Starting /dee2/code/volunteer_pipeline.sh SRR6958373 current disk space = 1549127761920 free memory = 1599412972 SRR6958373 SRAfilesize 2366dd86984e12cc12cfd7b27e7fbb9f SRR6958373.sra SRR6958373.sra file validated SRR6958373 is paired end SRR6958373 is conventional basespace SRR6958373 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958373_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.26375 33.0 32.0 34.0 27.0 34.0 2 31.97 33.0 33.0 34.0 28.0 34.0 3 31.67575 33.0 31.0 34.0 28.0 34.0 4 32.0555 33.0 33.0 34.0 29.0 34.0 5 32.42475 33.0 33.0 34.0 31.0 34.0 6 36.674 38.0 37.0 38.0 34.0 38.0 7 36.92225 38.0 38.0 38.0 35.0 38.0 8 37.04925 38.0 38.0 38.0 36.0 38.0 9 37.1215 38.0 38.0 38.0 36.0 38.0 10-14 37.192 38.0 38.0 38.0 36.4 38.0 15-19 37.21 38.0 38.0 38.0 36.4 38.0 20-24 37.2805 38.0 38.0 38.0 37.0 38.0 25-29 37.170550000000006 38.0 38.0 38.0 36.2 38.0 30-34 36.96325 38.0 38.0 38.0 35.8 38.0 35-39 36.91585 38.0 38.0 38.0 35.4 38.0 40-44 36.7777 38.0 38.0 38.0 35.2 38.0 45-49 36.8994 38.0 38.0 38.0 35.4 38.0 50-54 36.87140000000001 38.0 38.0 38.0 35.0 38.0 55-59 36.727199999999996 38.0 38.0 38.0 34.8 38.0 60-64 36.73175 38.0 38.0 38.0 34.6 38.0 65-69 36.6967 38.0 38.0 38.0 34.4 38.0 70-74 36.76950000000001 38.0 38.0 38.0 35.0 38.0 75-79 36.585 38.0 38.0 38.0 34.2 38.0 80-84 36.21435 38.0 37.6 38.0 33.0 38.0 85-89 36.1413 38.0 37.2 38.0 32.8 38.0 90-94 36.2417 38.0 37.4 38.0 33.2 38.0 95-99 36.26905 38.0 37.4 38.0 33.6 38.0 100-104 36.07185 38.0 37.0 38.0 33.0 38.0 105-109 35.6385 38.0 36.2 38.0 31.4 38.0 110-114 35.543549999999996 38.0 36.0 38.0 30.6 38.0 115-119 35.550200000000004 38.0 36.0 38.0 30.6 38.0 120-124 35.22905 38.0 35.4 38.0 29.0 38.0 125-129 34.9867 38.0 35.4 38.0 28.0 38.0 130-134 34.78985 38.0 35.0 38.0 27.4 38.0 135-139 34.4075 38.0 35.0 38.0 25.2 38.0 140-144 34.0767 38.0 34.6 38.0 23.4 38.0 145-149 32.98205 38.0 33.8 38.0 16.6 38.0 150-151 28.313000000000002 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 0.0 15 3.0 16 2.0 17 1.0 18 1.0 19 2.0 20 5.0 21 3.0 22 10.0 23 8.0 24 18.0 25 17.0 26 18.0 27 22.0 28 44.0 29 42.0 30 62.0 31 77.0 32 101.0 33 165.0 34 265.0 35 361.0 36 781.0 37 1990.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.36417678986818 9.123804600672008 8.917032825019385 42.594985784440425 2 24.0990990990991 12.512512512512513 35.53553553553554 27.852852852852855 3 21.45 14.475 26.6 37.475 4 24.875 22.35 23.425 29.349999999999998 5 26.070623591284747 27.473077886301027 23.741547708489858 22.71475081392437 6 23.45 32.0 23.9 20.65 7 18.675 23.95 39.125 18.25 8 20.875 24.925 29.625 24.575 9 19.725 21.325 34.675 24.275 10-14 22.365 25.990000000000002 26.27 25.374999999999996 15-19 23.064999999999998 24.92 26.38 25.635 20-24 23.015 25.55 26.055 25.380000000000003 25-29 23.25 25.115 26.41 25.224999999999998 30-34 23.125 25.035 26.340000000000003 25.5 35-39 22.63 25.064999999999998 25.965 26.340000000000003 40-44 22.825 25.865 25.595000000000002 25.715 45-49 22.71 25.655 25.795 25.840000000000003 50-54 23.155 25.264999999999997 26.029999999999998 25.55 55-59 22.884999999999998 25.28 26.165 25.669999999999998 60-64 22.95 25.61 25.645 25.795 65-69 22.99 25.295 