Starting /dee2/code/volunteer_pipeline.sh SRR6958368 current disk space = 1549134553088 free memory = 1597142792 SRR6958368 SRAfilesize 37acd729b3cd3c88960f952f3c9882b2 SRR6958368.sra SRR6958368.sra file validated SRR6958368 is paired end SRR6958368 is conventional basespace SRR6958368 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958368_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.99225 33.0 32.0 33.0 27.0 34.0 2 29.8335 31.0 29.0 33.0 18.0 33.0 3 31.457 33.0 31.0 33.0 27.0 34.0 4 31.8955 33.0 31.0 33.0 29.0 34.0 5 32.1825 33.0 33.0 34.0 31.0 34.0 6 36.32325 38.0 37.0 38.0 33.0 38.0 7 36.855 38.0 38.0 38.0 35.0 38.0 8 37.04625 38.0 38.0 38.0 35.0 38.0 9 37.06075 38.0 38.0 38.0 36.0 38.0 10-14 37.184349999999995 38.0 38.0 38.0 36.2 38.0 15-19 37.17615 38.0 38.0 38.0 36.2 38.0 20-24 37.31575 38.0 38.0 38.0 37.0 38.0 25-29 37.13680000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.982099999999996 38.0 38.0 38.0 35.6 38.0 35-39 36.9379 38.0 38.0 38.0 35.6 38.0 40-44 36.8623 38.0 38.0 38.0 35.2 38.0 45-49 36.9353 38.0 38.0 38.0 35.6 38.0 50-54 36.904700000000005 38.0 38.0 38.0 35.2 38.0 55-59 36.72235 38.0 38.0 38.0 34.6 38.0 60-64 36.7279 38.0 38.0 38.0 34.2 38.0 65-69 36.7364 38.0 38.0 38.0 34.6 38.0 70-74 36.808299999999996 38.0 38.0 38.0 34.6 38.0 75-79 36.67205 38.0 38.0 38.0 34.2 38.0 80-84 36.231899999999996 38.0 37.6 38.0 33.6 38.0 85-89 36.31895000000001 38.0 37.6 38.0 33.8 38.0 90-94 36.366200000000006 38.0 37.6 38.0 33.6 38.0 95-99 36.33525 38.0 37.4 38.0 33.6 38.0 100-104 36.09195000000001 38.0 37.0 38.0 33.0 38.0 105-109 35.6712 38.0 36.2 38.0 30.6 38.0 110-114 35.6688 38.0 36.0 38.0 31.0 38.0 115-119 35.64815 38.0 36.0 38.0 30.8 38.0 120-124 35.4151 38.0 35.8 38.0 29.8 38.0 125-129 35.1383 38.0 35.4 38.0 29.2 38.0 130-134 35.0056 38.0 35.0 38.0 28.0 38.0 135-139 34.485949999999995 38.0 35.0 38.0 26.6 38.0 140-144 34.0969 38.0 34.4 38.0 24.6 38.0 145-149 33.12650000000001 38.0 34.0 38.0 17.6 38.0 150-151 28.533875000000002 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 0.0 19 1.0 20 4.0 21 3.0 22 8.0 23 12.0 24 6.0 25 9.0 26 28.0 27 34.0 28 31.0 29 37.0 30 52.0 31 82.0 32 114.0 33 153.0 34 254.0 35 393.0 36 813.0 37 1961.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.45355474831344 9.963674104826154 7.524649714582251 44.05812143227815 2 21.71628721541156 11.683762822116588 40.53039779834876 26.069552164123095 3 19.925 14.6 26.05 39.425 4 25.900000000000002 22.825 20.65 30.625000000000004 5 26.99048572859289 28.567851777666498 24.887330996494743 19.55433149724587 6 21.975 32.550000000000004 24.65 20.825 7 19.325 23.275000000000002 37.95 19.45 8 21.15 23.599999999999998 30.7 24.55 9 19.8 21.224999999999998 34.599999999999994 24.375 10-14 22.86 26.669999999999998 25.485000000000003 24.985 15-19 22.75 25.45 26.47 25.330000000000002 20-24 22.425 25.840000000000003 26.905 24.83 25-29 22.830000000000002 25.330000000000002 26.69 25.15 30-34 22.665 25.695 26.05 25.590000000000003 35-39 23.169999999999998 25.025 26.325 25.480000000000004 40-44 23.095 25.52 26.31 25.074999999999996 45-49 22.634999999999998 25.759999999999998 25.919999999999998 25.685000000000002 50-54 22.75 25.61 26.045 25.595000000000002 55-59 22.900000000000002 25.45 