Starting /dee2/code/volunteer_pipeline.sh SRR6958366 current disk space = 1549156151296 free memory = 1600294924 SRR6958366 SRAfilesize d6cb52987c09af78256a72c42ed44c1b SRR6958366.sra SRR6958366.sra file validated SRR6958366 is paired end SRR6958366 is conventional basespace SRR6958366 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958366_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.62325 18.0 18.0 30.0 18.0 33.0 2 24.8705 25.0 18.0 32.0 18.0 32.0 3 29.329 30.0 27.0 33.0 25.0 33.0 4 28.49775 31.0 28.0 33.0 15.0 33.0 5 30.913 32.0 32.0 33.0 27.0 33.0 6 35.091 37.0 34.0 38.0 29.0 38.0 7 35.968 38.0 36.0 38.0 33.0 38.0 8 36.68175 38.0 37.0 38.0 34.0 38.0 9 37.02325 38.0 38.0 38.0 35.0 38.0 10-14 37.29065000000001 38.0 38.0 38.0 36.6 38.0 15-19 37.22465000000001 38.0 38.0 38.0 36.4 38.0 20-24 37.1572 38.0 38.0 38.0 36.2 38.0 25-29 37.036449999999995 38.0 38.0 38.0 35.8 38.0 30-34 36.90024999999999 38.0 38.0 38.0 35.4 38.0 35-39 36.91925 38.0 38.0 38.0 35.4 38.0 40-44 36.932249999999996 38.0 38.0 38.0 35.2 38.0 45-49 36.80585 38.0 38.0 38.0 34.6 38.0 50-54 36.3241 38.0 37.8 38.0 33.4 38.0 55-59 36.4206 38.0 37.6 38.0 33.6 38.0 60-64 36.70385 38.0 38.0 38.0 34.6 38.0 65-69 36.785450000000004 38.0 38.0 38.0 34.8 38.0 70-74 36.32639999999999 38.0 37.4 38.0 33.6 38.0 75-79 36.09345 38.0 37.0 38.0 33.0 38.0 80-84 35.84830000000001 38.0 36.8 38.0 31.2 38.0 85-89 36.1908 38.0 37.0 38.0 33.0 38.0 90-94 36.0283 38.0 36.8 38.0 32.6 38.0 95-99 35.64805 38.0 36.0 38.0 31.0 38.0 100-104 34.9177 38.0 35.0 38.0 27.4 38.0 105-109 34.53475 38.0 34.4 38.0 25.6 38.0 110-114 34.4139 38.0 34.2 38.0 24.8 38.0 115-119 34.25485 38.0 34.0 38.0 24.2 38.0 120-124 33.95665 38.0 34.0 38.0 22.6 38.0 125-129 34.1312 38.0 34.0 38.0 24.2 38.0 130-134 33.88775 38.0 33.8 38.0 23.0 38.0 135-139 33.200450000000004 37.4 33.0 38.0 18.8 38.0 140-144 31.803500000000003 35.8 31.0 38.0 13.6 38.0 145-149 30.26605 35.0 28.6 38.0 10.8 38.0 150-151 26.212125 33.0 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 1.0 18 5.0 19 2.0 20 5.0 21 3.0 22 7.0 23 5.0 24 17.0 25 18.0 26 33.0 27 48.0 28 50.0 29 62.0 30 78.0 31 119.0 32 188.0 33 249.0 34 372.0 35 606.0 36 1158.0 37 969.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.23437084330939 12.769353551476456 5.0811386006916734 40.91513700452248 2 22.275 13.925 26.474999999999998 37.325 3 21.975 15.6 24.224999999999998 38.2 4 26.625 22.025 21.05 30.3 5 27.800000000000004 25.2 22.8 24.2 6 24.425 29.325000000000003 22.225 24.025 7 20.175 24.275 35.925000000000004 19.625 8 21.025 24.3 28.525 26.150000000000002 9 21.0 22.650000000000002 31.1 25.25 10-14 23.119999999999997 25.380000000000003 25.655 25.845000000000002 15-19 23.205000000000002 24.555 25.779999999999998 26.46 20-24 23.915 25.105 25.7 25.28 25-29 23.72 24.725 25.845000000000002 25.71 30-34 24.165 24.755 25.91 25.169999999999998 35-39 23.225 24.45 26.055 26.27 40-44 23.76 24.6 25.745 25.895000000000003 45-49 23.580000000000002 24.615000000000002 25.555 26.25 50-54 23.355 24.98 25.085 26.58 55-59 23.599999999999998 24.87 25.585 25.945 60-64 24.104999999999997 24.315 25.540000000000003 26.040000000000003 65-69 24.07 23.82 25.735000000000003 26.375 70-74 23.84 24.695 25.35 26.115 75-79 24.275 24.27 24.925 26.529999999999998 80-84 23.935000000000002 24.915000000000003 25.16 25.990000000000002 85-89 24.715 24.310000000000002 25.055 25.919999999999998 90-94 24.705 