Starting /dee2/code/volunteer_pipeline.sh SRR6958374 current disk space = 1549140496384 free memory = 1600471476 SRR6958374 SRAfilesize 94bb78f25610f811e2786b169990b40d SRR6958374.sra SRR6958374.sra file validated SRR6958374 is paired end SRR6958374 is conventional basespace SRR6958374 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958374_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.5075 32.0 18.0 33.0 18.0 34.0 2 31.116 33.0 29.0 33.0 27.0 34.0 3 31.64875 33.0 31.0 33.0 28.0 34.0 4 32.297 33.0 33.0 33.0 31.0 34.0 5 32.95225 33.0 33.0 34.0 33.0 34.0 6 36.844 38.0 37.0 38.0 35.0 38.0 7 37.3685 38.0 38.0 38.0 36.0 38.0 8 37.51625 38.0 38.0 38.0 37.0 38.0 9 37.65375 38.0 38.0 38.0 38.0 38.0 10-14 37.62645 38.0 38.0 38.0 38.0 38.0 15-19 37.6148 38.0 38.0 38.0 38.0 38.0 20-24 37.56695 38.0 38.0 38.0 38.0 38.0 25-29 37.377700000000004 38.0 38.0 38.0 37.4 38.0 30-34 37.62635 38.0 38.0 38.0 38.0 38.0 35-39 37.57 38.0 38.0 38.0 37.8 38.0 40-44 37.32905000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.44884999999999 38.0 38.0 38.0 37.6 38.0 50-54 37.33555 38.0 38.0 38.0 37.0 38.0 55-59 37.222500000000004 38.0 38.0 38.0 36.4 38.0 60-64 37.27005 38.0 38.0 38.0 36.6 38.0 65-69 37.24565 38.0 38.0 38.0 36.0 38.0 70-74 36.97090000000001 38.0 38.0 38.0 35.6 38.0 75-79 37.12935 38.0 38.0 38.0 36.0 38.0 80-84 37.023 38.0 38.0 38.0 35.8 38.0 85-89 36.919599999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.77745 38.0 38.0 38.0 34.8 38.0 95-99 36.789049999999996 38.0 38.0 38.0 34.8 38.0 100-104 36.594350000000006 38.0 38.0 38.0 34.2 38.0 105-109 36.5409 38.0 38.0 38.0 34.0 38.0 110-114 36.31410000000001 38.0 37.6 38.0 33.8 38.0 115-119 36.14745 38.0 37.0 38.0 33.2 38.0 120-124 36.027750000000005 38.0 37.0 38.0 32.8 38.0 125-129 35.672999999999995 38.0 36.2 38.0 31.4 38.0 130-134 35.330799999999996 38.0 35.8 38.0 30.0 38.0 135-139 35.18875 38.0 35.4 38.0 30.4 38.0 140-144 34.770050000000005 38.0 34.4 38.0 28.2 38.0 145-149 33.70219999999999 38.0 33.0 38.0 23.2 38.0 150-151 29.138625 35.0 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 0.0 18 3.0 19 3.0 20 1.0 21 0.0 22 1.0 23 3.0 24 3.0 25 5.0 26 11.0 27 12.0 28 26.0 29 17.0 30 41.0 31 50.0 32 80.0 33 117.0 34 165.0 35 344.0 36 830.0 37 2286.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.62386746052291 13.331607558892053 8.827336267149883 47.217188713435156 2 20.0 13.200000000000001 37.075 29.725 3 19.5 15.425 25.974999999999998 39.1 4 25.174999999999997 23.400000000000002 23.275000000000002 28.15 5 25.074999999999996 29.349999999999998 24.825 20.75 6 23.225 33.675 23.3 19.8 7 18.275 25.0 38.25 18.475 8 21.05 26.174999999999997 28.7 24.075 9 18.975 22.900000000000002 35.0 23.125 10-14 21.54 27.38 26.87 24.21 15-19 22.175 26.009999999999998 26.779999999999998 25.035 20-24 22.33 26.575 26.765 24.33 25-29 22.325 26.424999999999997 26.38 24.87 30-34 21.83 26.590000000000003 26.71 24.87 35-39 22.134999999999998 26.490000000000002 26.555 24.82 40-44 22.225 26.005 26.68 25.09 45-49 22.25 26.5 26.69 24.560000000000002 50-54 22.275 26.31 26.505000000000003 24.91 55-59 21.884999999999998 26.334999999999997 27.02 24.759999999999998 60-64 21.811090554527727 26.681334066703332 26.196309815490775 25.311265563278162 65-69 22.327232723272328 26.072607260726073 