26.06 25.590000000000003 60-64 22.54 25.255 26.064999999999998 26.14 65-69 22.165000000000003 25.825 26.640000000000004 25.369999999999997 70-74 23.27 25.34 26.045 25.345000000000002 75-79 22.985 25.35 25.869999999999997 25.795 80-84 23.27 25.7 26.0 25.03 85-89 23.275000000000002 25.014999999999997 26.255 25.455 90-94 23.26 25.374999999999996 26.27 25.095 95-99 23.48 25.5 25.855 25.165 100-104 24.154999999999998 25.235000000000003 25.180000000000003 25.430000000000003 105-109 23.66 24.725 25.94 25.674999999999997 110-114 23.355 25.145 25.779999999999998 25.72 115-119 23.005 25.45 25.94 25.605 120-124 23.49 25.45 25.47 25.590000000000003 125-129 23.305 25.919999999999998 25.240000000000002 25.535000000000004 130-134 23.5 25.105 25.405 25.990000000000002 135-139 24.355 25.119999999999997 25.369999999999997 25.155 140-144 23.7 25.264999999999997 25.405 25.629999999999995 145-149 23.74 24.91 25.755 25.595000000000002 150-151 23.96146146146146 25.43793793793794 25.237737737737735 25.362862862862862 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.5 27 4.0 28 5.0 29 5.5 30 7.5 31 8.5 32 10.0 33 17.5 34 32.0 35 38.0 36 53.5 37 72.5 38 80.5 39 103.5 40 125.5 41 149.5 42 191.0 43 208.0 44 207.0 45 212.0 46 202.5 47 210.5 48 218.0 49 194.5 50 162.0 51 145.0 52 137.0 53 114.5 54 104.0 55 99.5 56 88.0 57 88.5 58 78.5 59 64.5 60 68.5 61 71.0 62 60.5 63 47.0 64 43.0 65 45.5 66 44.5 67 39.5 68 26.0 69 20.0 70 23.5 71 19.0 72 16.5 73 13.0 74 6.0 75 4.0 76 5.5 77 3.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.65 2 0.075 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4462622703247 98.775 2 0.4278882456581928 0.8500000000000001 3 0.12584948401711551 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.7875 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 1.0499999999999998 0.0 0.0 0.0 0.0 124-125 1.2625000000000002 0.0 0.0 0.0 0.0 126-127 1.4249999999999998 0.0 0.0 0.0 0.0 128-129 1.575 0.0 0.0 0.0 0.0 130-131 1.775 0.0 0.0 0.0 0.0 132-133 1.9375 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.4375 0.0 0.0 0.0 0.0 138-139 2.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958368 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958368_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.758 33.0 33.0 34.0 32.0 34.0 2 32.69875 33.0 33.0 34.0 32.0 34.0 3 32.79325 33.0 33.0 34.0 32.0 34.0 4 32.66775 33.0 33.0 34.0 32.0 34.0 5 32.6515 33.0 33.0 34.0 32.0 34.0 6 36.832 38.0 38.0 38.0 35.0 38.0 7 36.864 38.0 38.0 38.0 35.0 38.0 8 36.77275 38.0 38.0 38.0 35.0 38.0 9 36.81125 38.0 38.0 38.0 35.0 38.0 10-14 36.646499999999996 38.0 38.0 38.0 34.4 38.0 15-19 36.57375 38.0 38.0 38.0 34.2 38.0 20-24 36.705 38.0 38.0 38.0 34.8 38.0 25-29 36.79405 38.0 38.0 38.0 35.0 38.0 30-34 36.88945 38.0 38.0 38.0 35.8 38.0 35-39 36.74605 38.0 38.0 38.0 34.8 38.0 40-44 36.597750000000005 38.0 38.0 38.0 34.6 38.0 45-49 36.54595 38.0 38.0 38.0 34.0 38.0 50-54 36.50635 38.0 38.0 38.0 34.0 38.0 55-59 36.61364999999999 38.0 38.0 38.0 34.2 38.0 60-64 36.49545 38.0 38.0 38.0 34.0 38.0 65-69 36.396100000000004 38.0 38.0 38.0 34.0 38.0 70-74 36.234449999999995 38.0 38.0 38.0 33.2 38.0 75-79 36.2047 38.0 37.8 38.0 33.0 38.0 80-84 36.05655 38.0 37.4 38.0 33.0 38.0 85-89 35.7339 38.0 37.0 