Starting /dee2/code/volunteer_pipeline.sh SRR6958364 current disk space = 1549156786176 free memory = 1600444808 SRR6958364 SRAfilesize 3159aff477d6e96b9128fe1778c09bba SRR6958364.sra SRR6958364.sra file validated SRR6958364 is paired end SRR6958364 is conventional basespace SRR6958364 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958364_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.255 34.0 33.0 34.0 33.0 34.0 2 33.40625 34.0 33.0 34.0 33.0 34.0 3 33.42925 34.0 33.0 34.0 33.0 34.0 4 33.071 34.0 33.0 34.0 32.0 34.0 5 33.2625 34.0 33.0 34.0 33.0 34.0 6 36.20175 38.0 36.0 38.0 33.0 38.0 7 37.123 38.0 38.0 38.0 36.0 38.0 8 37.41225 38.0 38.0 38.0 37.0 38.0 9 37.5155 38.0 38.0 38.0 37.0 38.0 10-14 37.56195 38.0 38.0 38.0 37.8 38.0 15-19 37.4832 38.0 38.0 38.0 37.6 38.0 20-24 37.5889 38.0 38.0 38.0 38.0 38.0 25-29 37.5558 38.0 38.0 38.0 38.0 38.0 30-34 37.502500000000005 38.0 38.0 38.0 37.8 38.0 35-39 37.51015 38.0 38.0 38.0 37.8 38.0 40-44 37.47465 38.0 38.0 38.0 37.2 38.0 45-49 37.4469 38.0 38.0 38.0 37.0 38.0 50-54 37.37835 38.0 38.0 38.0 37.0 38.0 55-59 37.2418 38.0 38.0 38.0 36.8 38.0 60-64 37.14829999999999 38.0 38.0 38.0 36.6 38.0 65-69 37.2096 38.0 38.0 38.0 36.4 38.0 70-74 37.1662 38.0 38.0 38.0 36.0 38.0 75-79 37.03505 38.0 38.0 38.0 35.8 38.0 80-84 36.99055 38.0 38.0 38.0 35.8 38.0 85-89 36.87615 38.0 38.0 38.0 35.0 38.0 90-94 36.7142 38.0 38.0 38.0 34.6 38.0 95-99 36.52415 38.0 38.0 38.0 33.8 38.0 100-104 36.24335 38.0 37.8 38.0 32.8 38.0 105-109 36.13135 38.0 37.8 38.0 32.2 38.0 110-114 35.91185 38.0 37.8 38.0 31.4 38.0 115-119 35.622 38.0 36.8 38.0 30.4 38.0 120-124 35.40475 38.0 36.4 38.0 29.6 38.0 125-129 35.22945 38.0 36.0 38.0 28.4 38.0 130-134 34.81595 38.0 36.0 38.0 27.6 38.0 135-139 34.0964 38.0 33.4 38.0 24.8 38.0 140-144 33.74 38.0 33.0 38.0 22.6 38.0 145-149 33.0056 38.0 33.0 38.0 17.2 38.0 150-151 26.57275 32.5 17.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 0.0 16 3.0 17 2.0 18 3.0 19 7.0 20 7.0 21 2.0 22 7.0 23 9.0 24 8.0 25 13.0 26 20.0 27 19.0 28 22.0 29 36.0 30 35.0 31 60.0 32 72.0 33 99.0 34 181.0 35 272.0 36 767.0 37 2352.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.75 10.6 8.475000000000001 32.175 2 24.075 11.899999999999999 33.550000000000004 30.475 3 21.65 15.2 26.05 37.1 4 25.4 21.55 23.825 29.225 5 26.825 24.625 24.575 23.974999999999998 6 25.374999999999996 29.15 23.775 21.7 7 20.599999999999998 24.775 35.85 18.775 8 22.475 23.775 27.700000000000003 26.05 9 21.775 21.85 31.874999999999996 24.5 10-14 24.23 25.230000000000004 25.515 25.025 15-19 24.371092773193297 23.88097024256064 25.69142285571393 26.056514128532132 20-24 23.799999999999997 24.51 25.47 26.22 25-29 24.175 24.195 25.2 26.43 30-34 24.23 24.295 25.259999999999998 26.215 35-39 24.310000000000002 24.560000000000002 24.72 26.41 40-44 24.465 24.435000000000002 24.705 26.395000000000003 45-49 24.099999999999998 24.62 24.745 26.534999999999997 50-54 24.005000000000003 24.035 25.535000000000004 26.424999999999997 55-59 24.735 24.875 23.98 26.41 60-64 24.670376497718955 23.938436857672833 25.116558881034738 26.27462776357347 65-69 24.745 23.990000000000002 24.610000000000003 26.655 