27.062706270627064 24.53745374537454 70-74 22.598389758463767 25.993899084862733 26.35895384307646 25.048757313597044 75-79 22.49 26.205000000000002 26.25 25.055 80-84 22.425 26.1 26.729999999999997 24.745 85-89 22.12 26.029999999999998 26.645000000000003 25.205 90-94 22.400000000000002 25.86 26.695 25.045 95-99 22.61 26.245 26.375 24.77 100-104 22.78139069534767 26.178089044522263 26.468234117058532 24.572286143071537 105-109 22.54 26.369999999999997 26.32 24.77 110-114 22.27906510181563 26.241348179356006 26.712809710101315 24.766777008727054 115-119 22.388507933329997 26.632964612843484 26.657990890434956 24.320536563391563 120-124 22.495747022916042 26.143300310217153 26.248373861703193 25.112578805163615 125-129 22.65154556403051 25.697511039743077 26.510437575270974 25.14050582095544 130-134 22.39963960356392 25.628191010111124 26.454099509460406 25.51806987686455 135-139 22.994999999999997 25.374999999999996 26.939999999999998 24.69 140-144 22.81 25.785000000000004 26.015 25.39 145-149 22.98 26.55 25.5 24.97 150-151 22.9875 25.674999999999997 26.025 25.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.0 27 2.0 28 3.5 29 6.5 30 9.5 31 11.0 32 17.0 33 24.0 34 30.0 35 37.5 36 49.0 37 72.5 38 100.0 39 121.5 40 148.5 41 190.5 42 207.0 43 222.0 44 242.5 45 251.0 46 236.5 47 212.0 48 203.0 49 187.0 50 178.0 51 154.0 52 118.5 53 102.5 54 93.0 55 89.5 56 90.5 57 85.5 58 70.0 59 58.5 60 51.0 61 45.0 62 43.5 63 35.5 64 32.0 65 28.5 66 21.0 67 23.5 68 26.5 69 17.0 70 9.5 71 8.0 72 9.0 73 6.5 74 3.5 75 5.5 76 4.0 77 1.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.01 70-74 0.015 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.0 110-114 0.31 115-119 0.105 120-124 0.06999999999999999 125-129 0.36 130-134 0.11 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7566204287515763 1.5 3 0.025220680958385876 0.075 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.7250000000000001 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.25 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.975 0.0 0.0 0.0 0.0 132-133 2.2249999999999996 0.0 0.0 0.0 0.0 134-135 2.4 0.0 0.0 0.0 0.0 136-137 2.7125000000000004 0.0 0.0 0.0 0.0 138-139 3.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCAGT 10 0.0063298983 148.6923 1 CTCCTAT 10 0.0063298983 148.6923 1 GCCCATG 10 0.0068343505 144.975 8 >>END_MODULE SRR6958374 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958374_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10525 33.0 33.0 34.0 32.0 34.0 2 33.28825 34.0 33.0 34.0 33.0 34.0 3 33.308 34.0 33.0 34.0 33.0 34.0 4 33.32875 34.0 33.0 34.0 33.0 34.0 5 32.899 34.0 33.0 34.0 32.0 34.0 6 37.473 38.0 38.0 38.0 37.0 38.0 7 37.552 38.0 38.0 38.0 38.0 38.0 8 37.5535 38.0 38.0 38.0 38.0 38.0 9 37.468 38.0 38.0 38.0 38.0 38.0 10-14 36.68545 38.0 36.6 38.0 33.6 38.0 15-19 37.074949999999994 38.0 37.8 38.0 35.6 38.0 20-24 37.525099999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.56135 38.0 38.0 38.0 38.0 38.0 30-34 37.545750000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.4913 38.0 38.0 38.0 38.0 38.0 40-44 36.79915 38.0 37.8 38.0 34.2 38.0 45-49 37.08855 38.0 38.0 38.0 36.0 38.0 50-54 37.31465 38.0 38.0 38.0 37.6 38.0 55-59 37.382999999999996 38.0 38.0 38.0 37.6 38.0 60-64 37.393699999999995 