38.0 30.6 38.0 90-94 35.785199999999996 38.0 37.0 38.0 31.0 38.0 95-99 35.58585000000001 38.0 37.0 38.0 30.2 38.0 100-104 35.539300000000004 38.0 36.8 38.0 30.2 38.0 105-109 35.272949999999994 38.0 36.0 38.0 29.0 38.0 110-114 34.95375 38.0 35.6 38.0 27.4 38.0 115-119 34.942499999999995 38.0 35.4 38.0 27.6 38.0 120-124 34.9149 38.0 35.4 38.0 27.8 38.0 125-129 34.54625 38.0 35.0 38.0 25.8 38.0 130-134 34.18855 38.0 35.0 38.0 23.4 38.0 135-139 33.742000000000004 38.0 34.4 38.0 22.2 38.0 140-144 33.378049999999995 38.0 34.0 38.0 19.6 38.0 145-149 32.6844 38.0 33.6 38.0 15.0 38.0 150-151 28.06125 35.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 1.0 5 0.0 6 2.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 0.0 13 1.0 14 0.0 15 3.0 16 4.0 17 6.0 18 8.0 19 4.0 20 11.0 21 9.0 22 8.0 23 15.0 24 19.0 25 23.0 26 39.0 27 33.0 28 56.0 29 52.0 30 64.0 31 101.0 32 122.0 33 150.0 34 225.0 35 329.0 36 692.0 37 2014.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.0 18.55 11.450000000000001 38.0 2 28.075 24.099999999999998 29.475 18.35 3 21.175 25.900000000000002 28.775000000000002 24.15 4 24.9 32.275 20.724999999999998 22.1 5 27.775 33.225 20.549999999999997 18.45 6 23.225 35.475 21.0 20.3 7 21.7 19.975 35.699999999999996 22.625 8 24.099999999999998 23.875 25.324999999999996 26.700000000000003 9 22.900000000000002 21.8 29.275000000000002 26.025 10-14 26.045 26.16 23.794999999999998 24.0 15-19 25.759999999999998 25.929999999999996 25.174999999999997 23.135 20-24 25.505 26.14 24.465 23.89 25-29 25.81 26.05 24.099999999999998 24.04 30-34 25.180000000000003 25.75 25.195 23.875 35-39 25.55 26.334999999999997 24.02 24.095 40-44 25.82 25.874999999999996 24.51 23.794999999999998 45-49 25.4 26.14 24.77 23.69 50-54 25.6 26.245 24.565 23.59 55-59 25.77 25.705 24.66 23.865 60-64 26.05 25.759999999999998 24.64 23.549999999999997 65-69 25.490000000000002 26.215 24.82 23.474999999999998 70-74 25.840000000000003 25.069999999999997 24.759999999999998 24.33 75-79 25.490000000000002 25.845000000000002 24.985 23.68 80-84 26.36 25.564999999999998 24.815 23.26 85-89 25.45 25.685000000000002 25.305 23.56 90-94 25.46 25.215 25.474999999999998 23.849999999999998 95-99 25.355 26.055 24.884999999999998 23.705000000000002 100-104 25.66 25.775 24.740000000000002 23.825 105-109 24.97 26.540000000000003 24.785 23.705000000000002 110-114 25.729999999999997 25.955000000000002 25.169999999999998 23.145 115-119 25.695 25.895000000000003 24.57 23.84 120-124 25.900000000000002 25.995 25.09 23.015 125-129 25.81 25.825 25.045 23.32 130-134 26.325 26.240000000000002 24.375 23.06 135-139 26.31 25.615 25.055 23.02 140-144 26.495 25.955000000000002 24.9 22.650000000000002 145-149 26.765 26.075 24.34 22.82 150-151 26.226226226226224 27.039539539539543 24.086586586586588 22.64764764764765 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 5.0 29 6.0 30 7.0 31 9.5 32 10.0 33 14.0 34 26.0 35 34.0 36 42.0 37 56.0 38 86.5 39 113.5 40 120.5 41 141.5 42 159.0 43 188.5 44 210.0 45 198.0 46 194.5 47 186.5 48 179.0 49 175.0 50 155.0 51 150.5 52 153.5 53 128.0 54 104.0 55 101.5 56 96.5 57 97.5 58 98.5 59 85.5 60 84.0 61 79.5 62 72.0 63 65.5 64 56.0 65 47.0 66 43.0 67 43.5 68 41.5 69 38.0 70 27.5 71 21.5 72 17.0 73 9.0 74 5.0 75 2.5 76 1.0 77 2.0 78 1.5 79 0.0 80 0.0 81 0.0 82 1.5 83 2.