Starting /dee2/code/volunteer_pipeline.sh SRR6958365 current disk space = 1549160275968 free memory = 1594987708 SRR6958365 SRAfilesize 5ef9366d9b4cdccbcb2ad234ae5bb7c6 SRR6958365.sra SRR6958365.sra file validated SRR6958365 is paired end SRR6958365 is conventional basespace SRR6958365 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958365_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.43225 32.0 18.0 33.0 18.0 33.0 2 25.73 27.0 18.0 31.0 18.0 33.0 3 28.9015 29.0 27.0 31.0 25.0 33.0 4 30.879 31.0 29.0 33.0 28.0 33.0 5 31.99975 33.0 31.0 33.0 31.0 33.0 6 35.6915 37.0 35.0 38.0 31.0 38.0 7 37.35125 38.0 38.0 38.0 36.0 38.0 8 37.40175 38.0 38.0 38.0 37.0 38.0 9 37.51425 38.0 38.0 38.0 37.0 38.0 10-14 37.5081 38.0 38.0 38.0 37.4 38.0 15-19 37.52545 38.0 38.0 38.0 37.8 38.0 20-24 37.60785 38.0 38.0 38.0 38.0 38.0 25-29 37.5602 38.0 38.0 38.0 38.0 38.0 30-34 37.43255 38.0 38.0 38.0 37.6 38.0 35-39 37.540800000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.6105 38.0 38.0 38.0 38.0 38.0 45-49 37.5642 38.0 38.0 38.0 38.0 38.0 50-54 37.3976 38.0 38.0 38.0 37.6 38.0 55-59 37.466150000000006 38.0 38.0 38.0 37.4 38.0 60-64 37.55385 38.0 38.0 38.0 38.0 38.0 65-69 37.58265 38.0 38.0 38.0 38.0 38.0 70-74 37.267849999999996 38.0 38.0 38.0 36.4 38.0 75-79 37.52005 38.0 38.0 38.0 37.8 38.0 80-84 37.4585 38.0 38.0 38.0 37.4 38.0 85-89 37.270849999999996 38.0 38.0 38.0 37.0 38.0 90-94 36.0206 38.0 37.0 38.0 31.4 38.0 95-99 36.31034999999999 38.0 37.4 38.0 32.8 38.0 100-104 36.378 38.0 37.8 38.0 33.8 38.0 105-109 36.4731 38.0 38.0 38.0 34.2 38.0 110-114 36.30485 38.0 38.0 38.0 33.4 38.0 115-119 36.8017 38.0 38.0 38.0 34.8 38.0 120-124 36.94195 38.0 38.0 38.0 35.2 38.0 125-129 36.912499999999994 38.0 38.0 38.0 35.2 38.0 130-134 36.7815 38.0 38.0 38.0 35.0 38.0 135-139 36.75595 38.0 38.0 38.0 35.0 38.0 140-144 36.38555 38.0 38.0 38.0 34.0 38.0 145-149 35.85335 38.0 38.0 38.0 33.0 38.0 150-151 29.862125 35.5 19.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 2.0 19 0.0 20 1.0 21 2.0 22 5.0 23 1.0 24 3.0 25 3.0 26 3.0 27 7.0 28 12.0 29 22.0 30 24.0 31 36.0 32 45.0 33 84.0 34 118.0 35 232.0 36 717.0 37 2679.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.553945249597426 12.80193236714976 8.293075684380032 42.351046698872786 2 22.625 16.975 31.474999999999998 28.925 3 21.425 19.6 24.099999999999998 34.875 4 26.974999999999998 26.400000000000002 22.1 24.525 5 26.224999999999998 29.575000000000003 22.675 21.525 6 21.75 32.75 24.95 20.549999999999997 7 15.925 24.65 40.475 18.95 8 18.825 24.525 29.349999999999998 27.3 9 18.5 21.65 34.425 25.424999999999997 10-14 21.63 27.515 25.679999999999996 25.174999999999997 15-19 21.95 26.015 26.33 25.705 20-24 21.593354351198517 26.462493119151283 26.812790872241404 25.131361657408796 25-29 22.045 26.325 26.939999999999998 24.69 30-34 21.98 26.200000000000003 26.265 25.555 35-39 22.055 26.119999999999997 26.66 25.165 40-44 22.264999999999997 26.205000000000002 26.325 25.205 45-49 22.435 26.064999999999998 26.540000000000003 24.959999999999997 50-54 21.825 26.915 26.724999999999998 24.535 55-59 22.49 25.779999999999998 26.295 25.435000000000002 60-64 21.965 26.240000000000002 26.119999999999997 25.674999999999997 65-69 