Starting /dee2/code/volunteer_pipeline.sh SRR6958375 current disk space = 1549143126016 free memory = 1600475572 SRR6958375 SRAfilesize 702eb286a74ae85c89be96780dc069c0 SRR6958375.sra SRR6958375.sra file validated SRR6958375 is paired end SRR6958375 is conventional basespace SRR6958375 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958375_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.25125 32.0 25.0 33.0 18.0 34.0 2 28.343 30.0 25.0 33.0 18.0 33.0 3 30.36225 31.0 29.0 33.0 27.0 33.0 4 30.38375 31.0 29.0 33.0 27.0 33.0 5 32.0685 33.0 33.0 33.0 30.0 33.0 6 36.45525 38.0 36.0 38.0 34.0 38.0 7 37.35225 38.0 38.0 38.0 37.0 38.0 8 37.482 38.0 38.0 38.0 37.0 38.0 9 37.56425 38.0 38.0 38.0 38.0 38.0 10-14 37.54449999999999 38.0 38.0 38.0 37.6 38.0 15-19 37.4418 38.0 38.0 38.0 37.4 38.0 20-24 37.50385 38.0 38.0 38.0 37.6 38.0 25-29 37.5361 38.0 38.0 38.0 37.8 38.0 30-34 37.515299999999996 38.0 38.0 38.0 37.6 38.0 35-39 37.23605 38.0 38.0 38.0 36.6 38.0 40-44 37.574200000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.47795000000001 38.0 38.0 38.0 37.6 38.0 50-54 37.390499999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.0733 38.0 38.0 38.0 36.0 38.0 60-64 37.364999999999995 38.0 38.0 38.0 37.0 38.0 65-69 36.842549999999996 38.0 37.6 38.0 34.8 38.0 70-74 37.0474 38.0 38.0 38.0 35.6 38.0 75-79 36.6382 38.0 37.4 38.0 34.0 38.0 80-84 37.09995 38.0 38.0 38.0 36.0 38.0 85-89 37.15604999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.9942 38.0 38.0 38.0 35.4 38.0 95-99 36.8404 38.0 38.0 38.0 35.0 38.0 100-104 36.742399999999996 38.0 38.0 38.0 34.8 38.0 105-109 36.547799999999995 38.0 38.0 38.0 34.2 38.0 110-114 36.44295 38.0 38.0 38.0 34.0 38.0 115-119 36.27935 38.0 37.4 38.0 33.8 38.0 120-124 36.048199999999994 38.0 37.0 38.0 33.4 38.0 125-129 36.0191 38.0 37.0 38.0 33.2 38.0 130-134 35.72924999999999 38.0 36.0 38.0 31.8 38.0 135-139 34.216899999999995 38.0 33.8 38.0 24.6 38.0 140-144 30.77785 34.4 25.0 38.0 19.2 38.0 145-149 33.7544 38.0 33.0 38.0 24.6 38.0 150-151 29.229375 35.0 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 1.0 18 1.0 19 1.0 20 5.0 21 1.0 22 4.0 23 7.0 24 3.0 25 6.0 26 12.0 27 16.0 28 23.0 29 17.0 30 37.0 31 49.0 32 76.0 33 120.0 34 218.0 35 377.0 36 1106.0 37 1917.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 55.5850358185195 9.498540726983284 6.1820111435394 28.734412310957815 2 27.975 11.774999999999999 33.475 26.775 3 21.05 17.2 26.400000000000002 35.35 4 28.15 25.2 21.375 25.275 5 26.900000000000002 29.95 22.425 20.724999999999998 6 22.45 33.900000000000006 22.3 21.349999999999998 7 18.625 24.349999999999998 39.300000000000004 17.724999999999998 8 20.424999999999997 23.3 30.2 26.075 9 19.650000000000002 20.95 34.375 25.025 10-14 23.155 26.534999999999997 26.125 24.185000000000002 15-19 23.225 25.990000000000002 26.525 24.26 20-24 23.817381738173818 26.127612761276126 26.52265226522652 23.532353235323534 25-29 23.69 25.974999999999998 26.13 24.205 30-34 23.62 26.095000000000002 25.8 24.485 35-39 23.785 26.295 25.66 24.26 40-44 23.44 25.53 26.200000000000003 24.83 45-49 22.985 25.645 26.33 25.040000000000003 50-54 23.71 26.125 25.8 24.365000000000002 55-59 23.44 25.679999999999996 26.77 24.11 60-64 24.195 25.505 25.619999999999997 24.68 65-69 23.330000000000002 25.900000000000002 25.95 24.82 70-74 23.165 25.97 25.869999999999997 24.995 75-79 23.305 26.105 25.580000000000002 25.009999999999998 80-84 24.099999999999998 25.374999999999996 26.025 