Starting /dee2/code/volunteer_pipeline.sh SRR6958372 current disk space = 1549039738880 free memory = 1597285716 SRR6958372 SRAfilesize 28757f8e8d9c4f5b7ad55c6aaeb5c285 SRR6958372.sra SRR6958372.sra file validated SRR6958372 is paired end SRR6958372 is conventional basespace SRR6958372 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958372_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.09225 33.0 32.0 33.0 18.0 34.0 2 31.46325 33.0 31.0 33.0 27.0 34.0 3 30.83075 33.0 31.0 33.0 27.0 34.0 4 31.6405 33.0 32.0 33.0 28.0 34.0 5 32.24225 33.0 32.0 33.0 31.0 34.0 6 36.2635 38.0 37.0 38.0 33.0 38.0 7 36.32825 38.0 37.0 38.0 33.0 38.0 8 36.79025 38.0 38.0 38.0 35.0 38.0 9 36.971 38.0 38.0 38.0 35.0 38.0 10-14 37.161699999999996 38.0 38.0 38.0 36.2 38.0 15-19 37.27005 38.0 38.0 38.0 36.4 38.0 20-24 37.2735 38.0 38.0 38.0 36.6 38.0 25-29 37.1952 38.0 38.0 38.0 36.2 38.0 30-34 36.991 38.0 38.0 38.0 35.6 38.0 35-39 36.86645 38.0 38.0 38.0 35.2 38.0 40-44 36.963499999999996 38.0 38.0 38.0 35.4 38.0 45-49 36.8206 38.0 38.0 38.0 34.8 38.0 50-54 36.5413 38.0 38.0 38.0 34.0 38.0 55-59 36.4646 38.0 38.0 38.0 33.8 38.0 60-64 36.74935 38.0 38.0 38.0 34.6 38.0 65-69 36.79715 38.0 38.0 38.0 34.8 38.0 70-74 36.281400000000005 38.0 37.6 38.0 33.0 38.0 75-79 36.11285 38.0 37.0 38.0 32.4 38.0 80-84 36.15705 38.0 37.0 38.0 33.0 38.0 85-89 36.2856 38.0 37.2 38.0 33.6 38.0 90-94 36.09115 38.0 36.8 38.0 32.4 38.0 95-99 35.71625 38.0 36.4 38.0 30.6 38.0 100-104 35.147400000000005 38.0 35.6 38.0 28.0 38.0 105-109 34.7363 38.0 35.0 38.0 25.8 38.0 110-114 34.95115 38.0 35.0 38.0 27.2 38.0 115-119 35.00574999999999 38.0 35.0 38.0 27.6 38.0 120-124 34.71894999999999 38.0 35.0 38.0 26.6 38.0 125-129 34.66445 38.0 35.0 38.0 26.6 38.0 130-134 34.0188 38.0 33.8 38.0 22.8 38.0 135-139 33.491949999999996 38.0 33.6 38.0 20.6 38.0 140-144 32.4576 37.0 32.2 38.0 14.6 38.0 145-149 30.857549999999996 36.0 30.4 38.0 8.6 38.0 150-151 26.573500000000003 34.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 1.0 16 0.0 17 3.0 18 2.0 19 4.0 20 2.0 21 3.0 22 6.0 23 15.0 24 10.0 25 24.0 26 27.0 27 54.0 28 48.0 29 63.0 30 73.0 31 101.0 32 148.0 33 200.0 34 270.0 35 452.0 36 940.0 37 1551.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.965706447187934 10.75445816186557 7.4074074074074066 36.8724279835391 2 22.325 11.725 33.85 32.1 3 21.099999999999998 15.25 26.35 37.3 4 26.6 23.400000000000002 21.575 28.425 5 26.150000000000002 26.650000000000002 24.2 23.0 6 24.85 29.725 24.425 21.0 7 18.475 22.675 39.675 19.175 8 20.849999999999998 23.05 28.7 27.400000000000002 9 21.625 19.900000000000002 32.375 26.1 10-14 22.75 26.009999999999998 25.480000000000004 25.759999999999998 15-19 23.635 24.795 25.895000000000003 25.674999999999997 20-24 23.325000000000003 25.22 25.885 25.569999999999997 25-29 23.39 25.509999999999998 25.44 25.66 30-34 23.845 24.875 25.330000000000002 25.95 35-39 23.885 24.685000000000002 25.41 26.02 40-44 24.095 24.834999999999997 24.8 26.27 45-49 23.655 25.46 25.53 25.355 50-54 23.755000000000003 25.285000000000004 25.135 25.825 55-59 24.015 24.04 25.869999999999997 26.075 60-64 24.295 24.834999999999997 24.895 25.974999999999998 65-69 24.035 24.32 25.814999999999998 25.83 70-74 24.195 24.48 25.080000000000002 26.245 75-79 24.104999999999997 25.195 24.97 25.729999999999997 80-84 23.82 24.635 25.580000000000002 25.965 85-89 23.825 24.884999999999998 24.735 26.555 90-94 24.205 24.91 24.834999999999997 26.05 95-99 24.279999999999998 24.4 25.44 25.88 100-104 23.775 24.65 25.56 26.015 105-109 24.25 24.654999999999998 25.165 25.929999999999996 110-114 24.3 24.65 25.275 25.775 115-119 23.985 24.905 25.264999999999997 25.845000000000002 120-124 24.535 24.54 24.665 26.26 125-129 23.93 24.985 24.88 26.205000000000002 130-134 23.78 24.89 25.240000000000002 26.090000000000003 135-139 23.9 23.985 25.395 26.72 140-144 24.14 24.825 25.195 25.840000000000003 145-149 23.945 24.825 24.875 26.355 150-151 24.75 24.8125 24.5125 25.