22.605 26.064999999999998 26.21 25.119999999999997 70-74 22.27 25.245 26.924999999999997 25.56 75-79 22.41 25.825 26.05 25.715 80-84 22.145 26.174999999999997 26.61 25.069999999999997 85-89 23.04 26.005 26.07 24.884999999999998 90-94 22.07 25.919999999999998 26.590000000000003 25.419999999999998 95-99 21.87 25.895000000000003 26.52 25.715 100-104 22.56 25.729999999999997 26.450000000000003 25.259999999999998 105-109 22.675 26.05 26.325 24.95 110-114 22.595000000000002 26.05 25.52 25.835 115-119 22.86 26.119999999999997 26.075 24.945 120-124 22.305 26.015 26.27 25.41 125-129 22.715 25.775 26.400000000000002 25.11 130-134 22.96 26.025 25.88 25.135 135-139 23.01 26.295 25.685000000000002 25.009999999999998 140-144 22.765 26.66 25.345000000000002 25.230000000000004 145-149 22.68 26.35 25.505 25.465 150-151 23.075000000000003 25.0625 27.1 24.762500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 2.0 26 2.5 27 2.5 28 5.5 29 6.0 30 9.5 31 12.0 32 13.0 33 22.5 34 29.0 35 36.5 36 53.5 37 71.5 38 102.0 39 133.5 40 153.0 41 176.5 42 191.0 43 213.0 44 227.0 45 233.0 46 236.5 47 209.5 48 194.5 49 196.5 50 186.0 51 165.0 52 139.5 53 109.5 54 100.0 55 87.5 56 70.0 57 70.5 58 54.5 59 47.0 60 53.0 61 41.0 62 34.0 63 34.0 64 30.5 65 29.5 66 40.0 67 44.5 68 27.0 69 20.0 70 18.0 71 14.0 72 12.5 73 11.0 74 11.0 75 7.5 76 5.0 77 2.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.8500000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.08499999999999999 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.0999999999999996 0.0 0.0 0.0 0.0 120-121 2.3125 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.9000000000000004 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.5125 0.0 0.0 0.0 0.0 130-131 3.9375 0.0 0.0 0.0 0.0 132-133 4.387499999999999 0.0 0.0 0.0 0.0 134-135 4.9125 0.0 0.0 0.0 0.0 136-137 5.4 0.0 0.0 0.0 0.0 138-139 5.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958365 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958365_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10375 33.0 33.0 34.0 33.0 34.0 2 33.2475 34.0 33.0 34.0 33.0 34.0 3 33.2955 34.0 33.0 34.0 33.0 34.0 4 33.29825 34.0 33.0 34.0 33.0 34.0 5 33.23675 34.0 33.0 34.0 33.0 34.0 6 37.3675 38.0 38.0 38.0 37.0 38.0 7 37.338 38.0 38.0 38.0 37.0 38.0 8 37.41125 38.0 38.0 38.0 37.0 38.0 9 37.26175 38.0 38.0 38.0 37.0 38.0 10-14 37.195 38.0 38.0 38.0 37.0 38.0 15-19 37.147999999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.19445 38.0 38.0 38.0 37.0 38.0 25-29 37.2457 38.0 38.0 38.0 37.2 38.0 30-34 37.311 38.0 38.0 38.0 37.6 38.0 35-39 37.408100000000005 38.0 38.0 38.0 37.8 38.0 40-44 37.43715 38.0 38.0 38.0 38.0 38.0 45-49 37.34045 38.0 38.0 38.0 38.0 38.0 50-54 37.2578 38.0 38.0 38.0 37.2 38.0 55-59 36.991 38.0 38.0 38.0 36.4 38.0 60-64 36.4778 38.0 37.8 38.0 34.0 38.0 65-69 36.8452 38.0 38.0 38.0 36.0 38.0 70-74 36.98825 38.0 38.0 38.0 36.6 38.0 75-79 36.97345 38.0 38.0 38.0 36.4 38.0 80-84 36.826299999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.610049999999994 38.0 38.0 38.0 35.0 38.0 90-94 36.5735 38.0 38.0 38.0 34.8 38.0 95-99 36.9788 38.0 38.0 38.0 36.2 38.0 100-104 36.95805 38.0 38.0 38.0 36.0 38.0 105-109 36.9266 38.0 38.0 38.0 36.0 38.0 110-114 36.79995 38.0 38.0 38.0 35.6 38.0 115-119 36.574799999999996 38.0 38.0 38.0 34.8 38.0 120-124 36.3822 38.0 38.0 38.0 34.2 38.0 125-129 34.39815 38.0 34.4 38.0 25.6 38.0 130-134 36.1411 38.0 38.0 38.0 33.8 38.0 135-139 36.202299999999994 38.0 38.0 38.0 34.0 38.0 140-144 35.9953 38.0 38.0 38.0 33.6 38.0 145-149 35.6132 38.0 37.4 38.0 32.8 38.0 150-151 31.792 35.5 33.