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21776431995963 98.3 2 0.6813020439061317 1.35 3 0.0757002271006813 0.22499999999999998 4 0.0 0.0 5 0.025233409033560434 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.0750000000000002 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.4500000000000002 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.8 0.0 0.0 0.0 0.0 132-133 1.9625 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.4375 0.0 0.0 0.0 0.0 138-139 2.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297745 spots for SRR6958368.sra Written 1297745 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra Read 1297729 spots for SRR6958368.sra Written 1297729 spots for SRR6958368.sra SRR ids: ['SRR6958368.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tfcxvw9m SRR6958368.sra spots: 25954596 blocks: [[1, 1297729], [1297730, 2595458], [2595459, 3893187], [3893188, 5190916], [5190917, 6488645], [6488646, 7786374], [7786375, 9084103], [9084104, 10381832], [10381833, 11679561], [11679562, 12977290], [12977291, 14275019], [14275020, 15572748], [15572749, 16870477], [16870478, 18168206], [18168207, 19465935], [19465936, 20763664], [20763665, 22061393], [22061394, 23359122], [23359123, 24656851], [24656852, 25954596]] SRR6958368 file size 8773460 SRR6958368 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958368 SRR6958368_1.fastq SRR6958368_2.fastq Input file: SRR6958368_1.fastq Paired file: SRR6958368_2.fastq trimmed: SRR6958368-trimmed-pair1.fastq, SRR6958368-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:10:24 2024 >> started Fri Dec 6 21:10:52 2024 >> done (27.645s) 25954596 read pairs processed; of these: 24679 ( 0.10%) short read pairs filtered out after trimming by size control 25545 ( 0.10%) empty read pairs filtered out after trimming by size control 25904372 (99.81%) read pairs available; of these: 9368202 (36.16%) trimmed read pairs available after processing 16536170 (63.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 9 0.00% 21 8 0.00% 22 11 0.00% 23 7 0.00% 24 5 0.00% 25 6 0.00% 26 1 0.00% 27 13 0.00% 28 12 0.00% 29 11 0.00% 30 18 0.00% 31 13 0.00% 32 14 0.00% 33 13 0.00% 34 14 0.00% 35 14 0.00% 36 10 0.00% 37 13 0.00% 38 23 0.00% 39 18 0.00% 40 25 0.00% 41 22 0.00% 42 27 0.00% 43 27 0.00% 44 26 0.00% 45 34 0.00% 46 32 0.00% 47 43 0.00% 48 30 0.00% 49 51 0.00% 50 52 0.00% 51 60 0.00% 52 58 0.00% 53 66 0.00% 54 79 0.00% 55 82 0.00% 56 77 0.00% 57 106 0.00% 58 133 0.00% 59 144 0.00% 60 184 0.00% 61 172 0.00% 62 210 0.00% 63 225 0.00% 64 244 0.00% 65 287 0.00% 66 282 0.00% 67 325 0.00% 68 376 0.00% 69 379 0.00% 70 466 0.00% 71 500 0.00% 72 619 0.00% 73 645 0.00% 74 744 0.00% 75 766 0.00% 76 849 0.00% 77 1042 0.00% 78 1135 0.00% 79 1271 0.00% 80 1429 0.01% 81 1616 0.01% 82 1787 0.01% 83 1979 0.01% 84 3247 0.01% 85 3931 0.02% 86 4078 0.02% 87 4336 0.02% 88 4328 0.02% 89 4664 0.02% 90 4809 0.02% 91 5178 0.02% 92 5537 0.02% 93 5799 0.02% 94 6120 0.02% 95 6459 0.02% 96 6996 0.03% 97 7414 0.03% 98 8024 0.03% 99 8399 0.03% 100 8931 0.03% 101 9458 0.04% 102 10008 0.04% 103 10868 0.04% 104 11503 0.04% 105 12218 0.05% 106 12910 0.05% 107 13383 0.05% 108 