24.5 85-89 23.665 25.629999999999995 26.0 24.705 90-94 24.27 25.319999999999997 25.759999999999998 24.65 95-99 23.72 25.385 25.905 24.990000000000002 100-104 23.906195309765486 25.696284814240713 25.83629181459073 24.56122806140307 105-109 24.240000000000002 25.869999999999997 25.624999999999996 24.265 110-114 23.94 26.155 25.465 24.44 115-119 24.508578002300805 25.859050667733708 25.708998149352276 23.923373180613215 120-124 23.9 25.474999999999998 25.69 24.935 125-129 23.085777199479534 25.81323190871785 25.83324992493244 25.267740966870182 130-134 24.165 25.745 25.174999999999997 24.915000000000003 135-139 23.755000000000003 26.169999999999998 24.740000000000002 25.335 140-144 23.095 26.345000000000002 25.314999999999998 25.245 145-149 23.605 25.435000000000002 26.009999999999998 24.95 150-151 23.599999999999998 25.15 25.0 26.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.0 28 4.0 29 5.5 30 8.0 31 16.5 32 22.0 33 27.0 34 34.0 35 40.5 36 51.0 37 63.5 38 76.0 39 111.0 40 155.0 41 176.0 42 192.5 43 194.5 44 193.5 45 201.0 46 202.0 47 201.5 48 183.5 49 174.5 50 166.0 51 148.5 52 144.5 53 123.0 54 98.5 55 102.5 56 99.0 57 90.0 58 74.5 59 66.0 60 78.0 61 73.0 62 56.0 63 50.5 64 51.5 65 46.0 66 38.0 67 31.0 68 24.0 69 20.0 70 19.0 71 16.5 72 14.5 73 11.5 74 9.0 75 4.0 76 2.0 77 2.0 78 2.5 79 2.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.034999999999999996 120-124 0.0 125-129 0.09 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83603238866397 97.65 2 1.1133603238866396 2.1999999999999997 3 0.05060728744939271 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.6375000000000002 0.0 0.0 0.0 0.0 110-111 1.8875 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.4749999999999996 0.0 0.0 0.0 0.0 124-125 3.7625 0.0 0.0 0.0 0.0 126-127 4.1125 0.0 0.0 0.0 0.0 128-129 4.487500000000001 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.2625 0.0 0.0 0.0 0.0 134-135 5.7 0.0 0.0 0.0 0.0 136-137 5.9375 0.0 0.0 0.0 0.0 138-139 6.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCTGCT 10 0.005853838 152.57895 1 ACAGTCG 10 0.0068378756 144.95 8 CAGTCGA 10 0.0068378756 144.95 9 CAACAGT 10 0.0068378756 144.95 6 AACAGTC 10 0.0068378756 144.95 7 AAGCTGT 10 0.0068378756 144.95 2 GGACGGC 10 0.0068378756 144.95 145 >>END_MODULE SRR6958375 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958375_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02725 33.0 33.0 34.0 32.0 34.0 2 33.14325 34.0 33.0 34.0 33.0 34.0 3 33.2365 34.0 33.0 34.0 33.0 34.0 4 33.17875 34.0 33.0 34.0 33.0 34.0 5 33.218 34.0 33.0 34.0 33.0 34.0 6 37.36775 38.0 38.0 38.0 37.0 38.0 7 37.4015 38.0 38.0 38.0 38.0 38.0 8 37.39975 38.0 38.0 38.0 38.0 38.0 9 37.34675 38.0 38.0 38.0 38.0 38.0 10-14 37.27425 38.0 38.0 38.0 37.4 38.0 15-19 37.03755 38.0 38.0 38.0 36.4 38.0 20-24 37.27745 38.0 38.0 38.0 37.4 38.0 25-29 37.375699999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.3769 38.0 38.0 38.0 37.8 38.0 35-39 36.738099999999996 38.0 37.8 38.0 34.4 38.0 40-44 37.336 38.0 38.0 38.0 37.8 38.0 45-49 37.24544999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.2629 38.0 38.0 38.0 37.6 38.0 55-59 37.171749999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.136250000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.041700000000006 38.0 38.0 38.0 36.6 38.0 70-74 37.000600000000006 38.0 38.0 38.0 36.6 38.0 75-79 37.01305 38.0 38.0 38.0 36.4 38.0 80-84 35.7528 37.8 35.4 38.0 32.0 38.0 85-89 36.19235 38.0 37.0 38.0 