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 6.0 4 3.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 2.0 11 0.0 12 2.0 13 3.0 14 0.0 15 1.0 16 2.0 17 0.0 18 1.0 19 1.0 20 3.0 21 6.0 22 5.0 23 7.0 24 6.0 25 11.0 26 8.0 27 12.0 28 25.0 29 16.0 30 38.0 31 32.0 32 46.0 33 74.0 34 112.0 35 183.0 36 482.0 37 2907.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.225 18.575 12.375 31.825 2 30.125 23.849999999999998 28.625 17.4 3 22.3 26.85 29.349999999999998 21.5 4 24.15 32.925 21.95 20.974999999999998 5 27.075 33.15 21.2 18.575 6 22.35 36.775000000000006 20.974999999999998 19.900000000000002 7 22.3 18.725 36.875 22.1 8 24.625 23.075000000000003 24.575 27.725 9 24.5 22.775000000000002 27.375 25.35 10-14 25.46 26.63 24.525 23.385 15-19 25.22 25.929999999999996 25.405 23.445 20-24 25.495 26.375 24.735 23.395 25-29 25.535000000000004 26.63 25.465 22.37 30-34 25.215 26.584999999999997 25.095 23.105 35-39 25.06 26.495 25.435000000000002 23.01 40-44 25.155 26.085 25.790000000000003 22.97 45-49 26.179999999999996 26.395000000000003 24.635 22.79 50-54 25.34 25.974999999999998 25.855 22.830000000000002 55-59 25.3 26.13 25.405 23.165 60-64 25.155 26.290000000000003 25.52 23.035 65-69 25.21 26.455000000000002 25.314999999999998 23.02 70-74 25.945 26.38 24.94 22.735 75-79 25.205 25.85 26.44 22.505 80-84 25.385 26.334999999999997 25.69 22.59 85-89 25.8 25.94 25.25 23.01 90-94 25.535000000000004 26.695 25.41 22.36 95-99 25.505 26.39 25.724999999999998 22.38 100-104 25.335 26.11 25.97 22.585 105-109 25.515 26.665 26.185000000000002 21.634999999999998 110-114 25.874999999999996 26.875 25.165 22.085 115-119 25.679999999999996 26.47 25.319999999999997 22.53 120-124 25.424999999999997 27.125 25.345000000000002 22.105 125-129 26.57 26.479999999999997 25.259999999999998 21.69 130-134 25.81 26.875 25.3 22.015 135-139 26.445 27.12 24.955 21.48 140-144 26.815 26.884999999999998 25.2 21.099999999999998 145-149 26.195 26.525 25.369999999999997 21.91 150-151 27.625 26.325 25.587500000000002 20.4625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 0.5 28 2.5 29 6.0 30 9.0 31 12.5 32 17.5 33 21.5 34 26.0 35 28.0 36 46.0 37 70.5 38 91.5 39 124.5 40 148.0 41 172.0 42 201.0 43 205.0 44 194.5 45 207.5 46 225.0 47 232.0 48 215.0 49 175.0 50 155.0 51 147.0 52 118.5 53 97.0 54 100.5 55 96.5 56 91.5 57 90.0 58 69.5 59 55.0 60 59.5 61 53.5 62 54.0 63 56.0 64 44.0 65 36.0 66 41.5 67 40.0 68 32.5 69 28.0 70 19.5 71 20.5 72 20.0 73 13.0 74 10.0 75 6.5 76 3.0 77 2.5 78 2.