Starting /dee2/code/volunteer_pipeline.sh SRR6958370 current disk space = 1549131096064 free memory = 1476507936 SRR6958370 SRAfilesize d3a43be2851e9dfbe8f5da81dbfc94fa SRR6958370.sra SRR6958370.sra file validated SRR6958370 is paired end SRR6958370 is conventional basespace SRR6958370 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958370_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.0075 28.0 18.0 32.0 18.0 33.0 2 28.01175 29.0 27.0 31.0 18.0 33.0 3 29.4925 31.0 27.0 33.0 25.0 33.0 4 30.99825 32.0 32.0 33.0 27.0 33.0 5 31.6345 33.0 32.0 33.0 28.0 33.0 6 35.8965 38.0 36.0 38.0 31.0 38.0 7 36.455 38.0 37.0 38.0 33.0 38.0 8 36.87525 38.0 38.0 38.0 35.0 38.0 9 37.1375 38.0 38.0 38.0 36.0 38.0 10-14 37.25025 38.0 38.0 38.0 36.4 38.0 15-19 37.413799999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.362399999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.184599999999996 38.0 38.0 38.0 36.4 38.0 30-34 37.04064999999999 38.0 38.0 38.0 35.8 38.0 35-39 36.951049999999995 38.0 38.0 38.0 35.6 38.0 40-44 37.0331 38.0 38.0 38.0 35.6 38.0 45-49 36.7701 38.0 38.0 38.0 34.8 38.0 50-54 36.57375 38.0 38.0 38.0 34.2 38.0 55-59 36.5587 38.0 38.0 38.0 34.0 38.0 60-64 36.8476 38.0 38.0 38.0 34.8 38.0 65-69 36.76905000000001 38.0 38.0 38.0 34.6 38.0 70-74 36.3661 38.0 37.6 38.0 33.6 38.0 75-79 36.21745 38.0 37.2 38.0 33.2 38.0 80-84 36.2012 38.0 37.0 38.0 32.6 38.0 85-89 36.26145 38.0 37.0 38.0 33.0 38.0 90-94 36.1425 38.0 36.8 38.0 32.6 38.0 95-99 35.771699999999996 38.0 36.2 38.0 31.2 38.0 100-104 35.22935 38.0 35.8 38.0 28.2 38.0 105-109 34.78505 38.0 35.0 38.0 26.2 38.0 110-114 34.85770000000001 38.0 35.0 38.0 27.2 38.0 115-119 34.9691 38.0 35.0 38.0 27.8 38.0 120-124 34.619550000000004 38.0 34.8 38.0 26.4 38.0 125-129 34.5963 38.0 34.8 38.0 26.8 38.0 130-134 34.03205 38.0 34.0 38.0 23.4 38.0 135-139 33.4138 38.0 33.8 38.0 20.2 38.0 140-144 32.316649999999996 36.8 32.2 38.0 14.2 38.0 145-149 30.807799999999997 36.0 30.6 38.0 10.8 38.0 150-151 26.422375000000002 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 2.0 17 3.0 18 1.0 19 2.0 20 7.0 21 6.0 22 7.0 23 9.0 24 17.0 25 25.0 26 27.0 27 37.0 28 51.0 29 56.0 30 80.0 31 97.0 32 146.0 33 209.0 34 279.0 35 502.0 36 1053.0 37 1383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.911268372346214 10.206859009254218 6.83179096352749 34.05008165487207 2 22.3 10.7 34.775 32.225 3 22.25 16.075 25.074999999999996 36.6 4 27.750000000000004 22.85 21.075 28.325 5 26.525 27.175 24.175 22.125 6 25.474999999999998 29.375 22.525000000000002 22.625 7 18.125 24.525 37.574999999999996 19.775000000000002 8 21.525 23.375 27.875 27.224999999999998 9 20.724999999999998 21.75 32.074999999999996 25.45 10-14 23.635 25.759999999999998 25.435000000000002 25.169999999999998 15-19 23.580000000000002 24.64 26.38 25.4 20-24 23.835 25.05 25.36 25.755 25-29 24.224999999999998 25.745 24.62 25.41 30-34 23.205000000000002 24.935 26.015 25.845000000000002 35-39 23.315 24.59 25.669999999999998 26.424999999999997 40-44 23.75 24.87 25.715 25.665 45-49 23.64 24.295 25.314999999999998 26.75 50-54 23.435 24.45 26.224999999999998 25.89 55-59 24.33 24.575 25.169999999999998 25.924999999999997 60-64 24.169999999999998 24.03 26.005 25.795 65-69 24.060000000000002 24.740000000000002 25.03 26.169999999999998 70-74 23.599999999999998 24.81 25.224999999999998 26.365 75-79 24.08 24.43 25.445 26.045 80-84 23.5 24.915000000000003 25.119999999999997 26.465 85-89 24.645 24.195 25.365 25.795 90-94 