23.855 25.474999999999998 25.965 95-99 24.555 24.345 25.195 25.905 100-104 24.224999999999998 24.075 25.77 25.929999999999996 105-109 24.33 23.73 25.34 26.6 110-114 24.79 24.04 25.22 25.95 115-119 24.745 24.545 25.3 25.41 120-124 24.25 24.104999999999997 25.385 26.26 125-129 24.975 23.805 25.235000000000003 25.985000000000003 130-134 24.72 23.785 25.119999999999997 26.375 135-139 24.884999999999998 23.669999999999998 25.4 26.045 140-144 24.905 23.64 25.15 26.305 145-149 24.59 24.39 24.990000000000002 26.029999999999998 150-151 24.8 23.8125 24.675 26.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.0 28 2.0 29 3.0 30 6.5 31 9.5 32 9.5 33 12.5 34 19.5 35 29.5 36 40.0 37 45.0 38 59.5 39 88.5 40 108.5 41 118.5 42 142.0 43 181.5 44 203.5 45 211.0 46 214.5 47 197.0 48 189.0 49 171.0 50 150.5 51 157.0 52 143.5 53 123.5 54 121.0 55 110.5 56 99.5 57 102.0 58 94.0 59 88.0 60 81.0 61 71.0 62 66.0 63 64.5 64 57.5 65 53.0 66 57.5 67 59.0 68 49.5 69 39.0 70 30.0 71 24.0 72 26.5 73 19.0 74 13.0 75 9.5 76 8.5 77 8.0 78 5.0 79 2.0 80 0.5 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.0249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1679273827534 98.32499999999999 2 0.8068582955118508 1.6 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0125 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0125 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.037500000000000006 0.0 0.0 0.025 0.0 80-81 0.0625 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.0875 0.0 0.0 0.025 0.0 86-87 0.1 0.0 0.0 0.025 0.0 88-89 0.125 0.0 0.0 0.025 0.0 90-91 0.15 0.0 0.0 0.025 0.0 92-93 0.175 0.0 0.0 0.025 0.0 94-95 0.2625 0.0 0.0 0.025 0.0 96-97 0.2875 0.0 0.0 0.025 0.0 98-99 0.3125 0.0 0.0 0.025 0.0 100-101 0.3375 0.0 0.0 0.025 0.0 102-103 0.4125 0.0 0.0 0.025 0.0 104-105 0.4875 0.0 0.0 0.025 0.0 106-107 0.5125 0.0 0.0 0.025 0.0 108-109 0.575 0.0 0.0 0.025 0.0 110-111 0.6499999999999999 0.0 0.0 0.025 0.0 112-113 0.8375 0.0 0.0 0.025 0.0 114-115 1.0375 0.0 0.0 0.025 0.0 116-117 1.3 0.0 0.0 0.025 0.0 118-119 1.5375 0.0 0.0 0.025 0.0 120-121 1.7625000000000002 0.0 0.0 0.025 0.0 122-123 1.9375 0.0 0.0 0.025 0.0 124-125 2.2 0.0 0.0 0.025 0.0 126-127 2.5125 0.0 0.0 0.05 0.0 128-129 2.8 0.0 0.0 0.05 0.0 130-131 3.0875000000000004 0.0 0.0 0.05 0.0 132-133 3.325 0.0 0.0 0.05 0.0 134-135 3.6375 0.0 0.0 0.05 0.0 136-137 4.1 0.0 0.0 0.05 0.0 138-139 4.5875 0.0 0.0 0.05 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGTCGT 10 0.0068396386 144.9375 3 >>END_MODULE SRR6958366 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958366_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.29925 33.0 33.0 34.0 31.0 34.0 2 32.4245 33.0 33.0 34.0 31.0 34.0 3 32.30375 33.0 33.0 34.0 31.0 34.0 4 32.16525 33.0 33.0 34.0 31.0 34.0 5 32.19475 33.0 33.0 34.0 31.0 34.0 6 36.1825 38.0 38.0 38.0 33.0 38.0 7 36.23575 38.0 38.0 38.0 34.0 38.0 8 36.0055 38.0 38.0 38.0 32.0 38.0 9 35.7075 38.0 38.0 38.0 30.0 38.0 10-14 36.12465 38.0 38.0 38.0 32.8 38.0 15-19 36.2724 38.0 38.0 38.0 34.0 38.0 20-24 36.44345 38.0 38.0 38.0 34.4 38.0 25-29 36.21885 38.0 38.0 38.0 33.8 38.0 30-34 36.321349999999995 38.0 38.0 38.0 34.4 38.0 35-39 36.180099999999996 38.0 38.0 38.0 33.4 38.0 40-44 35.9489 38.0 37.8 38.0 32.6 38.0 45-49 35.995850000000004 38.0 38.0 38.0 32.8 38.0 50-54 36.011799999999994 38.0 37.8 38.0 33.0 38.0 55-59 36.1632 38.0 38.0 38.0 33.4 38.0 60-64 35.7706 38.0 37.4 38.0 