14172 0.05% 109 14975 0.06% 110 15945 0.06% 111 16574 0.06% 112 17767 0.07% 113 18963 0.07% 114 19455 0.08% 115 21226 0.08% 116 22457 0.09% 117 23165 0.09% 118 24600 0.09% 119 25395 0.10% 120 26575 0.10% 121 28355 0.11% 122 29341 0.11% 123 30928 0.12% 124 32571 0.13% 125 34246 0.13% 126 36348 0.14% 127 37979 0.15% 128 40167 0.16% 129 42669 0.16% 130 44523 0.17% 131 47513 0.18% 132 49966 0.19% 133 53575 0.21% 134 56368 0.22% 135 60607 0.23% 136 65216 0.25% 137 68709 0.27% 138 73653 0.28% 139 80510 0.31% 140 87816 0.34% 141 95670 0.37% 142 108721 0.42% 143 124039 0.48% 144 144029 0.56% 145 175406 0.68% 146 220220 0.85% 147 299909 1.16% 148 469480 1.81% 149 955210 3.69% 150 5315638 20.52% 151 16536170 63.84% 25904372 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=23 prefix-density=0.65 prefix-fanout=3.0 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=44.15 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=14 prefix-density=0.68 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=33.64 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.9 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958368 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:11:38 Started mapping on | Dec 06 21:11:39 Finished on | Dec 06 21:15:16 Mapping speed, Million of reads per hour | 429.75 Number of input reads | 25904372 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 25148515 Uniquely mapped reads % | 97.08% Average mapped length | 297.15 Number of splices: Total | 29449047 Number of splices: Annotated (sjdb) | 27791543 Number of splices: GT/AG | 29042999 Number of splices: GC/AG | 341826 Number of splices: AT/AC | 10777 Number of splices: Non-canonical | 53445 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263230 % of reads mapped to multiple loci | 1.02% Number of reads mapped to too many loci | 10729 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.61% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 506736 506736 506736 N_multimapping 263230 263230 263230 N_noFeature 896492 24311143 1096437 N_ambiguous 728585 3207 92280 UnstrandedReadsAssigned:23523438 PositiveStrandReadsAssigned:834165 NegativeStrandReadsAssigned:23959798 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958368 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958368-trimmed-pair1.fastq SRR6958368-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,904,372 reads, 23,906,811 reads pseudoaligned [quant] estimated average fragment length: 274.4 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52973 SRR6958368.ke.tsv 35125 SRR6958368.se.tsv 88098 total ==> SRR6958368.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.216 0 0 PNS24247 1044 770.6 74.7857 6.10003 PNS24249 1928 1654.6 31.2447 1.18693 PNS24246 1044 770.6 74.7857 6.10003 PNS24248 1044 770.6 74.7857 6.10003 PNS24244 1471 1197.6 41.3981 2.17276 PNS24243 293 77.7961 0 0 KQK14069 1603 1329.6 7477.56 353.493 KQK14071 474 216.012 116.152 33.7978 ==> SRR6958368.se.tsv <== BRADI_1g14170v3 8546 BRADI_1g53295v3 2041 BRADI_1g59795v3 138 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 510 BRADI_1g74790v3 111 BRADI_1g09890v3 3 BRADI_1g77505v3 276 BRADI_1g48960v3 0 SRR6958368 completed mapping pipeline successfully