70-74 24.57 24.154999999999998 25.15 26.125 75-79 24.886198789455253 23.55059776899605 25.081286578960533 26.481916862588168 80-84 24.565 24.115000000000002 24.715 26.605 85-89 25.18003600720144 23.88477695539108 24.64492898579716 26.290258051610323 90-94 24.875 24.04 24.965 26.119999999999997 95-99 24.8062403120156 23.701185059252964 25.026251312565627 26.466323316165806 100-104 24.654999999999998 23.935000000000002 25.345000000000002 26.064999999999998 105-109 24.988746061121393 23.803331165908066 24.92872505376882 26.27919771920172 110-114 24.715 24.215 24.7 26.369999999999997 115-119 25.48254825482548 24.242424242424242 23.86738673867387 26.407640764076408 120-124 25.16 24.165 24.495 26.179999999999996 125-129 25.08004802881729 24.584750850510307 24.414648789273564 25.920552331398838 130-134 25.264999999999997 24.62 23.77 26.345000000000002 135-139 25.003750562584386 24.753713056958542 24.003600540081013 26.238935840376055 140-144 25.14 24.585 23.56 26.715 145-149 25.1 25.235000000000003 24.07 25.595000000000002 150-151 24.6125 24.8625 23.5375 26.987499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 1.0 28 2.0 29 4.0 30 6.0 31 9.0 32 10.5 33 13.5 34 16.5 35 25.0 36 38.0 37 52.5 38 72.0 39 79.0 40 98.5 41 130.0 42 157.5 43 179.5 44 171.0 45 173.5 46 185.5 47 170.5 48 167.0 49 169.0 50 164.0 51 152.5 52 125.0 53 112.0 54 116.0 55 115.5 56 108.0 57 97.5 58 94.5 59 92.0 60 90.5 61 92.0 62 80.5 63 72.0 64 73.5 65 67.0 66 58.5 67 54.0 68 51.5 69 47.0 70 44.0 71 41.0 72 28.5 73 20.5 74 22.0 75 18.5 76 10.5 77 7.5 78 5.5 79 2.5 80 1.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.025 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.265 65-69 0.0 70-74 0.0 75-79 0.045 80-84 0.0 85-89 0.02 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.034999999999999996 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.06 130-134 0.0 135-139 0.015 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.655241935483871 1.3 3 0.07560483870967742 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.775 0.0 0.0 0.0 0.0 112-113 2.1624999999999996 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.2125 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 4.1375 0.0 0.0 0.0 0.0 124-125 4.612500000000001 0.0 0.0 0.0 0.0 126-127 5.0625 0.0 0.0 0.0 0.0 128-129 5.7 0.0 0.0 0.0 0.0 130-131 6.300000000000001 0.0 0.0 0.0 0.0 132-133 6.875 0.0 0.0 0.0 0.0 134-135 7.487500000000001 0.0 0.0 0.0 0.0 136-137 8.1375 0.0 0.0 0.0 0.0 138-139 8.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACCA 10 0.006830828 145.0 5 CGGACAC 10 0.006830828 145.0 3 >>END_MODULE SRR6958364 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958364_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8005 33.0 33.0 34.0 32.0 34.0 2 32.81325 34.0 33.0 34.0 32.0 34.0 3 32.87125 34.0 33.0 34.0 32.0 34.0 4 32.86825 34.0 33.0 34.0 33.0 34.0 5 32.84125 34.0 33.0 34.0 32.0 34.0 6 36.9575 38.0 38.0 38.0 37.0 38.0 7 37.014 38.0 38.0 38.0 37.0 38.0 8 37.00475 38.0 38.0 38.0 37.0 38.0 9 36.98375 38.0 38.0 38.0 37.0 38.0 10-14 36.92954999999999 38.0 38.0 38.0 37.0 38.0 15-19 36.900850000000005 38.0 38.0 38.0 36.8 38.0 20-24 36.90575 38.0 38.0 