31.8 38.0 65-69 35.52075 38.0 37.0 38.0 30.2 38.0 70-74 35.278800000000004 38.0 36.8 38.0 29.4 38.0 75-79 35.31269999999999 38.0 36.4 38.0 29.6 38.0 80-84 35.12535 38.0 36.6 38.0 28.6 38.0 85-89 35.222249999999995 38.0 36.6 38.0 29.0 38.0 90-94 34.8731 38.0 35.8 38.0 27.6 38.0 95-99 34.302150000000005 38.0 35.0 38.0 23.0 38.0 100-104 33.8644 38.0 34.2 38.0 21.4 38.0 105-109 33.9877 38.0 34.6 38.0 21.4 38.0 110-114 33.8061 38.0 34.2 38.0 22.2 38.0 115-119 33.016 37.6 32.8 38.0 17.8 38.0 120-124 33.0012 37.8 33.2 38.0 17.4 38.0 125-129 32.2144 37.4 31.6 38.0 14.0 38.0 130-134 31.574749999999995 36.4 30.6 38.0 13.2 38.0 135-139 30.75185 36.0 29.4 38.0 13.0 38.0 140-144 29.8358 35.2 27.4 38.0 10.4 38.0 145-149 27.96995 34.0 21.8 38.0 2.0 38.0 150-151 21.771124999999998 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 8.0 4 4.0 5 5.0 6 1.0 7 3.0 8 2.0 9 0.0 10 5.0 11 6.0 12 4.0 13 4.0 14 5.0 15 5.0 16 8.0 17 6.0 18 5.0 19 8.0 20 9.0 21 11.0 22 28.0 23 13.0 24 32.0 25 30.0 26 54.0 27 64.0 28 69.0 29 84.0 30 92.0 31 112.0 32 158.0 33 228.0 34 350.0 35 482.0 36 864.0 37 1211.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.466466466466464 20.57057057057057 9.684684684684685 28.27827827827828 2 28.15 24.95 25.25 21.65 3 23.05 25.974999999999998 26.424999999999997 24.55 4 25.924999999999997 31.1 20.075000000000003 22.900000000000002 5 27.825 31.85 19.275000000000002 21.05 6 24.099999999999998 33.85 20.200000000000003 21.85 7 23.425 19.15 32.9 24.525 8 24.2 24.425 22.55 28.825 9 23.775 23.525 26.875 25.825 10-14 26.525 25.025 23.07 25.380000000000003 15-19 26.11 25.019999999999996 23.810000000000002 25.06 20-24 25.72 25.955000000000002 23.580000000000002 24.745 25-29 26.11 25.385 23.335 25.169999999999998 30-34 25.855 25.430000000000003 23.68 25.035 35-39 26.19 25.705 23.025000000000002 25.080000000000002 40-44 26.445 25.045 23.465 25.045 45-49 26.395000000000003 24.75 23.965 24.89 50-54 26.775 24.85 23.555 24.82 55-59 27.0 24.560000000000002 23.799999999999997 24.64 60-64 26.484999999999996 24.425 23.965 25.124999999999996 65-69 26.365 25.285000000000004 23.535 24.815 70-74 26.57 24.755 23.895 24.779999999999998 75-79 26.119999999999997 24.875 24.085 24.92 80-84 26.369999999999997 25.324999999999996 23.669999999999998 24.635 85-89 27.07 24.529999999999998 23.53 24.87 90-94 26.43 25.05 23.54 24.98 95-99 26.529999999999998 24.645 24.34 24.485 100-104 26.08 24.945 23.849999999999998 25.124999999999996 105-109 25.855 25.095 24.14 24.91 110-114 26.650000000000002 25.115 23.630000000000003 24.605 115-119 26.515 25.064999999999998 23.97 24.45 120-124 26.729999999999997 25.27 23.7 24.3 125-129 26.240000000000002 25.324999999999996 23.9 24.535 130-134 27.05 25.374999999999996 23.075000000000003 24.5 135-139 26.950000000000003 25.474999999999998 24.044999999999998 23.53 140-144 26.82 25.569999999999997 24.15 23.46 145-149 27.265 26.125 23.169999999999998 23.44 150-151 27.450000000000003 25.025 24.212500000000002 23.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 1.0 26 1.0 27 1.5 28 1.0 29 2.0 30 5.0 31 6.0 32 6.0 33 7.0 34 14.5 35 22.0 36 24.5 37 31.5 38 55.5 39 83.0 40 101.0 41 132.0 42 159.5 43 161.0 44 172.0 45 192.0 46 190.5 47 182.0 48 170.0 49 164.5 50 160.0 51 145.5 52 129.5 53 122.0 54 127.5 55 110.0 56 93.5 57 101.0 58 100.5 59 97.0 60 85.0 61 81.0 62 90.5 63 87.5 64 77.5 65 70.5 66 68.0 67 66.5 68 58.5 69 45.5 70 35.5 71 35.5 72 36.5 73 25.5 74 18.5 75 14.0 76 7.5 77 6.0 78 3.5 79 2.5 80 2.