Starting /dee2/code/volunteer_pipeline.sh SRR6958369 current disk space = 1549186396160 free memory = 1599285004 SRR6958369 SRAfilesize 8513fd61057a4bf8d2585f821a936c68 SRR6958369.sra SRR6958369.sra file validated SRR6958369 is paired end SRR6958369 is conventional basespace SRR6958369 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958369_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.00775 32.0 18.0 33.0 18.0 34.0 2 31.178 33.0 29.0 34.0 27.0 34.0 3 32.21 33.0 31.0 34.0 29.0 34.0 4 32.68525 33.0 33.0 34.0 31.0 34.0 5 33.06475 33.0 33.0 34.0 33.0 34.0 6 36.454 38.0 37.0 38.0 34.0 38.0 7 37.30325 38.0 38.0 38.0 36.0 38.0 8 37.41675 38.0 38.0 38.0 37.0 38.0 9 37.58875 38.0 38.0 38.0 37.0 38.0 10-14 37.5707 38.0 38.0 38.0 38.0 38.0 15-19 37.57175 38.0 38.0 38.0 38.0 38.0 20-24 37.525 38.0 38.0 38.0 37.8 38.0 25-29 37.3448 38.0 38.0 38.0 37.0 38.0 30-34 37.59905 38.0 38.0 38.0 38.0 38.0 35-39 37.576100000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.31085 38.0 38.0 38.0 37.0 38.0 45-49 37.45545 38.0 38.0 38.0 37.6 38.0 50-54 37.375699999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.2949 38.0 38.0 38.0 36.8 38.0 60-64 37.33475 38.0 38.0 38.0 36.8 38.0 65-69 37.28294999999999 38.0 38.0 38.0 36.6 38.0 70-74 36.965599999999995 38.0 38.0 38.0 35.6 38.0 75-79 37.203649999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.14755 38.0 38.0 38.0 36.0 38.0 85-89 36.98635 38.0 38.0 38.0 35.6 38.0 90-94 36.87785 38.0 38.0 38.0 35.0 38.0 95-99 36.865899999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.703050000000005 38.0 38.0 38.0 34.8 38.0 105-109 36.595800000000004 38.0 38.0 38.0 34.2 38.0 110-114 36.35025 38.0 38.0 38.0 34.0 38.0 115-119 36.123000000000005 38.0 37.0 38.0 33.0 38.0 120-124 36.13355 38.0 37.0 38.0 33.2 38.0 125-129 35.8649 38.0 36.8 38.0 32.6 38.0 130-134 35.4342 38.0 35.8 38.0 30.4 38.0 135-139 35.3229 38.0 36.0 38.0 31.0 38.0 140-144 34.9358 38.0 34.6 38.0 30.4 38.0 145-149 33.77825 38.0 33.0 38.0 24.2 38.0 150-151 29.549500000000002 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 2.0 20 0.0 21 1.0 22 5.0 23 5.0 24 3.0 25 8.0 26 11.0 27 14.0 28 21.0 29 25.0 30 41.0 31 47.0 32 61.0 33 96.0 34 177.0 35 298.0 36 820.0 37 2363.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.473684210526315 14.736842105263156 8.68421052631579 45.10526315789474 2 21.125 13.100000000000001 37.0 28.775000000000002 3 18.7 16.625 25.674999999999997 39.0 4 24.5 23.825 22.35 29.325000000000003 5 26.775 30.025000000000002 21.875 21.325 6 22.15 33.25 23.175 21.425 7 18.025 25.15 39.0 17.825 8 20.325 24.775 29.95 24.95 9 19.400000000000002 20.7 35.9 24.0 10-14 22.1 27.365000000000002 26.595000000000002 23.94 15-19 22.03 25.674999999999997 26.875 25.419999999999998 20-24 21.745 26.695 26.745 24.815 25-29 22.46 25.759999999999998 26.724999999999998 25.055 30-34 22.34 26.200000000000003 26.555 24.905 35-39 22.115000000000002 26.200000000000003 26.784999999999997 24.9 40-44 22.259999999999998 25.69 26.55 25.5 45-49 22.564999999999998 26.064999999999998 26.44 24.93 50-54 22.38 26.009999999999998 26.715 24.895 55-59 22.48 26.05 26.325 25.145 60-64 22.526126306315316 25.636281814090705 26.581329066453325 25.256262813140655 65-69 22.122212221222124 26.707670767076706 