38.0 37.0 38.0 25-29 36.8214 38.0 38.0 38.0 36.6 38.0 30-34 36.823949999999996 38.0 38.0 38.0 36.6 38.0 35-39 36.830200000000005 38.0 38.0 38.0 37.0 38.0 40-44 36.7836 38.0 38.0 38.0 36.2 38.0 45-49 36.80275 38.0 38.0 38.0 36.4 38.0 50-54 36.675 38.0 38.0 38.0 36.0 38.0 55-59 36.61565 38.0 38.0 38.0 36.0 38.0 60-64 36.6499 38.0 38.0 38.0 36.0 38.0 65-69 36.5843 38.0 38.0 38.0 36.0 38.0 70-74 36.51535 38.0 38.0 38.0 35.4 38.0 75-79 36.5311 38.0 38.0 38.0 35.0 38.0 80-84 36.465599999999995 38.0 38.0 38.0 35.0 38.0 85-89 36.273900000000005 38.0 38.0 38.0 34.4 38.0 90-94 36.2082 38.0 38.0 38.0 34.2 38.0 95-99 36.065000000000005 38.0 38.0 38.0 34.0 38.0 100-104 35.9785 38.0 38.0 38.0 33.8 38.0 105-109 35.84824999999999 38.0 38.0 38.0 33.4 38.0 110-114 35.58729999999999 38.0 38.0 38.0 32.4 38.0 115-119 35.48075 38.0 37.4 38.0 32.2 38.0 120-124 35.46465 38.0 37.4 38.0 31.6 38.0 125-129 35.38484999999999 38.0 36.8 38.0 31.8 38.0 130-134 35.075900000000004 38.0 36.2 38.0 29.8 38.0 135-139 34.9403 38.0 36.0 38.0 30.0 38.0 140-144 34.536 38.0 36.0 38.0 28.0 38.0 145-149 33.69855 38.0 34.2 38.0 21.4 38.0 150-151 29.669 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 10.0 4 2.0 5 2.0 6 3.0 7 2.0 8 2.0 9 2.0 10 2.0 11 5.0 12 4.0 13 4.0 14 3.0 15 1.0 16 3.0 17 2.0 18 1.0 19 3.0 20 6.0 21 5.0 22 4.0 23 3.0 24 12.0 25 13.0 26 22.0 27 24.0 28 20.0 29 26.0 30 39.0 31 45.0 32 65.0 33 91.0 34 113.0 35 223.0 36 478.0 37 2727.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.825 19.475 11.125 28.575 2 30.210949271722754 23.380210949271724 24.10848819688599 22.30035158211954 3 24.96860085405677 25.14443607133886 26.90278824415976 22.984174830444612 4 27.297840281265696 30.562531391260674 18.960321446509294 23.17930688096434 5 28.603716725263688 32.32044198895028 18.006027122049222 21.069814163736815 6 23.53088900050226 33.50075339025616 20.165745856353592 22.802611752887998 7 23.229532898041185 19.512807634354594 31.717729784028126 25.53992968357609 8 25.382877228219936 23.07306050715541 22.144112478031637 29.399949786593023 9 23.304871923656453 23.70668006027122 25.715720743345056 27.27272727272727 10-14 26.27825213460573 25.082872928176798 22.315419387242592 26.323455549974888 15-19 26.17935192162773 25.174579251444364 23.21527254458679 25.430796282341124 20-24 26.077348066298345 25.565042692114513 23.01356102461075 25.344048216976393 25-29 26.451677717500505 24.849306811332127 23.030942334739805 25.668073136427566 30-34 26.456408196062675 24.909602249899557 23.237243873041383 25.396745680996386 35-39 25.65416101652353 25.312641253578423 23.117874541710613 25.915323188187433 40-44 26.468815908406146 24.630912925579995 23.034046399517926 25.866224766495932 45-49 26.544139801144922 24.580696997087475 22.993873656723913 25.88128954504369 50-54 26.48284867661092 24.72502636733464 23.454371955200642 25.3377530008538 55-59 27.360385697067098 24.176376054640418 23.46826034552029 24.9949779027722 60-64 26.531739654479715 24.703696263559664 23.282442748091604 25.482121333869024 65-69 26.85315387705906 24.54801124949779 23.08658095620731 25.51225391723584 70-74 26.53440482169764 24.465092918131592 23.510798593671524 25.489703666499246 