38.0 38.0 38.0 37.8 38.0 65-69 37.4078 38.0 38.0 38.0 37.6 38.0 70-74 37.292199999999994 38.0 38.0 38.0 37.0 38.0 75-79 36.89265 38.0 38.0 38.0 34.8 38.0 80-84 36.43920000000001 38.0 37.4 38.0 31.0 38.0 85-89 35.96105 38.0 37.0 38.0 30.6 38.0 90-94 36.70685 38.0 37.8 38.0 34.4 38.0 95-99 37.0815 38.0 38.0 38.0 36.0 38.0 100-104 36.9919 38.0 38.0 38.0 35.8 38.0 105-109 36.83839999999999 38.0 38.0 38.0 35.0 38.0 110-114 36.8633 38.0 38.0 38.0 35.2 38.0 115-119 36.7587 38.0 38.0 38.0 35.0 38.0 120-124 36.743050000000004 38.0 38.0 38.0 35.0 38.0 125-129 36.57459999999999 38.0 38.0 38.0 34.6 38.0 130-134 36.34295 38.0 38.0 38.0 34.0 38.0 135-139 33.361599999999996 37.0 29.6 38.0 24.4 38.0 140-144 35.10035 38.0 35.8 38.0 29.8 38.0 145-149 34.40005000000001 38.0 35.0 38.0 27.6 38.0 150-151 29.891624999999998 35.5 28.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 1.0 15 2.0 16 2.0 17 0.0 18 2.0 19 3.0 20 3.0 21 4.0 22 7.0 23 4.0 24 5.0 25 4.0 26 8.0 27 16.0 28 15.0 29 21.0 30 29.0 31 45.0 32 53.0 33 91.0 34 132.0 35 226.0 36 780.0 37 2542.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.075000000000003 17.825 13.525 37.574999999999996 2 29.299999999999997 24.224999999999998 28.475 18.0 3 21.325 26.974999999999998 28.199999999999996 23.5 4 24.15 31.35 22.3 22.2 5 27.275 33.025 20.75 18.95 6 22.175 37.574999999999996 20.599999999999998 19.650000000000002 7 22.725 19.525000000000002 35.8 21.95 8 23.875 23.75 26.375 26.0 9 23.1 22.25 29.95 24.7 10-14 25.72 27.05 23.835 23.395 15-19 25.36 26.3 25.074999999999996 23.265 20-24 25.869999999999997 26.755000000000003 24.59 22.785 25-29 25.145 26.515 25.035 23.305 30-34 24.855 26.325 25.064999999999998 23.755000000000003 35-39 24.975 26.415 25.34 23.27 40-44 25.509999999999998 26.275 25.124999999999996 23.09 45-49 25.14 26.05 25.555 23.255 50-54 25.230000000000004 26.529999999999998 25.66 22.58 55-59 25.485000000000003 26.5 25.155 22.86 60-64 25.119999999999997 26.515 25.615 22.75 65-69 25.124999999999996 26.384999999999998 25.595000000000002 22.895 70-74 25.55 26.61 25.285000000000004 22.555 75-79 25.155 26.400000000000002 25.25 23.195 80-84 25.374999999999996 26.174999999999997 26.195 22.255 85-89 25.564999999999998 26.375 25.75 22.31 90-94 25.395 26.645000000000003 25.490000000000002 22.470000000000002 95-99 25.635 26.655 25.66 22.05 100-104 24.68 26.61 25.740000000000002 22.97 105-109 24.73 27.060000000000002 25.525 22.685 110-114 25.145 27.634999999999998 25.03 22.189999999999998 115-119 25.990000000000002 26.495 25.424999999999997 22.09 120-124 25.34 27.0 25.825 21.834999999999997 125-129 25.655 26.755000000000003 25.11 22.48 130-134 25.180000000000003 27.07 25.490000000000002 22.259999999999998 135-139 25.435000000000002 27.375 25.525 21.665 140-144 25.474999999999998 27.065 25.759999999999998 21.7 145-149 25.7 26.625 25.495 22.18 150-151 25.687500000000004 26.025 26.174999999999997 22.112499999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 1.5 25 1.0 26 2.0 27 3.0 28 3.0 29 4.5 30 9.5 31 18.0 32 22.0 33 23.5 34 31.5 35 45.0 36 51.0 37 62.0 38 79.0 39 111.0 40 142.5 41 165.0 42 184.0 43 194.5 44 205.5 45 205.0 46 215.5 47 212.0 48 194.5 49 179.0 50 165.5 51 149.5 52 128.0 53 121.0 54 106.5 55 102.5 56 102.0 57 92.0 58 86.0 59 72.0 60 61.0 61 56.5 62 56.5 63 52.5 64 50.0 65 50.0 66 36.5 67 27.0 68 27.0 69 20.0 70 16.5 71 16.0 72 13.0 73 9.0 74 6.0 75 4.0 76 1.5 77 1.