26.592659265926592 24.577457745774577 70-74 22.28722872287229 26.172617261726174 26.852685268526855 24.68746874687469 75-79 22.465 25.585 26.865 25.085 80-84 22.105 26.265 26.21 25.419999999999998 85-89 22.41 25.395 26.540000000000003 25.655 90-94 22.785 25.83 26.590000000000003 24.795 95-99 22.25 26.115 26.56 25.074999999999996 100-104 22.8225524038221 25.75916754214818 26.494572014608035 24.923708039421683 105-109 22.8 25.3 26.93 24.97 110-114 22.84123959482499 26.521913549292947 25.719586801725004 24.917260054157055 115-119 23.111956358540613 25.78950002502377 26.590260747710325 24.50828286872529 120-124 23.121184829380567 25.64795356749725 25.77804463124187 25.452816971880317 125-129 22.775604373558032 25.779917745009527 26.687731969104224 24.756745912328217 130-134 22.4024024024024 25.985985985985987 26.72172172172172 24.88988988988989 135-139 22.869999999999997 26.13 25.945 25.055 140-144 22.645 25.61 26.5 25.245 145-149 23.125 25.8 25.695 25.380000000000003 150-151 23.5625 25.3 26.325 24.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 2.5 27 3.5 28 5.5 29 7.0 30 6.5 31 8.0 32 15.0 33 23.0 34 34.5 35 42.5 36 55.5 37 67.0 38 96.5 39 131.0 40 154.5 41 166.5 42 187.0 43 211.0 44 217.5 45 230.0 46 241.5 47 231.0 48 195.5 49 182.0 50 174.5 51 166.5 52 145.0 53 119.5 54 97.0 55 81.0 56 92.5 57 79.0 58 62.5 59 58.5 60 45.5 61 45.5 62 44.0 63 40.0 64 44.0 65 39.5 66 30.0 67 26.0 68 17.5 69 15.0 70 12.5 71 7.5 72 11.0 73 9.0 74 5.0 75 4.0 76 3.5 77 4.0 78 2.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.01 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.055 105-109 0.0 110-114 0.29 115-119 0.095 120-124 0.06999999999999999 125-129 0.31 130-134 0.1 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.1 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.525 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.8875000000000002 0.0 0.0 0.0 0.0 132-133 2.0375 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.45 0.0 0.0 0.0 0.0 138-139 2.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958369 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958369_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13675 33.0 33.0 34.0 33.0 34.0 2 33.2335 34.0 33.0 34.0 33.0 34.0 3 33.27275 34.0 33.0 34.0 33.0 34.0 4 33.325 34.0 33.0 34.0 33.0 34.0 5 33.085 34.0 33.0 34.0 33.0 34.0 6 37.40525 38.0 38.0 38.0 37.0 38.0 7 37.54575 38.0 38.0 38.0 38.0 38.0 8 37.578 38.0 38.0 38.0 38.0 38.0 9 37.4795 38.0 38.0 38.0 38.0 38.0 10-14 36.69465 38.0 36.6 38.0 33.6 38.0 15-19 37.122099999999996 38.0 37.8 38.0 36.0 38.0 20-24 37.50425 38.0 38.0 38.0 38.0 38.0 25-29 37.5418 38.0 38.0 38.0 38.0 38.0 30-34 37.54945 38.0 38.0 38.0 38.0 38.0 35-39 37.5034 38.0 38.0 38.0 38.0 38.0 40-44 36.6623 38.0 37.4 38.0 32.2 38.0 45-49 37.02890000000001 38.0 38.0 38.0 35.2 38.0 50-54 37.3938 38.0 38.0 38.0 37.8 38.0 55-59 37.440749999999994 38.0 38.0 38.0 37.6 38.0 60-64 37.4329 38.0 38.0 38.0 38.0 38.0 65-69 37.373149999999995 38.0 38.0 38.0 38.0 38.0 70-74 37.3214 38.0 38.0 38.0 37.2 38.0 75-79 36.8527 38.0 38.0 38.0 34.6 38.0 80-84 36.3037 38.0 37.2 38.0 30.8 38.0 85-89 35.8669 38.0 37.0 38.0 28.4 38.0 90-94 36.725699999999996 38.0 37.8 38.0 34.2 38.0 95-99 37.09025 38.0 38.0 38.0 36.2 38.0 100-104 37.014300000000006 38.0 38.0 38.0 36.0 38.0 105-109 36.8995 38.0 38.0 38.0 35.6 38.0 110-114 36.88525 38.0 38.0 38.0 35.2 38.0 115-119 36.8273 38.0 38.0 38.0 35.0 38.0 120-124 36.762 38.0 38.0 38.0 35.0 38.0 125-129 36.6473 38.0 38.0 38.0 34.8 38.0 130-134 36.43035 38.0 38.0 38.0 34.2 38.0 135-139 33.381350000000005 37.0 29.6 38.0 24.6 38.0 140-144 35.01285 38.0 35.6 38.0 29.6 38.0 145-149 34.51435 38.0 35.8 38.0 28.2 38.0 150-151 30.313499999999998 35.5 28.