24.060000000000002 24.515 25.314999999999998 26.11 95-99 24.325 24.104999999999997 24.93 26.640000000000004 100-104 24.21 24.37 25.44 25.979999999999997 105-109 24.525 24.11 25.09 26.275 110-114 24.3 24.51 25.319999999999997 25.869999999999997 115-119 24.16 23.73 25.635 26.474999999999998 120-124 24.175 24.335 25.335 26.155 125-129 24.285 24.865000000000002 24.715 26.135 130-134 24.715 24.09 24.93 26.265 135-139 24.635 24.365000000000002 25.080000000000002 25.919999999999998 140-144 24.81 24.48 24.845 25.865 145-149 24.645 24.41 25.169999999999998 25.775 150-151 24.575 24.25 25.3125 25.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 3.0 28 4.0 29 3.0 30 3.0 31 5.0 32 7.5 33 14.0 34 24.5 35 32.0 36 35.0 37 43.0 38 60.0 39 86.5 40 112.0 41 137.0 42 171.0 43 179.5 44 189.0 45 200.0 46 196.5 47 200.0 48 191.5 49 177.5 50 148.0 51 144.0 52 149.0 53 124.5 54 115.0 55 113.5 56 113.0 57 107.0 58 94.0 59 88.5 60 85.0 61 77.5 62 68.5 63 62.5 64 66.5 65 68.0 66 56.0 67 44.0 68 35.5 69 32.5 70 31.0 71 27.0 72 19.5 73 15.0 74 13.0 75 7.0 76 5.5 77 6.0 78 4.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16666666666667 98.175 2 0.6818181818181818 1.35 3 0.12626262626262627 0.375 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.05 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.7375 0.0 0.0 0.0 0.0 126-127 1.8624999999999998 0.0 0.0 0.0 0.0 128-129 2.05 0.0 0.0 0.0 0.0 130-131 2.3 0.0 0.0 0.0 0.0 132-133 2.6375 0.0 0.0 0.0 0.0 134-135 2.8875 0.0 0.0 0.0 0.0 136-137 3.2 0.0 0.0 0.0 0.0 138-139 3.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACAAA 10 0.0068396386 144.9375 2 >>END_MODULE SRR6958370 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958370_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.08075 33.0 33.0 34.0 30.0 34.0 2 32.139 33.0 33.0 34.0 30.0 34.0 3 32.11975 33.0 33.0 34.0 30.0 34.0 4 32.035 33.0 33.0 34.0 30.0 34.0 5 32.034 33.0 33.0 34.0 30.0 34.0 6 35.95625 38.0 38.0 38.0 31.0 38.0 7 35.414 38.0 37.0 38.0 29.0 38.0 8 36.0955 38.0 38.0 38.0 31.0 38.0 9 35.93025 38.0 38.0 38.0 31.0 38.0 10-14 36.065250000000006 38.0 38.0 38.0 32.6 38.0 15-19 36.325450000000004 38.0 38.0 38.0 33.6 38.0 20-24 36.27135 38.0 38.0 38.0 33.8 38.0 25-29 36.365100000000005 38.0 38.0 38.0 34.2 38.0 30-34 36.37 38.0 38.0 38.0 33.8 38.0 35-39 36.221799999999995 38.0 38.0 38.0 33.6 38.0 40-44 36.09065 38.0 38.0 38.0 33.0 38.0 45-49 35.95255 38.0 37.8 38.0 32.2 38.0 50-54 36.017999999999994 38.0 38.0 38.0 33.0 38.0 55-59 35.955000000000005 38.0 37.6 38.0 32.4 38.0 60-64 35.6462 38.0 37.0 38.0 30.2 38.0 65-69 35.7173 38.0 37.0 38.0 31.0 38.0 70-74 35.552550000000004 38.0 37.0 38.0 29.8 38.0 75-79 35.5248 38.0 37.0 38.0 30.2 38.0 80-84 35.51205 38.0 37.0 38.0 30.2 38.0 85-89 35.5514 38.0 37.0 38.0 30.6 38.0 90-94 35.16805 38.0 36.4 38.0 29.0 38.0 95-99 34.62465 38.0 35.4 38.0 25.4 38.0 100-104 34.19655 38.0 34.6 38.0 22.2 38.0 105-109 34.09175 38.0 34.6 38.0 22.8 38.0 110-114 33.7765 38.0 34.2 38.0 21.0 38.0 115-119 33.67415 38.0 34.0 38.0 21.4 38.0 120-124 33.575849999999996 38.0 34.0 38.0 21.4 38.0 125-129 32.89739999999999 38.0 33.4 38.0 14.8 38.0 130-134 32.09305 37.2 32.2 38.0 14.0 38.0 135-139 31.640549999999998 37.0 31.2 38.0 13.2 38.0 140-144 30.810449999999996 36.0 30.0 38.0 10.4 38.0 145-149 29.2683 36.0 27.4 38.0 2.0 38.0 150-151 23.455 30.5 7.