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39577039274926 98.7 2 0.5035246727089627 1.0 3 0.10070493454179255 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.2625 0.0 0.0 0.0 0.0 122-123 2.5250000000000004 0.0 0.0 0.0 0.0 124-125 2.8499999999999996 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.45 0.0 0.0 0.0 0.0 130-131 3.8625 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.875 0.0 0.0 0.0 0.0 136-137 5.35 0.0 0.0 0.0 0.0 138-139 5.800000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905765 spots for SRR6958365.sra Written 905765 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra Read 905752 spots for SRR6958365.sra Written 905752 spots for SRR6958365.sra SRR ids: ['SRR6958365.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zr531aea SRR6958365.sra spots: 18115053 blocks: [[1, 905752], [905753, 1811504], [1811505, 2717256], [2717257, 3623008], [3623009, 4528760], [4528761, 5434512], [5434513, 6340264], [6340265, 7246016], [7246017, 8151768], [8151769, 9057520], [9057521, 9963272], [9963273, 10869024], [10869025, 11774776], [11774777, 12680528], [12680529, 13586280], [13586281, 14492032], [14492033, 15397784], [15397785, 16303536], [16303537, 17209288], [17209289, 18115053]] SRR6958365 file size 6116896 SRR6958365 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958365 SRR6958365_1.fastq SRR6958365_2.fastq Input file: SRR6958365_1.fastq Paired file: SRR6958365_2.fastq trimmed: SRR6958365-trimmed-pair1.fastq, SRR6958365-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:07:14 2024 >> started Fri Dec 6 21:07:46 2024 >> done (32.468s) 18115053 read pairs processed; of these: 10401 ( 0.06%) short read pairs filtered out after trimming by size control 7145 ( 0.04%) empty read pairs filtered out after trimming by size control 18097507 (99.90%) read pairs available; of these: 5698899 (31.49%) trimmed read pairs available after processing 12398608 (68.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 4 0.00% 24 3 0.00% 25 7 0.00% 26 8 0.00% 27 4 0.00% 28 3 0.00% 29 6 0.00% 30 8 0.00% 31 1 0.00% 32 5 0.00% 33 3 0.00% 34 11 0.00% 35 13 0.00% 36 7 0.00% 37 8 0.00% 38 4 0.00% 39 8 0.00% 40 10 0.00% 41 13 0.00% 42 10 0.00% 43 15 0.00% 44 14 0.00% 45 21 0.00% 46 25 0.00% 47 19 0.00% 48 20 0.00% 49 25 0.00% 50 31 0.00% 51 25 0.00% 52 28 0.00% 53 36 0.00% 54 33 0.00% 55 46 0.00% 56 53 0.00% 57 47 0.00% 58 67 0.00% 59 93 0.00% 60 99 0.00% 61 119 0.00% 62 116 0.00% 63 135 0.00% 64 169 0.00% 65 154 0.00% 66 181 0.00% 67 202 0.00% 68 261 0.00% 69 273 0.00% 70 318 0.00% 71 411 0.00% 72 474 0.00% 73 537 0.00% 74 626 0.00% 75 689 0.00% 76 738 0.00% 77 845 0.00% 78 978 0.01% 79 1092 0.01% 80 1312 0.01% 81 1488 0.01% 82 1770 0.01% 83 1930 0.01% 84 2637 0.01% 85 3136 0.02% 86 3326 0.02% 87 3697 0.02% 88 3903 0.02% 89 4179 0.02% 90 4710 0.03% 91 5117 0.03% 92 5391 0.03% 93 6253 0.03% 94 6621 0.04% 95 7070 0.04% 96 7741 0.04% 97 8118 0.04% 98 8644 0.05% 99 9212 0.05% 100 9961 0.06% 101 10556 0.06% 102 11641 0.06% 103 12697 0.07% 104 13586 0.08% 105 14491 0.08% 106 15429 0.09% 107 15786 0.09% 108 16640 0.09% 109 17461 0.10% 110 18062 0.10% 111 19158 0.11% 112 20734 0.11% 113 21848 0.12% 114 23395 0.13% 115 24886 0.14% 116 25828 0.14% 117 26526 0.15% 118 27824 0.15% 119 28292 0.16% 120 29231 0.16% 121 30595 0.17% 122 32267 0.18% 123 33946 0.19% 124 35626 0.20% 125 37325 0.21% 126 38550 0.21% 127 39778 0.22% 128 40659 0.22% 129 41623 0.23% 130 43210 0.24% 131 44404 0.25% 132 46234 0.26% 133 49274 0.27% 134 51260 0.28% 135 52912 0.29% 136 55719 0.31% 137 58071 0.32% 138 59692 0.33% 139 