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 0.5 29 0.0 30 2.0 31 6.5 32 11.5 33 16.0 34 23.0 35 28.0 36 39.5 37 49.0 38 60.0 39 88.5 40 117.5 41 145.0 42 157.0 43 165.5 44 206.0 45 234.0 46 215.5 47 197.0 48 191.5 49 182.0 50 173.0 51 158.0 52 134.0 53 121.5 54 118.5 55 105.0 56 95.5 57 88.0 58 75.5 59 75.0 60 82.5 61 83.0 62 63.0 63 50.5 64 55.5 65 54.0 66 50.5 67 47.0 68 44.5 69 39.5 70 29.0 71 18.5 72 16.5 73 21.5 74 20.0 75 16.5 76 12.5 77 7.0 78 3.5 79 2.5 80 1.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.5125000000000002 0.0 0.0 0.0 0.0 116-117 1.8625 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.8499999999999996 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.5875 0.0 0.0 0.0 0.0 128-129 3.7750000000000004 0.0 0.0 0.0 0.0 130-131 4.125 0.0 0.0 0.0 0.0 132-133 4.487500000000001 0.0 0.0 0.0 0.0 134-135 4.9625 0.0 0.0 0.0 0.0 136-137 5.475 0.0 0.0 0.0 0.0 138-139 5.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGGAT 10 0.0054020355 156.67567 1 CAGTTTC 10 0.006841402 144.925 145 >>END_MODULE SRR6958372 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958372_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.05625 33.0 33.0 34.0 28.0 34.0 2 32.1715 33.0 33.0 34.0 30.0 34.0 3 32.13775 33.0 33.0 34.0 30.0 34.0 4 32.0995 33.0 33.0 34.0 30.0 34.0 5 32.06525 33.0 33.0 34.0 30.0 34.0 6 35.96875 38.0 38.0 38.0 31.0 38.0 7 35.41575 38.0 37.0 38.0 29.0 38.0 8 36.12625 38.0 38.0 38.0 33.0 38.0 9 35.9885 38.0 38.0 38.0 32.0 38.0 10-14 36.08485 38.0 38.0 38.0 32.2 38.0 15-19 36.324799999999996 38.0 38.0 38.0 34.0 38.0 20-24 36.315549999999995 38.0 38.0 38.0 34.0 38.0 25-29 36.3841 38.0 38.0 38.0 34.0 38.0 30-34 36.3723 38.0 38.0 38.0 34.2 38.0 35-39 36.186899999999994 38.0 38.0 38.0 33.8 38.0 40-44 36.10045 38.0 38.0 38.0 33.4 38.0 45-49 35.962900000000005 38.0 37.8 38.0 32.6 38.0 50-54 36.013650000000005 38.0 38.0 38.0 33.0 38.0 55-59 35.85125000000001 38.0 37.6 38.0 32.2 38.0 60-64 35.68055 38.0 37.0 38.0 31.0 38.0 65-69 35.6951 38.0 37.0 38.0 30.6 38.0 70-74 35.57785 38.0 37.4 38.0 30.2 38.0 75-79 35.500350000000005 38.0 37.0 38.0 30.2 38.0 80-84 35.503099999999996 38.0 37.0 38.0 30.6 38.0 85-89 35.46835 38.0 37.0 38.0 30.2 38.0 90-94 35.13435 38.0 36.4 38.0 28.8 38.0 95-99 34.5382 38.0 35.2 38.0 25.0 38.0 100-104 34.049749999999996 38.0 34.6 38.0 21.0 38.0 105-109 34.05485 38.0 34.8 38.0 21.4 38.0 110-114 33.73985 38.0 34.2 38.0 20.2 38.0 115-119 33.698750000000004 38.0 34.0 38.0 20.6 38.0 120-124 33.5728 38.0 34.0 38.0 19.4 38.0 125-129 32.822500000000005 38.0 33.2 38.0 14.8 38.0 130-134 32.224250000000005 37.4 32.2 38.0 14.0 38.0 135-139 31.8353 37.2 31.4 38.0 13.4 38.0 140-144 30.8762 36.0 30.4 38.0 12.6 38.0 145-149 29.23605 35.8 27.4 38.0 2.0 38.0 150-151 23.390875 30.5 7.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 14.0 4 7.0 5 2.0 6 5.0 7 3.0 8 0.0 9 1.0 10 1.0 11 3.0 12 4.0 13 3.0 14 4.0 15 7.0 16 4.0 17 9.0 18 10.0 19 15.0 20 11.0 21 19.0 22 17.0 23 18.0 24 41.0 25 28.0 26 38.0 27 47.0 28 70.0 29 78.0 30 79.0 31 112.0 32 149.0 33 190.0 34 275.0 35 420.0 36 826.0 37 1472.