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 15.0 4 5.0 5 1.0 6 0.0 7 1.0 8 1.0 9 3.0 10 1.0 11 3.0 12 5.0 13 5.0 14 3.0 15 9.0 16 10.0 17 8.0 18 15.0 19 18.0 20 5.0 21 17.0 22 20.0 23 28.0 24 27.0 25 28.0 26 49.0 27 40.0 28 64.0 29 79.0 30 94.0 31 111.0 32 131.0 33 190.0 34 293.0 35 409.0 36 808.0 37 1489.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.65 18.224999999999998 11.675 30.45 2 27.800000000000004 22.875 26.974999999999998 22.35 3 23.7 25.8 27.275 23.225 4 28.025 28.549999999999997 19.0 24.425 5 27.175 31.674999999999997 19.775000000000002 21.375 6 24.437218609304654 33.441720860430216 21.085542771385693 21.03551775887944 7 22.811405702851424 19.484742371185593 33.84192096048024 23.861930965482742 8 24.68734367183592 22.26113056528264 23.58679339669835 29.464732366183092 9 23.186593296648326 23.88694347173587 26.463231615807903 26.463231615807903 10-14 26.578289144572288 25.092546273136566 23.03151575787894 25.297648824412207 15-19 26.37818909454727 25.002501250625315 23.75687843921961 24.862431215607803 20-24 25.78289144572286 25.032516258129068 24.062031015507753 25.12256128064032 25-29 26.248124062031014 25.25262631315658 23.601800900450225 24.89744872436218 30-34 26.45822911455728 24.347173586793396 24.192096048024013 25.002501250625315 35-39 26.141763793707167 24.97623930768846 23.755690060527236 25.126306838077134 40-44 26.720688275310124 24.839935974389757 23.539415766306522 24.899959983993597 45-49 26.361862838277222 24.746135761092493 24.24591065979691 24.646090740833376 50-54 25.721574708618878 24.946225801610726 23.980791356110252 25.351408133660147 55-59 26.853426713356676 24.302151075537772 23.71185592796398 25.13256628314157 60-64 26.025410164065626 24.799919967987194 24.544817927170868 24.62985194077631 65-69 26.258129064532266 24.47223611805903 24.47223611805903 24.797398699349674 70-74 26.119141699594856 24.568599009653376 24.65863052068224 24.653628770069524 75-79 26.23418196368729 24.808683039063673 23.853348672035214 25.10378632521382 80-84 25.739008653028563 25.228830090531684 23.90836792877507 25.123793327664686 85-89 26.638319159579787 24.902451225612808 23.60680340170085 24.852426213106554 90-94 25.912956478239117 24.61230615307654 24.882441220610303 24.592296148074038 95-99 25.87664449002051 24.921214546545944 24.260917412835774 24.94122355059777 100-104 26.722024911210045 24.991246060727327 23.82572157470862 24.461007453354007 105-109 26.159155704496573 25.02876006602311 24.033411694092933 24.778672535387386 110-114 26.22680206092742 25.341403631634236 23.975789105097295 24.456005202341053 115-119 26.53694162373068 24.96123255464959 24.17087689460257 24.330948927017158 120-124 26.753025907772333 25.067520256076826 24.027208162448733 24.15224567370211 125-129 26.708012403721114 25.64769430829249 23.58707612283685 24.057217165149545 130-134 26.959435802530884 24.833691792127244 23.968388936127642 24.238483469214227 135-139 26.64899734960244 25.033755063259488 24.098614792218832 24.218632794919237 140-144 26.334999999999997 25.679999999999996 24.4 23.585 145-149 26.441610402600652 25.46636659164791 23.53088272068017 24.561140285071268 150-151 27.21590198774847 24.928116014501814 24.028003500437556 23.827978497312163 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 0.5 27 0.0 28 3.5 29 6.0 30 3.0 31 3.0 32 6.0 33 11.0 34 14.5 35 18.0 36 29.5 37 44.5 38 54.5 39 74.5 40 108.0 41 120.5 42 140.5 43 159.0 44 165.0 45 184.0 46 190.0 47 192.5 48 188.5 49 181.5 50 167.0 51 132.0 52 116.5 53 119.0 54 126.0 55 117.5 56 105.0 57 101.0 58 99.0 59 107.5 60 104.5 61 99.0 62 84.0 63 76.5 64 78.0 65 77.0 66 65.0 67 57.0 68 58.5 69 50.0 70 41.5 71 32.5 72 26.5 73 19.5 74 12.0 75 8.5 76 8.0 77 3.5 78 0.