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 1.0 17 0.0 18 2.0 19 4.0 20 3.0 21 6.0 22 1.0 23 5.0 24 10.0 25 9.0 26 15.0 27 10.0 28 20.0 29 20.0 30 27.0 31 42.0 32 44.0 33 79.0 34 125.0 35 255.0 36 730.0 37 2586.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.45 17.9 13.450000000000001 35.199999999999996 2 28.999999999999996 24.224999999999998 29.575000000000003 17.2 3 21.825 27.1 28.199999999999996 22.875 4 24.625 31.025000000000002 21.875 22.475 5 27.3 32.574999999999996 20.974999999999998 19.15 6 22.375 37.525 21.8 18.3 7 22.025 19.475 36.475 22.025 8 23.625 24.8 25.575 26.0 9 23.549999999999997 23.974999999999998 28.15 24.325 10-14 25.495 27.13 24.2 23.175 15-19 25.069999999999997 26.314999999999998 25.264999999999997 23.35 20-24 24.915000000000003 26.83 25.05 23.205000000000002 25-29 25.490000000000002 26.08 24.755 23.674999999999997 30-34 25.215 26.119999999999997 24.875 23.79 35-39 25.435000000000002 27.089999999999996 24.83 22.645 40-44 25.295 26.32 24.9 23.485 45-49 25.235000000000003 26.91 24.955 22.900000000000002 50-54 25.069999999999997 26.895000000000003 25.105 22.93 55-59 25.695 26.58 25.11 22.615 60-64 25.31 26.22 25.369999999999997 23.1 65-69 25.575 26.0 25.205 23.22 70-74 25.045 25.89 25.729999999999997 23.335 75-79 24.935 26.58 25.36 23.125 80-84 24.84 26.605 25.41 23.145 85-89 25.069999999999997 26.174999999999997 25.869999999999997 22.884999999999998 90-94 24.945 26.735 25.36 22.96 95-99 24.98 26.88 25.56 22.58 100-104 24.725 26.86 25.27 23.145 105-109 25.009999999999998 26.590000000000003 25.424999999999997 22.975 110-114 25.27 26.365 25.46 22.905 115-119 25.055 26.57 25.525 22.85 120-124 25.729999999999997 26.51 25.335 22.425 125-129 25.180000000000003 26.340000000000003 25.665 22.814999999999998 130-134 26.08 26.215 25.44 22.264999999999997 135-139 25.41 27.345000000000002 25.115 22.13 140-144 25.965 26.575 25.435000000000002 22.025 145-149 25.585 26.815 25.605 21.995 150-151 26.55 26.8625 25.0125 21.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.5 27 5.0 28 6.0 29 5.5 30 7.0 31 9.0 32 12.5 33 21.5 34 29.5 35 34.5 36 51.5 37 70.5 38 84.5 39 116.0 40 147.5 41 163.5 42 181.5 43 188.0 44 195.5 45 207.0 46 223.5 47 220.5 48 191.0 49 186.5 50 173.0 51 149.0 52 145.5 53 134.0 54 110.0 55 101.0 56 95.5 57 79.5 58 75.0 59 71.0 60 68.0 61 66.0 62 48.0 63 46.0 64 45.5 65 37.0 66 36.0 67 28.0 68 21.0 69 25.0 70 25.0 71 21.0 72 17.0 73 8.5 74 5.5 75 3.5 76 1.0 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5291005291005291 1.05 3 0.12597631645250693 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.7749999999999999 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.7 0.0 0.0 0.0 0.0 130-131 1.8375 0.0 0.0 0.0 0.0 132-133 1.9874999999999998 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.375 0.0 0.0 0.0 0.0 138-139 2.