Starting /dee2/code/volunteer_pipeline.sh SRR6958371 current disk space = 1549059051520 free memory = 1593593980 SRR6958371 SRAfilesize 96a8748a425dd542218b43b576611d1d SRR6958371.sra SRR6958371.sra file validated SRR6958371 is paired end SRR6958371 is conventional basespace SRR6958371 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958371_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.567 32.0 30.0 33.0 18.0 33.0 2 31.09175 33.0 31.0 33.0 27.0 34.0 3 30.435 33.0 29.0 33.0 25.0 33.0 4 31.224 33.0 32.0 33.0 27.0 33.0 5 31.904 33.0 32.0 33.0 30.0 34.0 6 35.72625 38.0 36.0 38.0 31.0 38.0 7 36.433 38.0 37.0 38.0 33.0 38.0 8 36.983 38.0 38.0 38.0 35.0 38.0 9 37.148 38.0 38.0 38.0 36.0 38.0 10-14 37.306650000000005 38.0 38.0 38.0 36.8 38.0 15-19 37.3906 38.0 38.0 38.0 37.0 38.0 20-24 37.350699999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.18724999999999 38.0 38.0 38.0 36.4 38.0 30-34 37.0173 38.0 38.0 38.0 36.0 38.0 35-39 36.9217 38.0 38.0 38.0 35.2 38.0 40-44 36.981849999999994 38.0 38.0 38.0 35.6 38.0 45-49 36.75429999999999 38.0 38.0 38.0 34.8 38.0 50-54 36.59235 38.0 38.0 38.0 34.0 38.0 55-59 36.54545 38.0 38.0 38.0 33.8 38.0 60-64 36.73595 38.0 38.0 38.0 34.6 38.0 65-69 36.77380000000001 38.0 38.0 38.0 34.6 38.0 70-74 36.32039999999999 38.0 37.2 38.0 33.4 38.0 75-79 36.1089 38.0 37.0 38.0 32.8 38.0 80-84 36.13665 38.0 37.0 38.0 32.6 38.0 85-89 36.31335 38.0 37.2 38.0 33.2 38.0 90-94 36.0604 38.0 36.8 38.0 32.6 38.0 95-99 35.66095 38.0 36.2 38.0 30.8 38.0 100-104 35.200149999999994 38.0 35.6 38.0 28.4 38.0 105-109 34.78464999999999 38.0 35.0 38.0 26.4 38.0 110-114 34.8397 38.0 35.0 38.0 26.6 38.0 115-119 34.96055 38.0 35.0 38.0 28.0 38.0 120-124 34.667950000000005 38.0 34.6 38.0 26.8 38.0 125-129 34.5561 38.0 35.0 38.0 26.8 38.0 130-134 33.86015 38.0 34.0 38.0 22.6 38.0 135-139 33.4307 38.0 33.6 38.0 20.6 38.0 140-144 32.40545 37.0 32.2 38.0 14.2 38.0 145-149 30.8348 35.8 30.2 38.0 8.6 38.0 150-151 26.474375000000002 34.0 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 2.0 17 2.0 18 5.0 19 3.0 20 5.0 21 3.0 22 7.0 23 13.0 24 20.0 25 20.0 26 40.0 27 33.0 28 50.0 29 57.0 30 75.0 31 105.0 32 109.0 33 187.0 34 295.0 35 443.0 36 1050.0 37 1472.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.800436205016354 10.032715376226827 8.642311886586695 32.52453653217012 2 25.324999999999996 10.424999999999999 32.824999999999996 31.424999999999997 3 22.400000000000002 15.65 26.174999999999997 35.775 4 26.424999999999997 21.95 22.975 28.65 5 26.275 26.974999999999998 22.95 23.799999999999997 6 27.6 29.125 22.025 21.25 7 19.6 23.599999999999998 37.15 19.650000000000002 8 21.3 23.875 28.275 26.55 9 21.15 22.400000000000002 31.874999999999996 24.575 10-14 24.099999999999998 25.21 25.465 25.224999999999998 15-19 24.060000000000002 24.295 25.474999999999998 26.169999999999998 20-24 23.925 24.779999999999998 25.665 25.629999999999995 25-29 24.79 24.485 25.245 25.480000000000004 30-34 23.775 25.195 25.445 25.585 35-39 24.335 24.145 25.45 26.07 40-44 23.875 24.560000000000002 25.61 25.955000000000002 45-49 23.915 24.7 25.430000000000003 25.955000000000002 50-54 24.625 24.279999999999998 25.515 25.580000000000002 55-59 24.05 24.13 25.295 26.525 60-64 24.425 23.965 25.365 26.245 65-69 24.02 24.335 25.0 26.645000000000003 70-74 23.95 24.19 25.41 26.450000000000003 75-79 24.27 24.295 25.119999999999997 26.314999999999998 80-84 24.125 24.2 25.330000000000002 26.345000000000002 85-89 24.715 23.575 25.055 26.655 90-94 24.55 24.474999999999998 24.625 26.35 95-99 24.73 23.24 25.56 26.47 100-104 24.2 24.385 24.95 26.465 105-109 24.92 23.285 25.490000000000002 26.305 110-114 24.834999999999997 23.665 25.39 26.11 115-119 24.975 23.95 25.0 26.075 120-124 24.884999999999998 23.995 24.5 26.619999999999997 125-129 24.865000000000002 23.84 24.88 26.415 130-134 24.635 24.355 24.86 26.150000000000002 135-139 25.155 24.085 25.11 25.650000000000002 140-144 25.06 23.810000000000002 24.64 26.490000000000002 145-149 24.615000000000002 24.02 24.515 26.85 150-151 24.45 23.7375 24.9375 26.