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49685534591195 98.875 2 0.4528301886792453 0.8999999999999999 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025157232704402514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8374999999999999 0.0 0.0 0.0 0.0 120-121 1.075 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.4249999999999998 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.0875 0.0 0.0 0.0 0.0 134-135 2.225 0.0 0.0 0.0 0.0 136-137 2.5125 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 20 0.00593511 29.0 110-114 >>END_MODULE Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742047 spots for SRR6958374.sra Written 742047 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra Read 742032 spots for SRR6958374.sra Written 742032 spots for SRR6958374.sra SRR ids: ['SRR6958374.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h5m7j8tl SRR6958374.sra spots: 14840655 blocks: [[1, 742032], [742033, 1484064], [1484065, 2226096], [2226097, 2968128], [2968129, 3710160], [3710161, 4452192], [4452193, 5194224], [5194225, 5936256], [5936257, 6678288], [6678289, 7420320], [7420321, 8162352], [8162353, 8904384], [8904385, 9646416], [9646417, 10388448], [10388449, 11130480], [11130481, 11872512], [11872513, 12614544], [12614545, 13356576], [13356577, 14098608], [14098609, 14840655]] SRR6958374 file size 5007310 SRR6958374 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958374 SRR6958374_1.fastq SRR6958374_2.fastq Input file: SRR6958374_1.fastq Paired file: SRR6958374_2.fastq trimmed: SRR6958374-trimmed-pair1.fastq, SRR6958374-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:20:37 2024 >> started Fri Dec 6 21:20:52 2024 >> done (15.007s) 14840655 read pairs processed; of these: 7787 ( 0.05%) short read pairs filtered out after trimming by size control 5819 ( 0.04%) empty read pairs filtered out after trimming by size control 14827049 (99.91%) read pairs available; of these: 4955720 (33.42%) trimmed read pairs available after processing 9871329 (66.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 2 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 1 0.00% 26 3 0.00% 27 2 0.00% 28 0 0.00% 29 1 0.00% 30 3 0.00% 31 1 0.00% 32 7 0.00% 33 5 0.00% 34 4 0.00% 35 5 0.00% 36 5 0.00% 37 1 0.00% 38 4 0.00% 39 3 0.00% 40 5 0.00% 41 2 0.00% 42 6 0.00% 43 5 0.00% 44 5 0.00% 45 3 0.00% 46 6 0.00% 47 6 0.00% 48 6 0.00% 49 11 0.00% 50 7 0.00% 51 7 0.00% 52 6 0.00% 53 17 0.00% 54 14 0.00% 55 15 0.00% 56 27 0.00% 57 20 0.00% 58 33 0.00% 59 28 0.00% 60 26 0.00% 61 38 0.00% 62 50 0.00% 63 46 0.00% 64 67 0.00% 65 68 0.00% 66 74 0.00% 67 66 0.00% 68 69 0.00% 69 93 0.00% 70 103 0.00% 71 104 0.00% 72 140 0.00% 73 163 0.00% 74 160 0.00% 75 201 0.00% 76 241 0.00% 77 272 0.00% 78 338 0.00% 79 376 0.00% 80 380 0.00% 81 418 0.00% 82 504 0.00% 83 548 0.00% 84 915 0.01% 85 1043 0.01% 86 1117 0.01% 87 1201 0.01% 88 1295 0.01% 89 1349 0.01% 90 1540 0.01% 91 1643 0.01% 92 1903 0.01% 93 1870 0.01% 94 2142 0.01% 95 2278 0.02% 96 2565 0.02% 97 2775 0.02% 98 2995 0.02% 99 3255 0.02% 100 3570 0.02% 101 3715 0.03% 102 3978 0.03% 103 4310 0.03% 104 4567 0.03% 105 4957 0.03% 106 5388 0.04% 107 5878 