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACAG 10 0.006830828 145.0 1 TTCGTCA 10 0.006830828 145.0 6 ACACCGA 10 0.006830828 145.0 145 CTTCGTC 10 0.006830828 145.0 5 CAGGCAA 10 0.006830828 145.0 5 ACAGGCA 10 0.006830828 145.0 4 CGGCAAT 10 0.006830828 145.0 1 CAAAACA 10 0.006830828 145.0 9 >>END_MODULE Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833139 spots for SRR6958369.sra Written 833139 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra Read 833127 spots for SRR6958369.sra Written 833127 spots for SRR6958369.sra SRR ids: ['SRR6958369.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rdtwxu2z SRR6958369.sra spots: 16662552 blocks: [[1, 833127], [833128, 1666254], [1666255, 2499381], [2499382, 3332508], [3332509, 4165635], [4165636, 4998762], [4998763, 5831889], [5831890, 6665016], [6665017, 7498143], [7498144, 8331270], [8331271, 9164397], [9164398, 9997524], [9997525, 10830651], [10830652, 11663778], [11663779, 12496905], [12496906, 13330032], [13330033, 14163159], [14163160, 14996286], [14996287, 15829413], [15829414, 16662552]] SRR6958369 file size 5624691 SRR6958369 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958369 SRR6958369_1.fastq SRR6958369_2.fastq Input file: SRR6958369_1.fastq Paired file: SRR6958369_2.fastq trimmed: SRR6958369-trimmed-pair1.fastq, SRR6958369-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:11:05 2024 >> started Fri Dec 6 21:11:27 2024 >> done (22.260s) 16662552 read pairs processed; of these: 9632 ( 0.06%) short read pairs filtered out after trimming by size control 7670 ( 0.05%) empty read pairs filtered out after trimming by size control 16645250 (99.90%) read pairs available; of these: 5395427 (32.41%) trimmed read pairs available after processing 11249823 (67.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 5 0.00% 21 4 0.00% 22 2 0.00% 23 2 0.00% 24 1 0.00% 25 2 0.00% 26 5 0.00% 27 3 0.00% 28 4 0.00% 29 2 0.00% 30 2 0.00% 31 1 0.00% 32 4 0.00% 33 5 0.00% 34 8 0.00% 35 3 0.00% 36 5 0.00% 37 2 0.00% 38 4 0.00% 39 6 0.00% 40 4 0.00% 41 4 0.00% 42 8 0.00% 43 3 0.00% 44 9 0.00% 45 9 0.00% 46 7 0.00% 47 9 0.00% 48 16 0.00% 49 10 0.00% 50 13 0.00% 51 11 0.00% 52 12 0.00% 53 15 0.00% 54 16 0.00% 55 24 0.00% 56 28 0.00% 57 24 0.00% 58 29 0.00% 59 39 0.00% 60 30 0.00% 61 48 0.00% 62 52 0.00% 63 63 0.00% 64 66 0.00% 65 80 0.00% 66 83 0.00% 67 103 0.00% 68 99 0.00% 69 110 0.00% 70 126 0.00% 71 147 0.00% 72 144 0.00% 73 195 0.00% 74 202 0.00% 75 238 0.00% 76 347 0.00% 77 387 0.00% 78 377 0.00% 79 379 0.00% 80 439 0.00% 81 531 0.00% 82 576 0.00% 83 700 0.00% 84 1102 0.01% 85 1246 0.01% 86 1296 0.01% 87 1414 0.01% 88 1515 0.01% 89 1605 0.01% 90 1785 0.01% 91 1947 0.01% 92 2192 0.01% 93 2236 0.01% 94 2366 0.01% 95 2540 0.02% 96 2843 0.02% 97 3110 0.02% 98 3341 0.02% 99 3584 0.02% 100 4016 0.02% 101 4131 0.02% 102 4575 0.03% 103 4906 0.03% 104 5204 0.03% 105 5592 0.03% 106 5967 0.04% 107 6327 0.04% 108 6943 0.04% 109 7199 0.04% 110 7672 0.05% 111 8144 0.05% 112 8670 0.05% 113 9015 0.05% 114 9731 0.06% 115 10470 0.06% 116 10971 0.07% 117 11612 0.07% 118 12270 0.07% 119 12647 0.08% 120 13439 0.08% 121 14419 0.09% 122 15044 0.09% 123 15742 0.09% 124 16674 0.10% 125 17807 0.11% 126 