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.0 28 0.5 29 2.5 30 5.0 31 7.5 32 11.0 33 18.0 34 24.5 35 30.5 36 40.5 37 54.5 38 76.5 39 82.0 40 84.5 41 112.0 42 143.5 43 178.0 44 193.5 45 197.5 46 201.0 47 193.0 48 178.0 49 175.5 50 171.5 51 147.5 52 129.5 53 121.5 54 108.0 55 109.5 56 109.0 57 103.5 58 98.0 59 84.5 60 78.0 61 74.5 62 76.5 63 77.5 64 71.5 65 63.0 66 58.0 67 47.5 68 40.5 69 44.0 70 40.5 71 30.5 72 27.5 73 24.0 74 17.5 75 12.0 76 9.0 77 5.5 78 4.0 79 2.0 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3195564516129 98.52499999999999 2 0.6048387096774194 1.2 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGACGATACCCTTCCCCCTGGTGATGTCCTGCTGGTCGTCGGAGATAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.9125000000000001 0.0 0.0 0.0 0.0 116-117 1.075 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.425 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.8875000000000002 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.4000000000000004 0.0 0.0 0.0 0.0 130-131 2.5999999999999996 0.0 0.0 0.0 0.0 132-133 2.95 0.0 0.0 0.0 0.0 134-135 3.475 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACAGC 10 0.006843168 144.91249 9 AAAAAAA 20 0.005952643 28.9825 30-34 >>END_MODULE SRR6958371 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958371_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0835 33.0 33.0 34.0 30.0 34.0 2 32.188 33.0 33.0 34.0 30.0 34.0 3 32.1295 33.0 33.0 34.0 30.0 34.0 4 32.11675 33.0 33.0 34.0 31.0 34.0 5 32.15175 33.0 33.0 34.0 31.0 34.0 6 36.14425 38.0 38.0 38.0 33.0 38.0 7 35.486 38.0 37.0 38.0 29.0 38.0 8 36.175 38.0 38.0 38.0 33.0 38.0 9 36.06425 38.0 38.0 38.0 33.0 38.0 10-14 36.1228 38.0 38.0 38.0 32.8 38.0 15-19 36.300349999999995 38.0 38.0 38.0 33.8 38.0 20-24 36.30955 38.0 38.0 38.0 33.8 38.0 25-29 36.40185 38.0 38.0 38.0 34.2 38.0 30-34 36.4246 38.0 38.0 38.0 34.8 38.0 35-39 36.2736 38.0 38.0 38.0 34.0 38.0 40-44 36.100550000000005 38.0 38.0 38.0 33.6 38.0 45-49 35.966750000000005 38.0 37.8 38.0 32.8 38.0 50-54 36.089 38.0 38.0 38.0 33.6 38.0 55-59 36.011199999999995 38.0 38.0 38.0 33.0 38.0 60-64 35.7165 38.0 37.6 38.0 31.0 38.0 65-69 35.764599999999994 38.0 37.6 38.0 31.4 38.0 70-74 35.6117 38.0 37.4 38.0 30.6 38.0 75-79 35.55645 38.0 37.0 38.0 30.6 38.0 80-84 35.56345 38.0 37.0 38.0 30.8 38.0 85-89 35.58275 38.0 37.0 38.0 30.8 38.0 90-94 35.171299999999995 38.0 36.6 38.0 29.0 38.0 95-99 34.7583 38.0 35.8 38.0 27.0 38.0 100-104 34.27375 38.0 35.0 38.0 24.0 38.0 105-109 34.09405 38.0 34.8 38.0 23.0 38.0 110-114 33.8681 38.0 34.4 38.0 21.4 38.0 115-119 33.826350000000005 38.0 34.4 38.0 21.8 38.0 120-124 33.68185 38.0 34.4 38.0 21.4 38.0 125-129 33.1318 38.0 34.0 38.0 15.0 38.0 130-134 32.46909999999999 38.0 33.0 38.0 14.0 38.0 135-139 32.0532 37.6 31.6 38.0 13.4 38.0 140-144 31.31745 36.4 31.0 38.0 12.8 38.0 145-149 29.70625 36.0 28.4 38.0 4.2 38.0 150-151 24.226375 31.5 12.