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62630373950648 96.925 2 1.1447468837445942 2.25 3 0.15263291783261257 0.44999999999999996 4 0.02543881963876876 0.1 5 0.02543881963876876 0.125 6 0.02543881963876876 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.7374999999999998 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.4125 0.0 0.0 0.0 0.0 128-129 2.7 0.0 0.0 0.0 0.0 130-131 2.95 0.0 0.0 0.0 0.0 132-133 3.1500000000000004 0.0 0.0 0.0 0.0 134-135 3.4749999999999996 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.387499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTCCC 10 0.006830828 145.0 6 TGTCCCT 15 1.1411342E-4 145.0 7 GTCCCTT 10 0.006830828 145.0 8 TCCCTTC 10 0.006830828 145.0 9 >>END_MODULE Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045949 spots for SRR6958366.sra Written 1045949 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra Read 1045942 spots for SRR6958366.sra Written 1045942 spots for SRR6958366.sra SRR ids: ['SRR6958366.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2_s9xb48 SRR6958366.sra spots: 20918847 blocks: [[1, 1045942], [1045943, 2091884], [2091885, 3137826], [3137827, 4183768], [4183769, 5229710], [5229711, 6275652], [6275653, 7321594], [7321595, 8367536], [8367537, 9413478], [9413479, 10459420], [10459421, 11505362], [11505363, 12551304], [12551305, 13597246], [13597247, 14643188], [14643189, 15689130], [15689131, 16735072], [16735073, 17781014], [17781015, 18826956], [18826957, 19872898], [19872899, 20918847]] SRR6958366 file size 7067010 SRR6958366 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958366 SRR6958366_1.fastq SRR6958366_2.fastq Input file: SRR6958366_1.fastq Paired file: SRR6958366_2.fastq trimmed: SRR6958366-trimmed-pair1.fastq, SRR6958366-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:08:14 2024 >> started Fri Dec 6 21:09:02 2024 >> done (47.652s) 20918847 read pairs processed; of these: 46794 ( 0.22%) short read pairs filtered out after trimming by size control 38938 ( 0.19%) empty read pairs filtered out after trimming by size control 20833115 (99.59%) read pairs available; of these: 9430412 (45.27%) trimmed read pairs available after processing 11402703 (54.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 5 0.00% 22 4 0.00% 23 5 0.00% 24 3 0.00% 25 3 0.00% 26 14 0.00% 27 9 0.00% 28 10 0.00% 29 7 0.00% 30 10 0.00% 31 9 0.00% 32 6 0.00% 33 11 0.00% 34 9 0.00% 35 11 0.00% 36 13 0.00% 37 14 0.00% 38 11 0.00% 39 24 0.00% 40 18 0.00% 41 20 0.00% 42 26 0.00% 43 14 0.00% 44 23 0.00% 45 22 0.00% 46 28 0.00% 47 20 0.00% 48 30 0.00% 49 43 0.00% 50 58 0.00% 51 55 0.00% 52 50 0.00% 53 86 0.00% 54 74 0.00% 55 76 0.00% 56 93 0.00% 57 106 0.00% 58 115 0.00% 59 117 0.00% 60 142 0.00% 61 145 0.00% 62 179 0.00% 63 201 0.00% 64 216 0.00% 65 224 0.00% 66 249 0.00% 67 262 0.00% 68 312 0.00% 69 379 0.00% 70 434 0.00% 71 491 0.00% 72 542 0.00% 73 617 0.00% 74 649 0.00% 75 787 0.00% 76 860 0.00% 77 895 0.00% 78 1038 0.00% 79 1243 0.01% 80 1337 0.01% 81 1547 0.01% 82 1827 0.01% 83 2177 0.01% 84 4123 0.02% 85 5205 0.02% 86 5314 0.03% 87 5401 0.03% 88 5484 0.03% 89 5578 0.03% 90 5753 0.03% 91 6021 0.03% 92 6585 0.03% 93 7034 0.03% 94 7625 0.04% 95 8224 0.04% 96 8398 0.04% 97 9343 0.04% 98 9769 0.05% 99 10147 0.05% 100 11238 0.05% 101 11699 0.06% 102 12771 0.06% 103 13894 0.07% 104 