18688 0.11% 127 19497 0.12% 128 20667 0.12% 129 21836 0.13% 130 23834 0.14% 131 23669 0.14% 132 25141 0.15% 133 27150 0.16% 134 28434 0.17% 135 30502 0.18% 136 32529 0.20% 137 35347 0.21% 138 36467 0.22% 139 39578 0.24% 140 42702 0.26% 141 46509 0.28% 142 52313 0.31% 143 58841 0.35% 144 67196 0.40% 145 81747 0.49% 146 102682 0.62% 147 140046 0.84% 148 220727 1.33% 149 473535 2.84% 150 3436595 20.65% 151 11249823 67.59% 16645250 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=24 prefix-density=0.75 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=166.41 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=13.6 sequence=ATTTCTTCAAAACAAACTACTTGTCGAGGCTGGAGTCACGTGGAGGCTTCGCTGTCGAGGCGAATCCTTTTGGTGCCAACCTCGTCACTAGCCGGCACCCTATTCTCCTTCGCTTCCACCGAGCACCTCTTGTAAGGTTTGAAGCCTGTCCGGTGGGATTTCATATTCAGGTGTGACAATTCAATGGGAAGGGAAGCTATCGGACCGACCGATGTATCGAGTTCATGATCAATAATCGAGGCGCACTC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=23 prefix-density=0.57 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=102.69 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.1 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958369 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:12:11 Started mapping on | Dec 06 21:12:11 Finished on | Dec 06 21:14:07 Mapping speed, Million of reads per hour | 516.58 Number of input reads | 16645250 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16233164 Uniquely mapped reads % | 97.52% Average mapped length | 298.15 Number of splices: Total | 19501615 Number of splices: Annotated (sjdb) | 18367042 Number of splices: GT/AG | 19234441 Number of splices: GC/AG | 224968 Number of splices: AT/AC | 7093 Number of splices: Non-canonical | 35113 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 178551 % of reads mapped to multiple loci | 1.07% Number of reads mapped to too many loci | 6856 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.10% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 237592 237592 237592 N_multimapping 178551 178551 178551 N_noFeature 635357 15716226 772689 N_ambiguous 438706 2071 59683 UnstrandedReadsAssigned:15159101 PositiveStrandReadsAssigned:514867 NegativeStrandReadsAssigned:15400792 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958369 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958369-trimmed-pair1.fastq SRR6958369-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,645,250 reads, 15,371,484 reads pseudoaligned [quant] estimated average fragment length: 257.308 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR6958369.ke.tsv 35125 SRR6958369.se.tsv 88098 total ==> SRR6958369.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 680.027 0 0 PNS24247 1044 787.692 48.0842 6.16052 PNS24249 1928 1671.69 44.8772 2.7092 PNS24246 1044 787.692 48.0842 6.16052 PNS24248 1044 787.692 48.0842 6.16052 PNS24244 1471 1214.69 16.8703 1.40162 PNS24243 293 79.0712 0 0 KQK14069 1603 1346.69 6768.03 507.185 KQK14071 474 224.964 64.4741 28.9231 ==> SRR6958369.se.tsv <== BRADI_1g14170v3 7579 BRADI_1g53295v3 1058 BRADI_1g59795v3 100 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 196 BRADI_1g74790v3 60 BRADI_1g09890v3 0 BRADI_1g77505v3 176 BRADI_1g48960v3 0 SRR6958369 completed mapping pipeline successfully