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 9.0 4 6.0 5 3.0 6 4.0 7 1.0 8 4.0 9 3.0 10 6.0 11 4.0 12 6.0 13 4.0 14 3.0 15 8.0 16 12.0 17 7.0 18 9.0 19 11.0 20 12.0 21 17.0 22 20.0 23 21.0 24 22.0 25 25.0 26 32.0 27 41.0 28 51.0 29 77.0 30 83.0 31 100.0 32 147.0 33 155.0 34 249.0 35 433.0 36 802.0 37 1593.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.75 19.225 11.1 28.925 2 30.325000000000003 23.549999999999997 24.925 21.2 3 24.375 25.6 26.35 23.674999999999997 4 26.125 31.25 19.7 22.925 5 27.075 32.275 19.125 21.525 6 24.706176544136035 34.508627156789196 19.854963740935233 20.930232558139537 7 23.680920230057513 19.579894973743436 31.90797699424856 24.831207801950487 8 23.730932733183295 23.355838959739934 22.280570142535634 30.632658164541137 9 23.830957739434858 23.58089522380595 26.30657664416104 26.281570392598148 10-14 26.456614153538382 25.57639409852463 22.61065266316579 25.35633908477119 15-19 26.596649162290575 24.63115778944736 23.210802700675167 25.561390347586897 20-24 26.046511627906977 24.74118529632408 23.355838959739934 25.85646411602901 25-29 26.596649162290575 24.871217804451113 23.675918979744935 24.85621405351338 30-34 25.95148787196799 24.976244061015255 23.550887721930483 25.52138034508627 35-39 26.156539134783696 25.211302825706426 23.53088272068017 25.101275318829707 40-44 26.65666416604151 24.926231557889473 22.815703925981495 25.601400350087523 45-49 26.261565391347837 24.916229057264317 23.415853963490875 25.406351587896975 50-54 25.946486621655414 25.156289072268066 23.810952738184547 25.08627156789197 55-59 26.55163790947737 24.88122030507627 23.250812703175793 25.316329082270567 60-64 26.401600400100023 24.846211552888224 23.63590897724431 25.116279069767444 65-69 26.65666416604151 25.081270317579396 23.240810202550637 25.021255313828455 70-74 26.451612903225808 24.456114028507127 23.640910227556887 25.45136284071018 75-79 26.231557889472366 24.36609152288072 24.141035258814703 25.261315328832207 80-84 26.466616654163538 24.466116529132282 23.975993998499625 25.09127281820455 85-89 26.516629157289323 24.63615903975994 23.69092273068267 25.156289072268066 90-94 26.74668667166792 24.31107776944236 23.6609152288072 25.28132033008252 95-99 26.196549137284318 25.63640910227557 23.090772693173292 25.076269067266814 100-104 27.016754188547136 24.38609652413103 23.510877719429857 25.08627156789197 105-109 26.151537884471114 25.23130782695674 23.80095023755939 24.816204051012754 110-114 26.186546636659163 25.32133033258315 23.640910227556887 24.851212803200802 115-119 26.696674168542135 25.036259064766192 23.39584896224056 24.871217804451113 120-124 26.866716679169794 24.681170292573142 24.06101525381345 24.391097774443608 125-129 27.0717679419855 25.046261565391347 23.475868967241812 24.406101525381345 130-134 26.98674668667167 25.581395348837212 22.810702675668917 24.621155288822205 135-139 27.016754188547136 25.166291572893222 24.111027756939237 23.705926481620406 140-144 27.51187796949237 25.85646411602901 23.220805201300326 23.410852713178297 145-149 27.101775443860966 25.291322830707674 23.23080770192548 24.376094023505875 150-151 27.619404851212803 26.406601650412604 23.193298324581146 22.780695173793447 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 0.0 26 0.5 27 3.0 28 3.0 29 1.5 30 2.0 31 4.0 32 7.0 33 6.5 34 9.0 35 25.5 36 33.5 37 41.5 38 58.5 39 72.5 40 88.0 41 119.0 42 147.5 43 151.0 44 156.5 45 168.0 46 175.0 47 175.0 48 180.0 49 189.0 50 177.5 51 154.0 52 132.0 53 118.5 54 111.0 55 106.5 56 101.0 57 107.0 58 112.5 59 96.5 60 85.0 61 87.0 62 91.0 63 85.0 64 78.0 65 75.5 66 72.0 67 61.5 68 61.5 69 53.5 70 50.0 71 49.0 72 34.0 73 26.0 74 21.5 75 12.5 76 5.5 77 4.5 78 2.5 79 3.5 80 1.