0.04% 108 6213 0.04% 109 6586 0.04% 110 7002 0.05% 111 7457 0.05% 112 7942 0.05% 113 8403 0.06% 114 8977 0.06% 115 9912 0.07% 116 10427 0.07% 117 10724 0.07% 118 11379 0.08% 119 11894 0.08% 120 12692 0.09% 121 13321 0.09% 122 14032 0.09% 123 14887 0.10% 124 15747 0.11% 125 16654 0.11% 126 17552 0.12% 127 18090 0.12% 128 19285 0.13% 129 20441 0.14% 130 22104 0.15% 131 22499 0.15% 132 23622 0.16% 133 25259 0.17% 134 26825 0.18% 135 28780 0.19% 136 30944 0.21% 137 32751 0.22% 138 33922 0.23% 139 36852 0.25% 140 40121 0.27% 141 43957 0.30% 142 48612 0.33% 143 55223 0.37% 144 63637 0.43% 145 77115 0.52% 146 96317 0.65% 147 132552 0.89% 148 209461 1.41% 149 447831 3.02% 150 3116638 21.02% 151 9871329 66.58% 14827049 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=23 prefix-density=0.82 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=35.34 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.8 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=14 prefix-density=0.56 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=55.74 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.7 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958374 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:21:36 Started mapping on | Dec 06 21:21:37 Finished on | Dec 06 21:23:09 Mapping speed, Million of reads per hour | 580.19 Number of input reads | 14827049 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14252816 Uniquely mapped reads % | 96.13% Average mapped length | 298.06 Number of splices: Total | 17205258 Number of splices: Annotated (sjdb) | 16241554 Number of splices: GT/AG | 16970218 Number of splices: GC/AG | 198593 Number of splices: AT/AC | 6419 Number of splices: Non-canonical | 30028 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 240953 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 24151 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.90% % of reads unmapped: other | 1.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 336511 336511 336511 N_multimapping 240953 240953 240953 N_noFeature 555580 13819016 667649 N_ambiguous 374805 1685 53965 UnstrandedReadsAssigned:13322431 PositiveStrandReadsAssigned:432115 NegativeStrandReadsAssigned:13531202 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958374 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958374-trimmed-pair1.fastq SRR6958374-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,827,049 reads, 13,548,812 reads pseudoaligned [quant] estimated average fragment length: 251.965 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52973 SRR6958374.ke.tsv 35125 SRR6958374.se.tsv 88098 total ==> SRR6958374.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 685.527 0 0 PNS24247 1044 793.035 42.018 5.80793 PNS24249 1928 1677.03 24.7695 1.61902 PNS24246 1044 793.035 42.018 5.80793 PNS24248 1044 793.035 42.018 5.80793 PNS24244 1471 1220.03 22.1766 1.99251 PNS24243 293 81.0025 0 0 KQK14069 1603 1352.03 4926 399.379 KQK14071 474 229.472 79.2202 37.8429 ==> SRR6958374.se.tsv <== BRADI_1g14170v3 5587 BRADI_1g53295v3 933 BRADI_1g59795v3 64 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 208 BRADI_1g74790v3 43 BRADI_1g09890v3 0 BRADI_1g77505v3 186 BRADI_1g48960v3 0 SRR6958374 completed mapping pipeline successfully