14740 0.07% 105 15594 0.07% 106 16656 0.08% 107 17646 0.08% 108 18635 0.09% 109 19516 0.09% 110 20891 0.10% 111 21933 0.11% 112 23671 0.11% 113 25045 0.12% 114 26367 0.13% 115 28248 0.14% 116 29654 0.14% 117 31012 0.15% 118 32665 0.16% 119 33757 0.16% 120 35721 0.17% 121 37122 0.18% 122 38861 0.19% 123 41126 0.20% 124 43673 0.21% 125 45761 0.22% 126 48036 0.23% 127 50648 0.24% 128 52704 0.25% 129 54831 0.26% 130 57135 0.27% 131 60485 0.29% 132 64155 0.31% 133 67807 0.33% 134 70922 0.34% 135 74612 0.36% 136 78813 0.38% 137 83010 0.40% 138 89032 0.43% 139 94443 0.45% 140 101090 0.49% 141 109718 0.53% 142 120900 0.58% 143 135782 0.65% 144 155818 0.75% 145 184666 0.89% 146 229380 1.10% 147 306368 1.47% 148 464047 2.23% 149 924057 4.44% 150 4956045 23.79% 151 11402703 54.73% 20833115 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=17 prefix-density=0.77 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=62.22 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=4.02 fanout-score-rank=16 prefix-density=0.51 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=53.28 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=7.4 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958366 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:09:44 Started mapping on | Dec 06 21:09:44 Finished on | Dec 06 21:11:26 Mapping speed, Million of reads per hour | 735.29 Number of input reads | 20833115 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 20205489 Uniquely mapped reads % | 96.99% Average mapped length | 295.30 Number of splices: Total | 22815777 Number of splices: Annotated (sjdb) | 21456643 Number of splices: GT/AG | 22514088 Number of splices: GC/AG | 266106 Number of splices: AT/AC | 8164 Number of splices: Non-canonical | 27419 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.60 Insertion rate per base | 0.01% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 180745 % of reads mapped to multiple loci | 0.87% Number of reads mapped to too many loci | 20693 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.47% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 472448 472448 472448 N_multimapping 180745 180745 180745 N_noFeature 516710 19664667 652792 N_ambiguous 479174 2424 75363 UnstrandedReadsAssigned:19209605 PositiveStrandReadsAssigned:538398 NegativeStrandReadsAssigned:19477334 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958366 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958366-trimmed-pair1.fastq SRR6958366-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,833,115 reads, 19,487,750 reads pseudoaligned [quant] estimated average fragment length: 242.46 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR6958366.ke.tsv 35125 SRR6958366.se.tsv 88098 total ==> SRR6958366.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.862 38.6406 4.07995 PNS24247 1044 802.54 56.6391 5.17797 PNS24249 1928 1686.54 46.3035 2.01431 PNS24246 1044 802.54 56.6391 5.17797 PNS24248 1044 802.54 56.6391 5.17797 PNS24244 1471 1229.54 32.1385 1.91775 PNS24243 293 89.814 0 0 KQK14069 1603 1361.54 4643.28 250.21 KQK14071 474 241.23 44.1455 13.4266 ==> SRR6958366.se.tsv <== BRADI_1g14170v3 4968 BRADI_1g53295v3 187 BRADI_1g59795v3 231 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 277 BRADI_1g74790v3 83 BRADI_1g09890v3 0 BRADI_1g77505v3 276 BRADI_1g48960v3 0 SRR6958366 completed mapping pipeline successfully