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.175 19.125 10.100000000000001 29.599999999999998 2 29.825000000000003 24.275 26.174999999999997 19.725 3 23.95 24.55 27.450000000000003 24.05 4 27.05 31.324999999999996 20.5 21.125 5 27.650000000000002 32.175 19.775000000000002 20.4 6 23.766591535186578 33.608815426997246 20.711244678186826 21.91334835962935 7 22.414224893563738 20.410718757826196 34.25995492111195 22.915101427498122 8 23.415977961432507 23.215627347858753 23.26571500125219 30.102679689456547 9 23.26571500125219 22.539444027047335 27.923866766841975 26.270974204858504 10-14 26.478689838233084 24.93113637501878 23.784244002604296 24.80592978414384 15-19 26.01422418110788 25.603525994190125 23.860562957026946 24.521686867675047 20-24 25.994190123209453 25.1477511770009 24.09095462285886 24.76710407693078 25-29 26.50137741046832 25.389431505133985 23.73153017781117 24.377660906586527 30-34 26.37219551282051 25.130208333333332 23.998397435897438 24.499198717948715 35-39 26.28837582010317 25.321780938548606 23.72915310261932 24.660690138728903 40-44 26.106770833333332 25.220352564102566 23.187099358974358 25.48577724358974 45-49 26.149454071922268 24.94240208354202 23.675247921466493 25.232895923069215 50-54 26.17688301282051 24.699519230769234 23.682892628205128 25.440705128205128 55-59 26.742788461538463 24.60436698717949 24.05849358974359 24.59435096153846 60-64 26.293384083738168 25.09140081133871 23.90945059347924 24.70576451144388 65-69 26.419913853551037 24.957427626965842 24.01081839126515 24.61184012821797 70-74 26.681356101958038 24.232560468726525 24.032249987480593 25.053833441834843 75-79 26.40592919024488 24.988732535429918 24.20251389653964 24.402824377785567 80-84 26.43965948923385 23.950926389584374 24.807210816224337 24.802203304957438 85-89 25.68609775641026 25.050080128205128 24.263822115384613 25.0 90-94 26.14552556462517 24.97370924933647 23.917071460764184 24.963693725274176 95-99 25.55088141025641 25.050080128205128 24.338942307692307 25.060096153846157 100-104 26.923076923076923 25.0 23.883213141025642 24.193709935897438 105-109 26.44466700050075 24.636955433149723 25.343014521782674 23.57536304456685 110-114 26.11678685897436 25.74619391025641 23.692908653846153 24.444110576923077 115-119 26.155541088687468 25.81501327056938 23.66668335920677 24.362762281536384 120-124 26.43096800040062 24.98372477339877 24.287645851069158 24.297661375131455 125-129 27.325988983475213 25.883825738607914 23.70555833750626 23.084626940410615 130-134 27.056938254294156 25.42941559417097 23.746807551705142 23.766838599829736 135-139 27.13162769739148 25.709708105943026 24.167626295498923 22.991037901166575 140-144 27.486609601041195 26.074986234169295 23.341843119587526 23.096561045201984 145-149 27.693771279791708 26.82755858201482 22.937111956739436 22.541558181454036 150-151 28.21379396670422 26.29866065840531 23.582425835523846 21.90511953936663 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 1.0 5 1.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 1.5 27 0.5 28 0.5 29 1.0 30 2.5 31 6.0 32 7.5 33 9.0 34 15.5 35 21.5 36 33.0 37 46.5 38 58.0 39 79.5 40 114.5 41 140.0 42 146.5 43 153.0 44 164.0 45 190.5 46 206.5 47 189.0 48 180.5 49 175.0 50 160.5 51 149.5 52 134.5 53 119.5 54 113.5 55 100.0 56 90.5 57 104.0 58 108.5 59 95.5 60 83.0 61 81.5 62 82.0 63 78.5 64 76.5 65 70.5 66 60.5 67 48.5 68 46.0 69 53.0 70 43.0 71 36.0 72 28.0 73 20.0 74 21.0 75 13.0 76 8.5 77 8.5 78 6.0 79 4.5 80 3.