25.869999999999997 25.845000000000002 70-74 23.549999999999997 24.884999999999998 26.240000000000002 25.324999999999996 75-79 23.285 25.8 25.535000000000004 25.380000000000003 80-84 23.635 24.94 25.224999999999998 26.200000000000003 85-89 23.544999999999998 25.215 25.845000000000002 25.395 90-94 23.549999999999997 25.224999999999998 25.585 25.64 95-99 23.175 24.925 25.905 25.995 100-104 23.185 24.925 25.8 26.090000000000003 105-109 24.005000000000003 25.615 25.28 25.1 110-114 23.845 24.779999999999998 25.56 25.814999999999998 115-119 23.895 25.215 25.155 25.735000000000003 120-124 23.62 24.925 25.629999999999995 25.825 125-129 24.175 25.025 25.019999999999996 25.779999999999998 130-134 23.474999999999998 25.290000000000003 25.09 26.145000000000003 135-139 23.875 24.77 25.779999999999998 25.575 140-144 23.775 24.7 25.505 26.02 145-149 24.310000000000002 25.235000000000003 25.22 25.235000000000003 150-151 24.49311639549437 24.668335419274094 25.744680851063826 25.093867334167708 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 2.5 27 2.0 28 4.0 29 7.5 30 8.0 31 12.0 32 21.0 33 26.5 34 29.0 35 34.0 36 47.0 37 65.0 38 84.5 39 100.0 40 121.0 41 144.5 42 171.0 43 184.5 44 210.0 45 231.0 46 210.5 47 201.5 48 185.0 49 167.5 50 159.0 51 154.5 52 146.5 53 125.0 54 97.5 55 93.0 56 89.0 57 76.0 58 74.0 59 71.5 60 74.5 61 75.0 62 70.5 63 61.5 64 52.5 65 48.0 66 37.5 67 35.5 68 33.5 69 26.5 70 27.5 71 20.5 72 17.5 73 19.5 74 15.0 75 9.5 76 7.0 77 2.5 78 2.0 79 3.0 80 1.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2750000000000004 2 0.1 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.36250000000000004 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.5375 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.7250000000000001 0.0 0.0 0.0 0.0 126-127 0.9125 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.2125 0.0 0.0 0.0 0.0 132-133 1.475 0.0 0.0 0.0 0.0 134-135 1.6125 0.0 0.0 0.0 0.0 136-137 1.775 0.0 0.0 0.0 0.0 138-139 2.0999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGTGTG 10 0.0065806094 146.79747 145 >>END_MODULE SRR6958373 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958373_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.805 33.0 33.0 34.0 32.0 34.0 2 32.8725 33.0 33.0 34.0 32.0 34.0 3 32.84725 33.0 33.0 34.0 32.0 34.0 4 32.84775 34.0 33.0 34.0 32.0 34.0 5 32.7925 34.0 33.0 34.0 32.0 34.0 6 36.99225 38.0 38.0 38.0 35.0 38.0 7 36.94875 38.0 38.0 38.0 36.0 38.0 8 36.81525 38.0 38.0 38.0 35.0 38.0 9 36.96275 38.0 38.0 38.0 36.0 38.0 10-14 36.68215 38.0 38.0 38.0 34.8 38.0 15-19 36.579899999999995 38.0 38.0 38.0 34.2 38.0 20-24 36.74595 38.0 38.0 38.0 35.0 38.0 25-29 36.836 38.0 38.0 38.0 35.2 38.0 30-34 36.87625 38.0 38.0 38.0 35.0 38.0 35-39 36.80855 38.0 38.0 38.0 35.2 38.0 40-44 36.698800000000006 38.0 38.0 38.0 34.8 38.0 45-49 36.611450000000005 38.0 38.0 38.0 34.2 38.0 50-54 36.593199999999996 38.0 38.0 38.0 34.2 38.0 55-59 36.68215 38.0 38.0 38.0 35.0 38.0 60-64 36.62995 38.0 38.0 38.0 34.2 38.0 65-69 36.4413 38.0 38.0 38.0 34.0 38.0 70-74 36.3376 38.0 38.0 38.0 33.8 38.0 75-79 36.24565 38.0 38.0 38.0 33.4 38.0 80-84 36.119899999999994 38.0 38.0 38.0 33.0 38.0 85-89 