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.025 20-24 0.025 25-29 0.025 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.025 50-54 0.025 55-59 0.025 60-64 0.025 65-69 0.025 70-74 0.025 75-79 0.025 80-84 0.025 85-89 0.025 90-94 0.025 95-99 0.025 100-104 0.025 105-109 0.025 110-114 0.025 115-119 0.025 120-124 0.025 125-129 0.025 130-134 0.025 135-139 0.025 140-144 0.025 145-149 0.025 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08837680425424 97.82499999999999 2 0.7090402633578121 1.4000000000000001 3 0.12661433274246645 0.375 4 0.02532286654849329 0.1 5 0.02532286654849329 0.125 6 0.0 0.0 7 0.02532286654849329 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 7 0.17500000000000002 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1625 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.7250000000000001 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.5125000000000002 0.0 0.0 0.0 0.0 122-123 1.7374999999999998 0.0 0.0 0.0 0.0 124-125 1.95 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.4625 0.0 0.0 0.0 0.0 130-131 2.625 0.0 0.0 0.0 0.0 132-133 2.95 0.0 0.0 0.0 0.0 134-135 3.5 0.0 0.0 0.0 0.0 136-137 4.0 0.0 0.0 0.0 0.0 138-139 4.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAATTC 10 0.00682755 145.0 3 TGGCGCT 10 0.00682755 145.0 1 >>END_MODULE Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra Read 1050449 spots for SRR6958371.sra Written 1050449 spots for SRR6958371.sra SRR ids: ['SRR6958371.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0fadyrme SRR6958371.sra spots: 21008980 blocks: [[1, 1050449], [1050450, 2100898], [2100899, 3151347], [3151348, 4201796], [4201797, 5252245], [5252246, 6302694], [6302695, 7353143], [7353144, 8403592], [8403593, 9454041], [9454042, 10504490], [10504491, 11554939], [11554940, 12605388], [12605389, 13655837], [13655838, 14706286], [14706287, 15756735], [15756736, 16807184], [16807185, 17857633], [17857634, 18908082], [18908083, 19958531], [19958532, 21008980]] SRR6958371 file size 7097553 SRR6958371 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958371 SRR6958371_1.fastq SRR6958371_2.fastq Input file: SRR6958371_1.fastq Paired file: SRR6958371_2.fastq trimmed: SRR6958371-trimmed-pair1.fastq, SRR6958371-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:23:30 2024 >> started Fri Dec 6 21:23:53 2024 >> done (23.655s) 21008980 read pairs processed; of these: 53917 ( 0.26%) short read pairs filtered out after trimming by size control 37085 ( 0.18%) empty read pairs filtered out after trimming by size control 20917978 (99.57%) read pairs available; of these: 9199019 (43.98%) trimmed read pairs available after processing 11718959 (56.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 7 0.00% 22 5 0.00% 23 8 0.00% 24 3 0.00% 25 9 0.00% 26 3 0.00% 27 9 0.00% 28 7 0.00% 29 11 0.00% 30 9 0.00% 31 13 0.00% 32 10 0.00% 33 10 0.00% 34 10 0.00% 35 17 0.00% 36 8 0.00% 37 18 0.00% 38 13 0.00% 39 14 0.00% 40 16 0.00% 41 20 0.00% 42 24 0.00% 43 26 0.00% 44 31 0.00% 45 28 0.00% 46 30 0.00% 47 42 0.00% 48 41 0.00% 49 55 0.00% 50 54 0.00% 51 63 0.00% 52 51 0.00% 53 54 0.00% 54 85 0.00% 55 62 0.00% 56 105 0.00% 57 103 0.00% 58 119 0.00% 59 140 0.00% 60 141 0.00% 61 164 0.00% 62 167 0.00% 63 169 0.00% 64 235 0.00% 65 248 0.00% 66 273 0.00% 67 271 0.00% 68 343 0.00% 69 332 0.00% 70 428 0.00% 71 451 0.00% 72 488 0.00% 73 632 0.00% 74 624 0.00% 75 728 0.00% 76 812 0.00% 77 860 0.00% 78 958 0.00% 79 1063 0.01% 80 1247 0.01% 81 1435 0.01% 82 1615 0.01% 83 2122 0.01% 84 