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.05 15-19 0.05 20-24 0.05 25-29 0.05 30-34 0.05 35-39 0.045 40-44 0.04 45-49 0.045 50-54 0.045 55-59 0.05 60-64 0.04 65-69 0.05 70-74 0.034999999999999996 75-79 0.034999999999999996 80-84 0.034999999999999996 85-89 0.05 90-94 0.05 95-99 0.045 100-104 0.045 105-109 0.034999999999999996 110-114 0.045 115-119 0.045 120-124 0.03 125-129 0.03 130-134 0.034999999999999996 135-139 0.015 140-144 0.0 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06471183013144 97.975 2 0.7836198179979776 1.55 3 0.1263902932254803 0.375 4 0.02527805864509606 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.075 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.3624999999999998 0.0 0.0 0.0 0.0 122-123 1.55 0.0 0.0 0.0 0.0 124-125 1.7375 0.0 0.0 0.0 0.0 126-127 1.8624999999999998 0.0 0.0 0.0 0.0 128-129 2.05 0.0 0.0 0.0 0.0 130-131 2.275 0.0 0.0 0.0 0.0 132-133 2.5999999999999996 0.0 0.0 0.0 0.0 134-135 2.8625 0.0 0.0 0.0 0.0 136-137 3.1375 0.0 0.0 0.0 0.0 138-139 3.4625000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra Read 1080861 spots for SRR6958370.sra Written 1080861 spots for SRR6958370.sra SRR ids: ['SRR6958370.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xp99ebgo SRR6958370.sra spots: 21617220 blocks: [[1, 1080861], [1080862, 2161722], [2161723, 3242583], [3242584, 4323444], [4323445, 5404305], [5404306, 6485166], [6485167, 7566027], [7566028, 8646888], [8646889, 9727749], [9727750, 10808610], [10808611, 11889471], [11889472, 12970332], [12970333, 14051193], [14051194, 15132054], [15132055, 16212915], [16212916, 17293776], [17293777, 18374637], [18374638, 19455498], [19455499, 20536359], [20536360, 21617220]] SRR6958370 file size 7303666 SRR6958370 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958370 SRR6958370_1.fastq SRR6958370_2.fastq Input file: SRR6958370_1.fastq Paired file: SRR6958370_2.fastq trimmed: SRR6958370-trimmed-pair1.fastq, SRR6958370-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:21:34 2024 >> started Fri Dec 6 21:25:29 2024 >> done (234.787s) 21617220 read pairs processed; of these: 43742 ( 0.20%) short read pairs filtered out after trimming by size control 34540 ( 0.16%) empty read pairs filtered out after trimming by size control 21538938 (99.64%) read pairs available; of these: 9458886 (43.92%) trimmed read pairs available after processing 12080052 (56.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 4 0.00% 21 0 0.00% 22 4 0.00% 23 8 0.00% 24 4 0.00% 25 6 0.00% 26 6 0.00% 27 8 0.00% 28 13 0.00% 29 17 0.00% 30 10 0.00% 31 7 0.00% 32 9 0.00% 33 11 0.00% 34 12 0.00% 35 13 0.00% 36 15 0.00% 37 8 0.00% 38 15 0.00% 39 14 0.00% 40 20 0.00% 41 19 0.00% 42 24 0.00% 43 34 0.00% 44 37 0.00% 45 37 0.00% 46 33 0.00% 47 28 0.00% 48 60 0.00% 49 60 0.00% 50 66 0.00% 51 82 0.00% 52 67 0.00% 53 76 0.00% 54 83 0.00% 55 89 0.00% 56 91 0.00% 57 113 0.00% 58 142 0.00% 59 182 0.00% 60 166 0.00% 61 195 0.00% 62 221 0.00% 63 239 0.00% 64 229 0.00% 65 278 0.00% 66 317 0.00% 67 350 0.00% 68 396 0.00% 69 446 0.00% 70 499 0.00% 71 545 0.00% 72 668 0.00% 73 749 0.00% 74 814 0.00% 75 917 0.00% 76 1042 0.00% 77 1195 0.01% 78 1242 0.01% 79 1414 0.01% 80 1660 0.01% 81 1839 0.01% 82 2158 0.01% 83 2391 0.01% 84 4171 0.02% 85 5242 0.02% 86 5203 0.02% 87 5338 0.02% 88 5439 0.03% 89 5477 0.03% 90 5743 0.03% 91 6594 0.03% 92 6376 0.03% 93 6655 0.03% 94 