125 28.4 9 22.775000000000002 23.325000000000003 27.725 26.174999999999997 10-14 25.979999999999997 25.224999999999998 23.09 25.705 15-19 25.96 25.09 23.275000000000002 25.674999999999997 20-24 26.245 25.330000000000002 24.115000000000002 24.310000000000002 25-29 25.874999999999996 25.295 23.65 25.180000000000003 30-34 25.874999999999996 25.445 23.86 24.82 35-39 25.81 25.11 23.419999999999998 25.66 40-44 25.8 25.165 23.645 25.39 45-49 26.055 25.21 23.72 25.014999999999997 50-54 25.82 24.89 24.3 24.990000000000002 55-59 26.665 25.275 23.45 24.610000000000003 60-64 26.724999999999998 24.709999999999997 23.605 24.959999999999997 65-69 25.825 25.264999999999997 24.325 24.585 70-74 26.279999999999998 24.625 24.145 24.95 75-79 26.205000000000002 24.8 24.365000000000002 24.63 80-84 26.090000000000003 24.990000000000002 24.41 24.51 85-89 26.115 24.990000000000002 24.305 24.59 90-94 26.36 24.779999999999998 23.990000000000002 24.87 95-99 27.05 24.85 23.66 24.44 100-104 26.325 25.245 23.95 24.48 105-109 26.029999999999998 24.884999999999998 24.445 24.64 110-114 26.265 25.19 24.060000000000002 24.485 115-119 27.445000000000004 24.58 23.59 24.385 120-124 26.169999999999998 25.4 24.625 23.805 125-129 26.985 25.56 23.185 24.27 130-134 27.075 25.41 23.355 24.16 135-139 26.825 24.8 24.490000000000002 23.885 140-144 27.175 25.605 23.46 23.76 145-149 27.35 25.495 23.925 23.23 150-151 28.8625 24.875 22.775000000000002 23.4875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.5 28 3.5 29 4.5 30 6.0 31 6.5 32 7.5 33 8.5 34 16.0 35 26.0 36 29.5 37 39.5 38 55.5 39 74.5 40 100.5 41 123.5 42 146.0 43 160.0 44 180.5 45 189.0 46 189.5 47 181.5 48 163.5 49 176.5 50 169.0 51 147.0 52 134.0 53 129.5 54 132.5 55 123.5 56 107.5 57 107.5 58 108.0 59 96.5 60 84.5 61 78.0 62 85.5 63 89.5 64 78.0 65 63.5 66 57.5 67 56.0 68 48.5 69 42.0 70 38.0 71 30.5 72 28.0 73 23.0 74 16.5 75 10.5 76 8.0 77 6.0 78 4.5 79 3.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96149949341438 97.675 2 0.8611955420466059 1.7000000000000002 3 0.10131712259371835 0.3 4 0.050658561296859174 0.2 5 0.025329280648429587 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.45 0.0 0.0 0.0 0.0 118-119 1.7 0.0 0.0 0.0 0.0 120-121 1.925 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.5625 0.0 0.0 0.0 0.0 128-129 2.975 0.0 0.0 0.0 0.0 130-131 3.375 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.5375 0.0 0.0 0.0 0.0 138-139 5.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGAACG 10 0.006830828 145.0 2 GCATCCA 10 0.006830828 145.0 4 >>END_MODULE Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125599 spots for SRR6958363.sra Written 1125599 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra Read 1125592 spots for SRR6958363.sra Written 1125592 spots for SRR6958363.sra SRR ids: ['SRR6958363.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d57mpcrx SRR6958363.sra spots: 22511847 blocks: [[1, 1125592], [1125593, 2251184], [2251185, 3376776], [3376777, 4502368], [4502369, 5627960], [5627961, 6753552], [6753553, 7879144], [7879145, 9004736], [9004737, 10130328], [10130329, 11255920], [11255921, 12381512], [12381513, 13507104], [13507105, 14632696], [14632697, 15758288], [15758289, 16883880], [16883881, 18009472], [18009473, 19135064], [19135065, 20260656], [20260657, 21386248], [21386249, 22511847]] SRR6958363 file size 7606825 SRR6958363 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958363 SRR6958363_1.fastq SRR6958363_2.fastq Input file: SRR6958363_1.fastq Paired file: SRR6958363_2.fastq trimmed: SRR6958363-trimmed-pair1.fastq, SRR6958363-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:03:45 2024 >> started Fri Dec 6 21:04:12 2024 >> done (26.574s) 22511847 read pairs processed; of these: 49245 ( 0.22%) short read pairs filtered out after trimming by size control 51643 ( 0.23%) empty read pairs filtered out after trimming by size control 22410959 (99.55%) read pairs available; of these: 12554875 (56.02%) trimmed read pairs available after processing 9856084 (43.