61728 0.34% 140 64619 0.36% 141 67932 0.38% 142 73085 0.40% 143 78602 0.43% 144 86791 0.48% 145 98048 0.54% 146 113003 0.62% 147 139980 0.77% 148 195308 1.08% 149 365353 2.02% 150 3053859 16.87% 151 12398608 68.51% 18097507 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=6.21 fanout-score-rank=22 prefix-density=0.46 prefix-fanout=3.9 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=69.28 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=18.8 sequence=TTCTCCTCCTTG criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=30.01 fanout-score-rank=5 prefix-density=1.00 prefix-fanout=7.1 sequence=AAGGAGAAGCTGCCTGGCCAGCACTGAGCGCCTCGCAGTCGCAGGTTGCCTAGCTCGACTTGTGAGAGTTGAGCTACGTATAGTACCAGCTGGCCACCCTCTGAGAATACTATACTGTAATAAGATGAAGAAGAATAAAATTCCCACGATCACATGTACTGTTATACTGAGAGTAGAGTCTGTACCGTGGGATTTATACCGTACGTCGTTGTGTAAATTTCCTTTTAATTTGTTTGAATCGTGAATCGTATATGTATGTTCACATGTACACTGTGTTCTTCTGTTCAGAACTTGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=71.69 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=15.8 sequence=GGAGAAGATCAAGGA SRR6958365 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:09:02 Started mapping on | Dec 06 21:09:03 Finished on | Dec 06 21:10:58 Mapping speed, Million of reads per hour | 566.53 Number of input reads | 18097507 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17522742 Uniquely mapped reads % | 96.82% Average mapped length | 296.18 Number of splices: Total | 20118168 Number of splices: Annotated (sjdb) | 19013148 Number of splices: GT/AG | 19865179 Number of splices: GC/AG | 215232 Number of splices: AT/AC | 8826 Number of splices: Non-canonical | 28931 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.01% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 165540 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 18833 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.53% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 416777 416777 416777 N_multimapping 165540 165540 165540 N_noFeature 739370 17071044 880896 N_ambiguous 364370 2320 55448 UnstrandedReadsAssigned:16419002 PositiveStrandReadsAssigned:449378 NegativeStrandReadsAssigned:16586398 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958365 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958365-trimmed-pair1.fastq SRR6958365-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,097,507 reads, 16,587,183 reads pseudoaligned [quant] estimated average fragment length: 255.434 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,237 rounds 52973 SRR6958365.ke.tsv 35125 SRR6958365.se.tsv 88098 total ==> SRR6958365.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.994 5.42528 0.724151 PNS24247 1044 789.566 50.5954 5.83325 PNS24249 1928 1673.57 50.4752 2.74551 PNS24246 1044 789.566 50.5954 5.83325 PNS24248 1044 789.566 50.5954 5.83325 PNS24244 1471 1216.57 78.3132 5.85985 PNS24243 293 90.8409 0 0 KQK14069 1603 1348.57 598.542 40.4026 KQK14071 474 234.516 14.3055 5.55287 ==> SRR6958365.se.tsv <== BRADI_1g14170v3 746 BRADI_1g53295v3 447 BRADI_1g59795v3 251 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 678 BRADI_1g74790v3 403 BRADI_1g09890v3 0 BRADI_1g77505v3 264 BRADI_1g48960v3 0 SRR6958365 completed mapping pipeline successfully