4142 0.02% 85 5185 0.02% 86 4944 0.02% 87 5135 0.02% 88 5191 0.02% 89 5080 0.02% 90 5323 0.03% 91 5950 0.03% 92 5662 0.03% 93 6207 0.03% 94 6638 0.03% 95 6854 0.03% 96 7333 0.04% 97 7785 0.04% 98 8305 0.04% 99 8782 0.04% 100 9426 0.05% 101 9880 0.05% 102 10667 0.05% 103 11738 0.06% 104 12036 0.06% 105 12956 0.06% 106 13914 0.07% 107 14395 0.07% 108 15069 0.07% 109 16102 0.08% 110 16804 0.08% 111 18017 0.09% 112 19416 0.09% 113 20530 0.10% 114 21944 0.10% 115 23438 0.11% 116 24715 0.12% 117 26038 0.12% 118 27295 0.13% 119 27977 0.13% 120 29407 0.14% 121 30636 0.15% 122 32510 0.16% 123 34671 0.17% 124 37166 0.18% 125 38936 0.19% 126 40779 0.19% 127 43500 0.21% 128 45114 0.22% 129 47819 0.23% 130 49752 0.24% 131 52601 0.25% 132 56353 0.27% 133 59972 0.29% 134 62888 0.30% 135 67690 0.32% 136 70922 0.34% 137 74837 0.36% 138 80981 0.39% 139 86875 0.42% 140 93679 0.45% 141 102838 0.49% 142 116214 0.56% 143 129148 0.62% 144 150000 0.72% 145 180923 0.86% 146 227103 1.09% 147 309410 1.48% 148 474922 2.27% 149 957473 4.58% 150 4945884 23.64% 151 11718959 56.02% 20917978 reads passed initial QC criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=14 prefix-density=1.06 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=24.05 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=16 prefix-density=0.71 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=52.72 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=7.0 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958371 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:24:36 Started mapping on | Dec 06 21:24:36 Finished on | Dec 06 21:26:36 Mapping speed, Million of reads per hour | 627.54 Number of input reads | 20917978 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20163351 Uniquely mapped reads % | 96.39% Average mapped length | 295.71 Number of splices: Total | 22939142 Number of splices: Annotated (sjdb) | 21580996 Number of splices: GT/AG | 22624926 Number of splices: GC/AG | 267428 Number of splices: AT/AC | 7591 Number of splices: Non-canonical | 39197 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 215809 % of reads mapped to multiple loci | 1.03% Number of reads mapped to too many loci | 6816 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 567764 567764 567764 N_multimapping 215809 215809 215809 N_noFeature 508002 19572676 640229 N_ambiguous 535026 2696 77374 UnstrandedReadsAssigned:19120323 PositiveStrandReadsAssigned:587979 NegativeStrandReadsAssigned:19445748 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958371 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958371-trimmed-pair1.fastq SRR6958371-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,917,978 reads, 19,429,384 reads pseudoaligned [quant] estimated average fragment length: 262.499 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52973 SRR6958371.ke.tsv 35125 SRR6958371.se.tsv 88098 total ==> SRR6958371.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 674.982 0 0 PNS24247 1044 782.501 63.9771 5.94412 PNS24249 1928 1666.5 45.518 1.98576 PNS24246 1044 782.501 63.9771 5.94412 PNS24248 1044 782.501 63.9771 5.94412 PNS24244 1471 1209.5 34.5506 2.07681 PNS24243 293 84.0379 0 0 KQK14069 1603 1341.5 5815.67 315.178 KQK14071 474 226.458 103.949 33.3719 ==> SRR6958371.se.tsv <== BRADI_1g14170v3 6594 BRADI_1g53295v3 845 BRADI_1g59795v3 80 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 346 BRADI_1g74790v3 77 BRADI_1g09890v3 0 BRADI_1g77505v3 285 BRADI_1g48960v3 0 SRR6958371 completed mapping pipeline successfully