35.98865 38.0 37.2 38.0 32.2 38.0 90-94 35.9012 38.0 37.0 38.0 32.0 38.0 95-99 35.8386 38.0 37.0 38.0 32.0 38.0 100-104 35.7553 38.0 37.0 38.0 31.2 38.0 105-109 35.3994 38.0 36.0 38.0 29.8 38.0 110-114 35.1174 38.0 35.6 38.0 28.2 38.0 115-119 35.0652 38.0 35.4 38.0 27.8 38.0 120-124 35.030199999999994 38.0 35.2 38.0 28.0 38.0 125-129 34.7644 38.0 35.0 38.0 27.4 38.0 130-134 34.345150000000004 38.0 34.8 38.0 24.0 38.0 135-139 33.9457 38.0 34.4 38.0 22.4 38.0 140-144 33.72154999999999 38.0 34.0 38.0 21.8 38.0 145-149 32.90175000000001 38.0 33.6 38.0 15.6 38.0 150-151 28.2345 35.5 18.0 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 0.0 15 5.0 16 3.0 17 4.0 18 4.0 19 9.0 20 2.0 21 7.0 22 11.0 23 7.0 24 17.0 25 23.0 26 30.0 27 33.0 28 44.0 29 54.0 30 76.0 31 88.0 32 130.0 33 138.0 34 210.0 35 338.0 36 661.0 37 2092.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.65 17.125 11.475 36.75 2 29.5 23.825 28.275 18.4 3 23.0 25.224999999999998 28.549999999999997 23.225 4 26.924999999999997 28.675 20.325 24.075 5 27.750000000000004 31.55 20.150000000000002 20.549999999999997 6 22.15 36.8 20.275000000000002 20.775 7 23.425 19.45 33.95 23.175 8 23.799999999999997 23.625 25.75 26.825 9 23.75 22.5 27.900000000000002 25.85 10-14 25.335 25.895000000000003 23.74 25.03 15-19 25.555 25.6 24.14 24.705 20-24 25.39 25.72 24.915000000000003 23.974999999999998 25-29 25.3 25.295 24.8 24.605 30-34 25.27 25.86 24.305 24.565 35-39 25.28 25.8 24.535 24.385 40-44 25.53 25.255 24.21 25.005 45-49 25.929999999999996 25.5 24.22 24.349999999999998 50-54 25.919999999999998 25.245 24.395 24.44 55-59 26.005 24.82 24.44 24.735 60-64 25.385 25.074999999999996 25.285000000000004 24.255 65-69 25.645 24.85 25.27 24.235 70-74 26.029999999999998 25.119999999999997 24.75 24.099999999999998 75-79 25.485000000000003 24.965 24.525 25.025 80-84 26.155 25.455 24.535 23.855 85-89 25.759999999999998 25.115 24.565 24.560000000000002 90-94 25.840000000000003 25.41 24.88 23.87 95-99 25.765 25.31 24.945 23.98 100-104 25.445 24.97 24.94 24.645 105-109 25.814999999999998 25.1 24.545 24.54 110-114 25.85 25.619999999999997 24.815 23.715 115-119 26.119999999999997 25.169999999999998 24.775 23.935000000000002 120-124 25.825 25.629999999999995 24.45 24.095 125-129 25.759999999999998 26.055 24.57 23.615 130-134 26.145000000000003 25.915 24.585 23.355 135-139 26.14 25.424999999999997 24.935 23.5 140-144 26.255 25.724999999999998 24.965 23.055 145-149 26.5 25.44 24.81 23.25 150-151 26.304592666750093 26.78012764359905 23.97697409585784 22.938305593793018 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 2.5 27 3.0 28 2.5 29 3.5 30 6.5 31 11.0 32 12.0 33 20.0 34 28.5 35 30.5 36 44.5 37 58.5 38 72.0 39 95.5 40 114.0 41 127.5 42 158.5 43 186.0 44 202.5 45 207.5 46 197.5 47 190.0 48 172.0 49 159.0 50 147.5 51 129.0 52 117.0 53 109.0 54 107.0 55 109.0 56 102.0 57 95.5 58 90.0 59 94.0 60 95.5 61 73.0 62 73.0 63 72.5 64 59.5 65 59.5 66 51.5 67 48.0 68 47.0 69 39.0 70 42.0 71 38.5 72 23.0 73 18.0 74 14.0 75 11.0 76 11.0 77 6.5 78 2.5 79 2.5 80 2.