33.2 38.0 90-94 35.12455 38.0 35.4 38.0 28.8 38.0 95-99 34.15319999999999 37.8 33.2 38.0 25.2 38.0 100-104 34.34705 37.8 33.0 38.0 26.6 38.0 105-109 36.21855 38.0 37.8 38.0 33.8 38.0 110-114 36.325149999999994 38.0 38.0 38.0 33.2 38.0 115-119 36.14085 38.0 38.0 38.0 33.0 38.0 120-124 35.94685 38.0 38.0 38.0 32.6 38.0 125-129 35.29475 38.0 36.8 38.0 29.8 38.0 130-134 35.298700000000004 38.0 37.2 38.0 29.6 38.0 135-139 34.655950000000004 38.0 36.0 38.0 27.6 38.0 140-144 31.394 36.0 29.4 38.0 14.8 38.0 145-149 28.689549999999997 35.0 25.0 38.0 2.0 38.0 150-151 22.091625 27.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 0.0 5 0.0 6 3.0 7 1.0 8 1.0 9 3.0 10 1.0 11 2.0 12 0.0 13 1.0 14 1.0 15 0.0 16 4.0 17 6.0 18 6.0 19 4.0 20 6.0 21 7.0 22 12.0 23 4.0 24 10.0 25 17.0 26 19.0 27 29.0 28 29.0 29 31.0 30 43.0 31 68.0 32 103.0 33 130.0 34 220.0 35 423.0 36 1172.0 37 1637.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.1 20.7 7.775 25.424999999999997 2 30.7 22.1 28.575 18.625 3 22.05 24.725 28.825 24.4 4 25.45 31.95 21.425 21.175 5 27.325 34.875 18.75 19.05 6 22.575 35.75 20.724999999999998 20.95 7 22.15 20.325 34.925 22.6 8 23.375 23.925 25.124999999999996 27.575 9 24.099999999999998 24.05 26.924999999999997 24.925 10-14 25.71 26.455000000000002 24.075 23.76 15-19 25.275 25.295 24.9 24.529999999999998 20-24 24.63 26.52 24.975 23.875 25-29 25.540000000000003 26.685 24.385 23.39 30-34 25.025 26.174999999999997 24.97 23.830000000000002 35-39 24.825 26.57 24.57 24.035 40-44 25.0 26.07 25.064999999999998 23.865 45-49 24.62 25.855 25.480000000000004 24.044999999999998 50-54 25.155062024809926 25.755302120848338 25.180072028811523 23.90956382553021 55-59 25.292529252925295 26.017601760176017 24.772477247724773 23.91739173917392 60-64 25.656414103525883 25.87146786696674 24.621155288822205 23.850962740685173 65-69 25.36 26.090000000000003 24.585 23.965 70-74 25.02876582120166 26.034318875381462 25.489018960428233 23.447896342988646 75-79 25.03001200480192 26.040416166466585 25.090036014405765 23.83953581432573 80-84 25.068801601200903 25.82937202902177 25.43907930948211 23.66274706029522 85-89 25.5927963981991 25.982991495747875 25.152576288144076 23.271635817908955 90-94 24.67870180527079 26.138920838125717 25.348802320348053 23.83357503625544 95-99 24.635 25.665 25.615 24.085 100-104 25.669999999999998 26.045 24.93 23.355 105-109 25.277583274982497 26.05781734520356 25.27258177453236 23.392017605281584 110-114 25.365 26.07 25.415 23.150000000000002 115-119 25.881470367591895 25.93148287071768 24.836209052263065 23.350837709427356 120-124 25.742574257425744 26.37763776377638 24.352435243524354 23.527352735273528 125-129 25.23878581787268 27.129069360404063 24.37365604840726 23.258488773315996 130-134 26.179999999999996 25.61 24.945 23.265 135-139 26.371592898224556 25.9964991247812 25.046261565391347 22.5856464116029 140-144 25.735000000000003 26.179999999999996 25.14 22.945 145-149 26.447644764476447 25.697569756975696 24.877487748774875 22.977297729772978 150-151 26.172314617981744 26.32237088908341 25.084406652494685 22.420907840440165 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 2.5 27 4.0 28 5.0 29 3.0 30 6.5 31 12.0 32 17.0 33 24.5 34 26.5 35 34.0 36 47.0 37 56.5 38 78.5 39 101.5 40 126.5 41 164.5 42 184.5 43 194.0 44 205.5 45 201.5 46 201.0 47 197.5 48 195.0 49 176.5 50 157.5 51 159.5 52 135.0 53 117.0 54 98.0 55 84.5 56 90.0 57 86.5 58 82.0 59 75.5 60 75.0 61 71.5 62 70.5 63 66.5 64 54.5 65 52.5 66 44.0 67 35.5 68 31.0 69 35.5 70 32.0 71 20.5 72 20.0 73 13.0 74 7.5 75 6.5 76 4.0 77 2.0 78 1.