75-79 26.567913632939995 24.730102937484308 23.2538287722822 25.448154657293497 80-84 26.519031836898666 24.876970975193334 23.50105453449834 25.10294265340966 85-89 26.851805353286796 24.61206247175212 23.32647014513132 25.20966202982976 90-94 26.550494651735047 24.878220258122834 23.793501732536534 24.777783357605585 95-99 26.648586208628394 24.95103209281302 23.484506051931092 24.91587564662749 100-104 27.046710195881467 24.465092918131592 23.07885484681065 25.40934203917629 105-109 26.781499522924722 24.506603726209008 23.52232210113996 25.18957464972631 110-114 26.675037669512808 24.927172275238576 23.53088900050226 24.86690105474636 115-119 26.83306548814785 24.984933708316593 23.2774206508638 24.904580152671755 120-124 27.18232044198895 25.107985936715217 23.023606228026118 24.686087393269716 125-129 27.28231394998494 25.253590438887212 23.244953299186502 24.219142311941347 130-134 27.84110882338171 25.546125646562544 22.66358660171747 23.94917892833827 135-139 27.257205985738675 25.876267952194436 23.044089585216433 23.822436476850456 140-144 28.585777420650864 25.833668139815185 22.790277219766974 22.790277219766974 145-149 27.73843604037969 25.4582893877756 23.168098036261362 23.635176535583348 150-151 27.624309392265197 26.04218985434455 23.2420894023104 23.09141135107986 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 8.5 2 5.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.5 25 0.5 26 0.0 27 1.0 28 4.5 29 4.5 30 4.5 31 7.0 32 8.0 33 9.5 34 15.0 35 19.0 36 28.0 37 39.0 38 57.0 39 70.5 40 85.5 41 102.0 42 115.5 43 153.5 44 181.0 45 177.5 46 177.5 47 174.5 48 166.0 49 168.0 50 151.5 51 149.0 52 144.0 53 116.0 54 105.0 55 111.0 56 105.5 57 105.0 58 108.0 59 99.0 60 94.5 61 98.0 62 89.5 63 74.5 64 85.5 65 87.0 66 69.5 67 62.0 68 61.5 69 59.0 70 55.0 71 40.5 72 30.5 73 31.5 74 24.5 75 17.0 76 14.5 77 9.5 78 4.5 79 1.0 80 0.5 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.475 4 0.44999999999999996 5 0.44999999999999996 6 0.44999999999999996 7 0.44999999999999996 8 0.42500000000000004 9 0.44999999999999996 10-14 0.44999999999999996 15-19 0.475 20-24 0.44999999999999996 25-29 0.45999999999999996 30-34 0.44 35-39 0.445 40-44 0.43 45-49 0.43 50-54 0.445 55-59 0.44 60-64 0.44 65-69 0.44 70-74 0.44999999999999996 75-79 0.42500000000000004 80-84 0.43 85-89 0.43499999999999994 90-94 0.43499999999999994 95-99 0.445 100-104 0.44999999999999996 105-109 0.43499999999999994 110-114 0.44999999999999996 115-119 0.44 120-124 0.44999999999999996 125-129 0.43 130-134 0.43499999999999994 135-139 0.43 140-144 0.44 145-149 0.445 150-151 0.44999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88353209845216 97.425 2 0.9895965490992134 1.95 3 0.025374270489723422 0.075 4 0.025374270489723422 0.1 5 0.050748540979446845 0.25 6 0.0 0.0 7 0.0 0.0 8 0.025374270489723422 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.4874999999999998 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.8 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.85 0.0 0.0 0.0 0.0 118-119 3.25 0.0 0.0 0.0 0.0 120-121 3.6375 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.637499999999999 0.0 0.0 0.0 0.0 