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09044972208186 98.05 2 0.808489135927236 1.6 3 0.05053057099545225 0.15 4 0.05053057099545225 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.2125 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.38749999999999996 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.2375 0.0 0.0 0.0 0.0 132-133 1.525 0.0 0.0 0.0 0.0 134-135 1.6625 0.0 0.0 0.0 0.0 136-137 1.825 0.0 0.0 0.0 0.0 138-139 2.1500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215770 spots for SRR6958373.sra Written 1215770 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra Read 1215768 spots for SRR6958373.sra Written 1215768 spots for SRR6958373.sra SRR ids: ['SRR6958373.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7yaiw45i SRR6958373.sra spots: 24315362 blocks: [[1, 1215768], [1215769, 2431536], [2431537, 3647304], [3647305, 4863072], [4863073, 6078840], [6078841, 7294608], [7294609, 8510376], [8510377, 9726144], [9726145, 10941912], [10941913, 12157680], [12157681, 13373448], [13373449, 14589216], [14589217, 15804984], [15804985, 17020752], [17020753, 18236520], [18236521, 19452288], [19452289, 20668056], [20668057, 21883824], [21883825, 23099592], [23099593, 24315362]] SRR6958373 file size 8217977 SRR6958373 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958373 SRR6958373_1.fastq SRR6958373_2.fastq Input file: SRR6958373_1.fastq Paired file: SRR6958373_2.fastq trimmed: SRR6958373-trimmed-pair1.fastq, SRR6958373-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:21:02 2024 >> started Fri Dec 6 21:21:31 2024 >> done (28.766s) 24315362 read pairs processed; of these: 15192 ( 0.06%) short read pairs filtered out after trimming by size control 11414 ( 0.05%) empty read pairs filtered out after trimming by size control 24288756 (99.89%) read pairs available; of these: 8596829 (35.39%) trimmed read pairs available after processing 15691927 (64.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 4 0.00% 21 8 0.00% 22 5 0.00% 23 11 0.00% 24 10 0.00% 25 7 0.00% 26 6 0.00% 27 14 0.00% 28 4 0.00% 29 6 0.00% 30 10 0.00% 31 17 0.00% 32 10 0.00% 33 15 0.00% 34 13 0.00% 35 14 0.00% 36 18 0.00% 37 11 0.00% 38 12 0.00% 39 18 0.00% 40 19 0.00% 41 24 0.00% 42 16 0.00% 43 20 0.00% 44 17 0.00% 45 26 0.00% 46 24 0.00% 47 29 0.00% 48 35 0.00% 49 38 0.00% 50 30 0.00% 51 53 0.00% 52 46 0.00% 53 63 0.00% 54 55 0.00% 55 68 0.00% 56 72 0.00% 57 74 0.00% 58 90 0.00% 59 89 0.00% 60 89 0.00% 61 127 0.00% 62 129 0.00% 63 164 0.00% 64 163 0.00% 65 190 0.00% 66 194 0.00% 67 215 0.00% 68 222 0.00% 69 259 0.00% 70 287 0.00% 71 315 0.00% 72 377 0.00% 73 394 0.00% 74 471 0.00% 75 502 0.00% 76 553 0.00% 77 653 0.00% 78 662 0.00% 79 761 0.00% 80 912 0.00% 81 1002 0.00% 82 1178 0.00% 83 1313 0.01% 84 2063 0.01% 85 2576 0.01% 86 2664 0.01% 87 2881 0.01% 88 3007 0.01% 89 3227 0.01% 90 3389 0.01% 91 3573 0.01% 92 3790 0.02% 93 4058 0.02% 94 4370 0.02% 95 4688 0.02% 96 4862 0.02% 97 5274 0.02% 98 5847 0.02% 99 6010 0.02% 100 6674 0.03% 101 6984 0.03% 102 7559 0.03% 103 8106 0.03% 104 8382 0.03% 105 9014 0.04% 106 9660 0.04% 107 10377 0.04% 108 11088 0.05% 109 11794 0.05% 110 12545 0.05% 111 13245 0.05% 112 14207 0.06% 113 15129 0.06% 114 16085 0.07% 115 17015 0.07% 116 17913 0.07% 117 19244 0.08% 118 20467 0.08% 119 