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.04 55-59 0.01 60-64 0.025 65-69 0.0 70-74 0.055 75-79 0.04 80-84 0.075 85-89 0.05 90-94 0.015 95-99 0.0 100-104 0.0 105-109 0.03 110-114 0.0 115-119 0.025 120-124 0.01 125-129 0.015 130-134 0.0 135-139 0.025 140-144 0.0 145-149 0.01 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62280030604438 96.675 2 0.9946442234123948 1.95 3 0.22953328232593728 0.675 4 0.0510073960724305 0.2 5 0.102014792144861 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit GCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCC 5 0.125 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.6875 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.525 0.0 0.0 0.0 0.0 126-127 3.9749999999999996 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.9375 0.0 0.0 0.0 0.0 132-133 5.4625 0.0 0.0 0.0 0.0 134-135 5.9 0.0 0.0 0.0 0.0 136-137 6.1125 0.0 0.0 0.0 0.0 138-139 6.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926206 spots for SRR6958375.sra Written 926206 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra Read 926202 spots for SRR6958375.sra Written 926202 spots for SRR6958375.sra SRR ids: ['SRR6958375.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bbn24b2w SRR6958375.sra spots: 18524044 blocks: [[1, 926202], [926203, 1852404], [1852405, 2778606], [2778607, 3704808], [3704809, 4631010], [4631011, 5557212], [5557213, 6483414], [6483415, 7409616], [7409617, 8335818], [8335819, 9262020], [9262021, 10188222], [10188223, 11114424], [11114425, 12040626], [12040627, 12966828], [12966829, 13893030], [13893031, 14819232], [14819233, 15745434], [15745435, 16671636], [16671637, 17597838], [17597839, 18524044]] SRR6958375 file size 6255490 SRR6958375 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958375 SRR6958375_1.fastq SRR6958375_2.fastq Input file: SRR6958375_1.fastq Paired file: SRR6958375_2.fastq trimmed: SRR6958375-trimmed-pair1.fastq, SRR6958375-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:22:14 2024 >> started Fri Dec 6 21:22:33 2024 >> done (19.325s) 18524044 read pairs processed; of these: 14436 ( 0.08%) short read pairs filtered out after trimming by size control 15154 ( 0.08%) empty read pairs filtered out after trimming by size control 18494454 (99.84%) read pairs available; of these: 7514455 (40.63%) trimmed read pairs available after processing 10979999 (59.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 6 0.00% 21 15 0.00% 22 15 0.00% 23 11 0.00% 24 13 0.00% 25 10 0.00% 26 14 0.00% 27 8 0.00% 28 17 0.00% 29 20 0.00% 30 21 0.00% 31 12 0.00% 32 14 0.00% 33 23 0.00% 34 17 0.00% 35 16 0.00% 36 16 0.00% 37 28 0.00% 38 17 0.00% 39 22 0.00% 40 33 0.00% 41 27 0.00% 42 29 0.00% 43 41 0.00% 44 29 0.00% 45 32 0.00% 46 41 0.00% 47 62 0.00% 48 55 0.00% 49 41 0.00% 50 59 0.00% 51 71 0.00% 52 94 0.00% 53 86 0.00% 54 101 0.00% 55 98 0.00% 56 127 0.00% 57 155 0.00% 58 173 0.00% 59 190 0.00% 60 204 0.00% 61 235 0.00% 62 294 0.00% 63 319 0.00% 64 372 0.00% 65 345 0.00% 66 398 0.00% 67 468 0.00% 68 523 0.00% 69 586 0.00% 70 691 0.00% 71 770 0.00% 72 885 0.00% 73 931 0.01% 74 1174 0.01% 75 1226 0.01% 76 1612 0.01% 77 1907 0.01% 78 1877 0.01% 79 1948 0.01% 80 2224 0.01% 81 2600 0.01% 82 2850 0.02% 83 3202 0.02% 84 4287 0.02% 85 4599 0.02% 86 5002 0.03% 87 5571 0.03% 88 5841 0.03% 89 6322 0.03% 90 6799 0.04% 91 7218 0.04% 92 