126-127 5.0875 0.0 0.0 0.0 0.0 128-129 5.725 0.0 0.0 0.0 0.0 130-131 6.300000000000001 0.0 0.0 0.0 0.0 132-133 6.85 0.0 0.0 0.0 0.0 134-135 7.487500000000001 0.0 0.0 0.0 0.0 136-137 8.1125 0.0 0.0 0.0 0.0 138-139 8.912500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCGAGG 10 0.006830828 145.0 2 >>END_MODULE Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044793 spots for SRR6958364.sra Written 1044793 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra Read 1044786 spots for SRR6958364.sra Written 1044786 spots for SRR6958364.sra SRR ids: ['SRR6958364.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s47bfpqb SRR6958364.sra spots: 20895727 blocks: [[1, 1044786], [1044787, 2089572], [2089573, 3134358], [3134359, 4179144], [4179145, 5223930], [5223931, 6268716], [6268717, 7313502], [7313503, 8358288], [8358289, 9403074], [9403075, 10447860], [10447861, 11492646], [11492647, 12537432], [12537433, 13582218], [13582219, 14627004], [14627005, 15671790], [15671791, 16716576], [16716577, 17761362], [17761363, 18806148], [18806149, 19850934], [19850935, 20895727]] SRR6958364 file size 7059175 SRR6958364 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958364 SRR6958364_1.fastq SRR6958364_2.fastq Input file: SRR6958364_1.fastq Paired file: SRR6958364_2.fastq trimmed: SRR6958364-trimmed-pair1.fastq, SRR6958364-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:06:43 2024 >> started Fri Dec 6 21:07:04 2024 >> done (20.903s) 20895727 read pairs processed; of these: 45757 ( 0.22%) short read pairs filtered out after trimming by size control 87456 ( 0.42%) empty read pairs filtered out after trimming by size control 20762514 (99.36%) read pairs available; of these: 10116760 (48.73%) trimmed read pairs available after processing 10645754 (51.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 11 0.00% 20 8 0.00% 21 7 0.00% 22 5 0.00% 23 10 0.00% 24 12 0.00% 25 6 0.00% 26 8 0.00% 27 11 0.00% 28 9 0.00% 29 17 0.00% 30 6 0.00% 31 11 0.00% 32 13 0.00% 33 8 0.00% 34 6 0.00% 35 17 0.00% 36 13 0.00% 37 12 0.00% 38 13 0.00% 39 16 0.00% 40 11 0.00% 41 21 0.00% 42 12 0.00% 43 25 0.00% 44 26 0.00% 45 32 0.00% 46 18 0.00% 47 31 0.00% 48 35 0.00% 49 46 0.00% 50 44 0.00% 51 65 0.00% 52 58 0.00% 53 85 0.00% 54 77 0.00% 55 82 0.00% 56 94 0.00% 57 111 0.00% 58 125 0.00% 59 146 0.00% 60 155 0.00% 61 209 0.00% 62 239 0.00% 63 229 0.00% 64 269 0.00% 65 338 0.00% 66 369 0.00% 67 384 0.00% 68 463 0.00% 69 534 0.00% 70 646 0.00% 71 757 0.00% 72 916 0.00% 73 986 0.00% 74 1099 0.01% 75 1243 0.01% 76 1462 0.01% 77 1717 0.01% 78 1912 0.01% 79 2078 0.01% 80 2392 0.01% 81 2808 0.01% 82 3164 0.02% 83 3653 0.02% 84 5694 0.03% 85 6862 0.03% 86 7376 0.04% 87 7878 0.04% 88 8456 0.04% 89 8686 0.04% 90 9334 0.04% 91 10053 0.05% 92 10686 0.05% 93 11499 0.06% 94 12453 0.06% 95 13659 0.07% 96 14198 0.07% 97 15095 0.07% 98 15977 0.08% 99 17044 0.08% 100 18215 0.09% 101 19473 0.09% 102 21122 0.10% 103 22671 0.11% 104 23682 0.11% 105 25252 0.12% 106 26651 0.13% 107 28176 0.14% 108 29557 0.14% 109 30593 0.15% 110 32169 0.15% 111 33926 0.16% 112 35890 0.17% 113 37537 0.18% 114 39957 0.19% 115 41765 0.20% 116 43483 0.21% 117 45373 0.22% 118 