21384 0.09% 120 22661 0.09% 121 24013 0.10% 122 25053 0.10% 123 25859 0.11% 124 28141 0.12% 125 29774 0.12% 126 31129 0.13% 127 33070 0.14% 128 35179 0.14% 129 36654 0.15% 130 39272 0.16% 131 41264 0.17% 132 44445 0.18% 133 47191 0.19% 134 50317 0.21% 135 53741 0.22% 136 58248 0.24% 137 61286 0.25% 138 66737 0.27% 139 72581 0.30% 140 78691 0.32% 141 86775 0.36% 142 97753 0.40% 143 111120 0.46% 144 129394 0.53% 145 158622 0.65% 146 198769 0.82% 147 273407 1.13% 148 426670 1.76% 149 875891 3.61% 150 5001729 20.59% 151 15691927 64.61% 24288756 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=22 prefix-density=0.99 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=23 fanout-score=27.59 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=7.9 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGCGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=16 prefix-density=0.72 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=69.34 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=4.7 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958373 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:22:19 Started mapping on | Dec 06 21:22:19 Finished on | Dec 06 21:25:44 Mapping speed, Million of reads per hour | 426.53 Number of input reads | 24288756 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 23591306 Uniquely mapped reads % | 97.13% Average mapped length | 297.58 Number of splices: Total | 27388085 Number of splices: Annotated (sjdb) | 25808528 Number of splices: GT/AG | 27011489 Number of splices: GC/AG | 316765 Number of splices: AT/AC | 9396 Number of splices: Non-canonical | 50435 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 245679 % of reads mapped to multiple loci | 1.01% Number of reads mapped to too many loci | 9633 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.58% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 461345 461345 461345 N_multimapping 245679 245679 245679 N_noFeature 865480 22825025 1075487 N_ambiguous 650119 3135 95006 UnstrandedReadsAssigned:22075707 PositiveStrandReadsAssigned:763146 NegativeStrandReadsAssigned:22420813 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958373 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958373-trimmed-pair1.fastq SRR6958373-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,288,756 reads, 22,370,611 reads pseudoaligned [quant] estimated average fragment length: 274.968 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR6958373.ke.tsv 35125 SRR6958373.se.tsv 88098 total ==> SRR6958373.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 662.496 0 0 PNS24247 1044 770.032 61.2838 5.24454 PNS24249 1928 1654.03 72.0028 2.86864 PNS24246 1044 770.032 61.2838 5.24454 PNS24248 1044 770.032 61.2838 5.24454 PNS24244 1471 1197.03 20.1459 1.10905 PNS24243 293 77.2635 0 0 KQK14069 1603 1329.03 8141 403.658 KQK14071 474 215.45 173.969 53.2105 ==> SRR6958373.se.tsv <== BRADI_1g14170v3 9545 BRADI_1g53295v3 1619 BRADI_1g59795v3 150 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 259 BRADI_1g74790v3 96 BRADI_1g09890v3 0 BRADI_1g77505v3 281 BRADI_1g48960v3 0 SRR6958373 completed mapping pipeline successfully