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.17500000000000002 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-14 0.165 15-19 0.16999999999999998 20-24 0.16999999999999998 25-29 0.17500000000000002 30-34 0.16 35-39 0.165 40-44 0.16 45-49 0.16999999999999998 50-54 0.16 55-59 0.16 60-64 0.165 65-69 0.16999999999999998 70-74 0.155 75-79 0.155 80-84 0.15 85-89 0.16 90-94 0.155 95-99 0.16 100-104 0.16 105-109 0.15 110-114 0.16 115-119 0.155 120-124 0.155 125-129 0.15 130-134 0.155 135-139 0.135 140-144 0.11499999999999999 145-149 0.13999999999999999 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39439818319455 98.475 2 0.42896795357052736 0.8500000000000001 3 0.10093363613424174 0.3 4 0.05046681806712087 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025233409033560434 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.5125000000000002 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 2.875 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.5875 0.0 0.0 0.0 0.0 128-129 3.7875 0.0 0.0 0.0 0.0 130-131 4.1625 0.0 0.0 0.0 0.0 132-133 4.550000000000001 0.0 0.0 0.0 0.0 134-135 5.0375 0.0 0.0 0.0 0.0 136-137 5.5375 0.0 0.0 0.0 0.0 138-139 6.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCCAA 10 0.006830828 145.0 8 >>END_MODULE Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095031 spots for SRR6958372.sra Written 1095031 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra Read 1095026 spots for SRR6958372.sra Written 1095026 spots for SRR6958372.sra SRR ids: ['SRR6958372.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wbncsv88 SRR6958372.sra spots: 21900525 blocks: [[1, 1095026], [1095027, 2190052], [2190053, 3285078], [3285079, 4380104], [4380105, 5475130], [5475131, 6570156], [6570157, 7665182], [7665183, 8760208], [8760209, 9855234], [9855235, 10950260], [10950261, 12045286], [12045287, 13140312], [13140313, 14235338], [14235339, 15330364], [15330365, 16425390], [16425391, 17520416], [17520417, 18615442], [18615443, 19710468], [19710469, 20805494], [20805495, 21900525]] SRR6958372 file size 7399668 SRR6958372 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958372 SRR6958372_1.fastq SRR6958372_2.fastq Input file: SRR6958372_1.fastq Paired file: SRR6958372_2.fastq trimmed: SRR6958372-trimmed-pair1.fastq, SRR6958372-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:23:17 2024 >> started Fri Dec 6 21:23:39 2024 >> done (22.662s) 21900525 read pairs processed; of these: 43292 ( 0.20%) short read pairs filtered out after trimming by size control 28057 ( 0.13%) empty read pairs filtered out after trimming by size control 21829176 (99.67%) read pairs available; of these: 9934792 (45.51%) trimmed read pairs available after processing 11894384 (54.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 7 0.00% 22 6 0.00% 23 3 0.00% 24 1 0.00% 25 5 0.00% 26 9 0.00% 27 8 0.00% 28 5 0.00% 29 8 0.00% 30 12 0.00% 31 12 0.00% 32 9 0.00% 33 12 0.00% 34 9 0.00% 35 14 0.00% 36 5 0.00% 37 20 0.00% 38 16 0.00% 39 19 0.00% 40 20 0.00% 41 21 0.00% 42 27 0.00% 43 23 0.00% 44 29 0.00% 45 38 0.00% 46 41 0.00% 47 43 0.00% 48 43 0.00% 49 55 0.00% 50 59 0.00% 51 70 0.00% 52 96 0.00% 53 83 0.00% 54 101 0.00% 55 137 0.00% 56 111 0.00% 57 128 0.00% 58 153 0.00% 59 161 0.00% 60 201 0.00% 61 214 0.00% 62 227 0.00% 63 284 0.00% 64 319 0.00% 65 339 0.00% 66 387 0.00% 67 410 0.00% 68 444 0.00% 69 535 0.00% 70 583 0.00% 71 626 0.00% 72 738 0.00% 73 856 0.00% 74 957 0.00% 75 1099 0.01% 76 1161 0.01% 77 1327 0.01% 78 1501 0.01% 79 1674 0.01% 80 1956 0.01% 81 2298 0.01% 82 2590 0.01% 83 3114 0.01% 84 4989 0.02% 85 6000 0.03% 86 5826 0.03% 87 6189 0.03% 88 6527 0.03% 89 6640 0.03% 90 7032 0.03% 91 8122 