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 2 0.00% 21 7 0.00% 22 3 0.00% 23 3 0.00% 24 5 0.00% 25 9 0.00% 26 3 0.00% 27 7 0.00% 28 8 0.00% 29 6 0.00% 30 11 0.00% 31 12 0.00% 32 7 0.00% 33 19 0.00% 34 25 0.00% 35 16 0.00% 36 16 0.00% 37 10 0.00% 38 21 0.00% 39 25 0.00% 40 22 0.00% 41 20 0.00% 42 29 0.00% 43 27 0.00% 44 44 0.00% 45 42 0.00% 46 37 0.00% 47 42 0.00% 48 39 0.00% 49 63 0.00% 50 66 0.00% 51 75 0.00% 52 83 0.00% 53 91 0.00% 54 121 0.00% 55 123 0.00% 56 121 0.00% 57 150 0.00% 58 168 0.00% 59 184 0.00% 60 197 0.00% 61 236 0.00% 62 262 0.00% 63 261 0.00% 64 337 0.00% 65 355 0.00% 66 356 0.00% 67 416 0.00% 68 458 0.00% 69 521 0.00% 70 568 0.00% 71 652 0.00% 72 718 0.00% 73 821 0.00% 74 902 0.00% 75 990 0.00% 76 1136 0.01% 77 1241 0.01% 78 1450 0.01% 79 1702 0.01% 80 1872 0.01% 81 2188 0.01% 82 2528 0.01% 83 2969 0.01% 84 4589 0.02% 85 5614 0.03% 86 5872 0.03% 87 6101 0.03% 88 6261 0.03% 89 6245 0.03% 90 6801 0.03% 91 7338 0.03% 92 7798 0.03% 93 8372 0.04% 94 8884 0.04% 95 9619 0.04% 96 10073 0.04% 97 10739 0.05% 98 11453 0.05% 99 12475 0.06% 100 13429 0.06% 101 14149 0.06% 102 15316 0.07% 103 16581 0.07% 104 17692 0.08% 105 18824 0.08% 106 20258 0.09% 107 21545 0.10% 108 22638 0.10% 109 23926 0.11% 110 25396 0.11% 111 26854 0.12% 112 28526 0.13% 113 30385 0.14% 114 32184 0.14% 115 34535 0.15% 116 36423 0.16% 117 38379 0.17% 118 40210 0.18% 119 42462 0.19% 120 44356 0.20% 121 46785 0.21% 122 48914 0.22% 123 51978 0.23% 124 55354 0.25% 125 58962 0.26% 126 61914 0.28% 127 65271 0.29% 128 68483 0.31% 129 72926 0.33% 130 76666 0.34% 131 80584 0.36% 132 86335 0.39% 133 92330 0.41% 134 98762 0.44% 135 105197 0.47% 136 112449 0.50% 137 120096 0.54% 138 128683 0.57% 139 140356 0.63% 140 152541 0.68% 141 167982 0.75% 142 189140 0.84% 143 214074 0.96% 144 248862 1.11% 145 298571 1.33% 146 375579 1.68% 147 508054 2.27% 148 774595 3.46% 149 1519205 6.78% 150 5817024 25.96% 151 9856084 43.98% 22410959 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=22 prefix-density=0.62 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=108.36 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.3 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.86 fanout-score-rank=25 prefix-density=0.47 prefix-fanout=3.0 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=73.23 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=4.1 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958363 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:04:55 Started mapping on | Dec 06 21:04:55 Finished on | Dec 06 21:07:20 Mapping speed, Million of reads per hour | 556.41 Number of input reads | 22410959 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 21730096 Uniquely mapped reads % | 96.96% Average mapped length | 293.86 Number of splices: Total | 24604132 Number of splices: Annotated (sjdb) | 23045055 Number of splices: GT/AG | 24272252 Number of splices: GC/AG | 293218 Number of splices: AT/AC | 8816 Number of splices: Non-canonical | 29846 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 182889 % of reads mapped to multiple loci | 0.82% Number of reads mapped to too many loci | 11822 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.86% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 523623 523623 523623 N_multimapping 182889 182889 182889 N_noFeature 621065 21143647 789472 N_ambiguous 503711 3017 86412 UnstrandedReadsAssigned:20605320 PositiveStrandReadsAssigned:583432 NegativeStrandReadsAssigned:20854212 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=146 echo kmer=141 SRR6958363 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958363-trimmed-pair1.fastq SRR6958363-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,410,959 reads, 20,876,096 reads pseudoaligned [quant] estimated average fragment length: 250.646 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR6958363.ke.tsv 35125 SRR6958363.se.tsv 88098 total ==> SRR6958363.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.827 0.00623836 0.000655561 PNS24247 1044 794.354 85.224 7.7435 PNS24249 1928 1678.35 108.785 4.67817 PNS24246 1044 794.354 85.224 7.7435 PNS24248 1044 794.354 85.224 7.7435 PNS24244 1471 1221.35 21.5367 1.27271 PNS24243 293 89.4869 0 0 KQK14069 1603 1353.35 8023.17 427.882 KQK14071 474 236.333 186.292 56.8932 ==> SRR6958363.se.tsv <== BRADI_1g14170v3 9156 BRADI_1g53295v3 230 BRADI_1g59795v3 279 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 204 BRADI_1g74790v3 103 BRADI_1g09890v3 0 BRADI_1g77505v3 231 BRADI_1g48960v3 0 SRR6958363 completed mapping pipeline successfully