7423 0.03% 95 7742 0.04% 96 8003 0.04% 97 8764 0.04% 98 9106 0.04% 99 9692 0.04% 100 10105 0.05% 101 10441 0.05% 102 11338 0.05% 103 11929 0.06% 104 12545 0.06% 105 13302 0.06% 106 14290 0.07% 107 14918 0.07% 108 15678 0.07% 109 16452 0.08% 110 17284 0.08% 111 18098 0.08% 112 19383 0.09% 113 20741 0.10% 114 21801 0.10% 115 22751 0.11% 116 23961 0.11% 117 25540 0.12% 118 26514 0.12% 119 27314 0.13% 120 28827 0.13% 121 29931 0.14% 122 32205 0.15% 123 33078 0.15% 124 34967 0.16% 125 37142 0.17% 126 39302 0.18% 127 41427 0.19% 128 43238 0.20% 129 45674 0.21% 130 47969 0.22% 131 50666 0.24% 132 53695 0.25% 133 57207 0.27% 134 60401 0.28% 135 64903 0.30% 136 68504 0.32% 137 73249 0.34% 138 78961 0.37% 139 85722 0.40% 140 91977 0.43% 141 101460 0.47% 142 114679 0.53% 143 127541 0.59% 144 149781 0.70% 145 182063 0.85% 146 232776 1.08% 147 319147 1.48% 148 494581 2.30% 149 1008572 4.68% 150 5146388 23.89% 151 12080052 56.08% 21538938 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=15 prefix-density=0.95 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=32.17 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=12 prefix-density=0.69 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=61.01 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.7 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR6958370 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:31:11 Started mapping on | Dec 06 21:31:12 Finished on | Dec 06 21:55:16 Mapping speed, Million of reads per hour | 53.70 Number of input reads | 21538938 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20712556 Uniquely mapped reads % | 96.16% Average mapped length | 296.00 Number of splices: Total | 23329397 Number of splices: Annotated (sjdb) | 21961410 Number of splices: GT/AG | 23019348 Number of splices: GC/AG | 271497 Number of splices: AT/AC | 8691 Number of splices: Non-canonical | 29861 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.56 Insertion rate per base | 0.01% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 199040 % of reads mapped to multiple loci | 0.92% Number of reads mapped to too many loci | 20294 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 651048 651048 651048 N_multimapping 199040 199040 199040 N_noFeature 587356 20136544 726404 N_ambiguous 519171 2781 83184 UnstrandedReadsAssigned:19606029 PositiveStrandReadsAssigned:573231 NegativeStrandReadsAssigned:19902968 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958370 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958370-trimmed-pair1.fastq SRR6958370-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,538,938 reads, 19,909,608 reads pseudoaligned [quant] estimated average fragment length: 262.392 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52973 SRR6958370.ke.tsv 35125 SRR6958370.se.tsv 88098 total ==> SRR6958370.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 674.992 0 0 PNS24247 1044 782.608 64.4247 5.88477 PNS24249 1928 1666.61 83.2565 3.57114 PNS24246 1044 782.608 64.4247 5.88477 PNS24248 1044 782.608 64.4247 5.88477 PNS24244 1471 1209.61 50.4693 2.98267 PNS24243 293 82.2073 0 0 KQK14069 1603 1341.61 5814.36 309.812 KQK14071 474 225.33 91.0127 28.8738 ==> SRR6958370.se.tsv <== BRADI_1g14170v3 6481 BRADI_1g53295v3 253 BRADI_1g59795v3 331 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 298 BRADI_1g74790v3 148 BRADI_1g09890v3 0 BRADI_1g77505v3 280 BRADI_1g48960v3 0 SRR6958370 completed mapping pipeline successfully