0.04% 92 8291 0.04% 93 8713 0.04% 94 9673 0.04% 95 10325 0.05% 96 10831 0.05% 97 11762 0.05% 98 12145 0.06% 99 13429 0.06% 100 14066 0.06% 101 14830 0.07% 102 16313 0.07% 103 17524 0.08% 104 18442 0.08% 105 19510 0.09% 106 20791 0.10% 107 21639 0.10% 108 22871 0.10% 109 24144 0.11% 110 25276 0.12% 111 26268 0.12% 112 28058 0.13% 113 29751 0.14% 114 32189 0.15% 115 33490 0.15% 116 35097 0.16% 117 36625 0.17% 118 38081 0.17% 119 39599 0.18% 120 41249 0.19% 121 43165 0.20% 122 44996 0.21% 123 47331 0.22% 124 49977 0.23% 125 52354 0.24% 126 54679 0.25% 127 56959 0.26% 128 59308 0.27% 129 61620 0.28% 130 64125 0.29% 131 67336 0.31% 132 70528 0.32% 133 74946 0.34% 134 78391 0.36% 135 83003 0.38% 136 86611 0.40% 137 91416 0.42% 138 96308 0.44% 139 103534 0.47% 140 110523 0.51% 141 120141 0.55% 142 132786 0.61% 143 146415 0.67% 144 166680 0.76% 145 198388 0.91% 146 246058 1.13% 147 328935 1.51% 148 496173 2.27% 149 982572 4.50% 150 5001764 22.91% 151 11894384 54.49% 21829176 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=19 prefix-density=0.65 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=121.50 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.9 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=24 prefix-density=0.51 prefix-fanout=2.8 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=129.50 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=5.0 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958372 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:24:29 Started mapping on | Dec 06 21:24:30 Finished on | Dec 06 21:25:50 Mapping speed, Million of reads per hour | 982.31 Number of input reads | 21829176 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21258107 Uniquely mapped reads % | 97.38% Average mapped length | 294.89 Number of splices: Total | 23776834 Number of splices: Annotated (sjdb) | 22320567 Number of splices: GT/AG | 23468252 Number of splices: GC/AG | 280703 Number of splices: AT/AC | 9062 Number of splices: Non-canonical | 18817 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 151836 % of reads mapped to multiple loci | 0.70% Number of reads mapped to too many loci | 17971 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.36% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 442846 442846 442846 N_multimapping 151836 151836 151836 N_noFeature 638538 20674541 801222 N_ambiguous 503103 2814 83159 UnstrandedReadsAssigned:20116466 PositiveStrandReadsAssigned:580752 NegativeStrandReadsAssigned:20373726 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6958372 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958372-trimmed-pair1.fastq SRR6958372-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,829,176 reads, 20,406,113 reads pseudoaligned [quant] estimated average fragment length: 256.219 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR6958372.ke.tsv 35125 SRR6958372.se.tsv 88098 total ==> SRR6958372.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.209 0 0 PNS24247 1044 788.781 79.5147 7.27589 PNS24249 1928 1672.78 36.5632 1.57761 PNS24246 1044 788.781 79.5147 7.27589 PNS24248 1044 788.781 79.5147 7.27589 PNS24244 1471 1215.78 61.8928 3.67435 PNS24243 293 90.9016 0 0 KQK14069 1603 1347.78 4868.99 260.745 KQK14071 474 232.973 105.032 32.5396 ==> SRR6958372.se.tsv <== BRADI_1g14170v3 5663 BRADI_1g53295v3 278 BRADI_1g59795v3 222 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 270 BRADI_1g74790v3 164 BRADI_1g09890v3 0 BRADI_1g77505v3 277 BRADI_1g48960v3 0 SRR6958372 completed mapping pipeline successfully