8109 0.04% 93 8852 0.05% 94 9669 0.05% 95 10096 0.05% 96 10901 0.06% 97 11665 0.06% 98 12179 0.07% 99 13999 0.08% 100 17285 0.09% 101 19951 0.11% 102 15843 0.09% 103 16960 0.09% 104 17780 0.10% 105 18785 0.10% 106 20297 0.11% 107 20759 0.11% 108 21360 0.12% 109 22676 0.12% 110 23332 0.13% 111 24863 0.13% 112 26064 0.14% 113 27173 0.15% 114 29077 0.16% 115 30819 0.17% 116 31541 0.17% 117 32188 0.17% 118 33287 0.18% 119 34562 0.19% 120 35545 0.19% 121 36648 0.20% 122 38405 0.21% 123 40291 0.22% 124 41900 0.23% 125 43864 0.24% 126 44841 0.24% 127 46549 0.25% 128 47499 0.26% 129 49504 0.27% 130 50674 0.27% 131 52340 0.28% 132 54992 0.30% 133 56608 0.31% 134 59069 0.32% 135 62525 0.34% 136 63954 0.35% 137 65988 0.36% 138 68256 0.37% 139 73153 0.40% 140 77020 0.42% 141 82221 0.44% 142 88872 0.48% 143 97642 0.53% 144 109821 0.59% 145 128003 0.69% 146 153778 0.83% 147 202872 1.10% 148 300463 1.62% 149 606987 3.28% 150 3988942 21.57% 151 10979999 59.37% 18494454 reads passed initial QC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=14 prefix-density=1.08 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=66.50 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=17 prefix-density=0.73 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=148.35 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=6.9 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCC SRR6958375 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:23:25 Started mapping on | Dec 06 21:23:25 Finished on | Dec 06 21:24:48 Mapping speed, Million of reads per hour | 802.17 Number of input reads | 18494454 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18108375 Uniquely mapped reads % | 97.91% Average mapped length | 294.80 Number of splices: Total | 19972772 Number of splices: Annotated (sjdb) | 18716381 Number of splices: GT/AG | 19708609 Number of splices: GC/AG | 227739 Number of splices: AT/AC | 7341 Number of splices: Non-canonical | 29083 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 146051 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 9669 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.98% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 249382 249382 249382 N_multimapping 146051 146051 146051 N_noFeature 730931 17557875 914803 N_ambiguous 436948 2663 70717 UnstrandedReadsAssigned:16940496 PositiveStrandReadsAssigned:547837 NegativeStrandReadsAssigned:17122855 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958375 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958375-trimmed-pair1.fastq SRR6958375-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,494,454 reads, 17,121,207 reads pseudoaligned [quant] estimated average fragment length: 245.319 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR6958375.ke.tsv 35125 SRR6958375.se.tsv 88098 total ==> SRR6958375.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 692.288 0 0 PNS24247 1044 799.681 59.6558 6.62907 PNS24249 1928 1683.68 36.4167 1.92202 PNS24246 1044 799.681 59.6558 6.62907 PNS24248 1044 799.681 59.6558 6.62907 PNS24244 1471 1226.68 19.616 1.42101 PNS24243 293 93.8416 0 0 KQK14069 1603 1358.68 5989.87 391.757 KQK14071 474 240.223 125.663 46.4848 ==> SRR6958375.se.tsv <== BRADI_1g14170v3 7003 BRADI_1g53295v3 193 BRADI_1g59795v3 393 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 244 BRADI_1g74790v3 69 BRADI_1g09890v3 0 BRADI_1g77505v3 221 BRADI_1g48960v3 0 SRR6958375 completed mapping pipeline successfully