46550 0.22% 119 47953 0.23% 120 50023 0.24% 121 51894 0.25% 122 54037 0.26% 123 56415 0.27% 124 59567 0.29% 125 61579 0.30% 126 63590 0.31% 127 65708 0.32% 128 67334 0.32% 129 69214 0.33% 130 71175 0.34% 131 73591 0.35% 132 76551 0.37% 133 79923 0.38% 134 82760 0.40% 135 85882 0.41% 136 88392 0.43% 137 90856 0.44% 138 93670 0.45% 139 98086 0.47% 140 101856 0.49% 141 107969 0.52% 142 116096 0.56% 143 124271 0.60% 144 137220 0.66% 145 156931 0.76% 146 186508 0.90% 147 240537 1.16% 148 352049 1.70% 149 731499 3.52% 150 5567245 26.81% 151 10645754 51.27% 20762514 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=30 prefix-density=0.66 prefix-fanout=2.5 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=23.00 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.98 fanout-score-rank=22 prefix-density=0.91 prefix-fanout=1.9 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=94.15 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=4.4 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958364 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:07:50 Started mapping on | Dec 06 21:07:50 Finished on | Dec 06 21:09:34 Mapping speed, Million of reads per hour | 718.70 Number of input reads | 20762514 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 20088826 Uniquely mapped reads % | 96.76% Average mapped length | 293.47 Number of splices: Total | 21300502 Number of splices: Annotated (sjdb) | 19967828 Number of splices: GT/AG | 21012954 Number of splices: GC/AG | 248806 Number of splices: AT/AC | 7705 Number of splices: Non-canonical | 31037 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.61 Insertion rate per base | 0.01% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 167631 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 12300 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.08% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 533551 533551 533551 N_multimapping 167631 167631 167631 N_noFeature 577895 19516547 727525 N_ambiguous 500596 2699 78597 UnstrandedReadsAssigned:19010335 PositiveStrandReadsAssigned:569580 NegativeStrandReadsAssigned:19282704 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958364 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958364-trimmed-pair1.fastq SRR6958364-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,762,514 reads, 19,275,055 reads pseudoaligned [quant] estimated average fragment length: 239.08 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR6958364.ke.tsv 35125 SRR6958364.se.tsv 88098 total ==> SRR6958364.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.284 0 0 PNS24247 1044 805.92 66.622 5.99973 PNS24249 1928 1689.92 82.7121 3.5523 PNS24246 1044 805.92 66.622 5.99973 PNS24248 1044 805.92 66.622 5.99973 PNS24244 1471 1232.92 54.422 3.20365 PNS24243 293 98.1903 0 0 KQK14069 1603 1364.92 3993.01 212.324 KQK14071 474 246.416 103.76 30.5608 ==> SRR6958364.se.tsv <== BRADI_1g14170v3 4472 BRADI_1g53295v3 252 BRADI_1g59795v3 348 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 229 BRADI_1g74790v3 163 BRADI_1g09890v3 0 BRADI_1g77505v3 286 BRADI_1g48960v3 0 SRR6958364 completed mapping pipeline successfully