Starting /dee2/code/volunteer_pipeline.sh SRR6958376 current disk space = 1549140369408 free memory = 1598277020 SRR6958376 SRAfilesize a225006cb4967d582ca49e965aabe0b2 SRR6958376.sra SRR6958376.sra file validated SRR6958376 is paired end SRR6958376 is conventional basespace SRR6958376 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958376_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.6735 28.0 18.0 33.0 18.0 33.0 2 29.09975 30.0 27.0 33.0 18.0 33.0 3 30.389 31.0 29.0 33.0 27.0 33.0 4 32.41425 33.0 32.0 33.0 32.0 34.0 5 32.532 33.0 33.0 33.0 32.0 34.0 6 36.68375 38.0 37.0 38.0 34.0 38.0 7 37.2 38.0 38.0 38.0 36.0 38.0 8 36.13625 38.0 38.0 38.0 31.0 38.0 9 37.247 38.0 38.0 38.0 36.0 38.0 10-14 36.5269 38.0 37.0 38.0 31.4 38.0 15-19 37.45655000000001 38.0 38.0 38.0 37.2 38.0 20-24 37.595600000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.564949999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.5206 38.0 38.0 38.0 38.0 38.0 35-39 37.30435 38.0 38.0 38.0 37.0 38.0 40-44 37.438649999999996 38.0 38.0 38.0 37.2 38.0 45-49 37.4763 38.0 38.0 38.0 37.4 38.0 50-54 36.641650000000006 38.0 37.6 38.0 33.8 38.0 55-59 37.1382 38.0 38.0 38.0 36.4 38.0 60-64 37.305499999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.317800000000005 38.0 38.0 38.0 37.0 38.0 70-74 37.3597 38.0 38.0 38.0 37.0 38.0 75-79 36.837650000000004 38.0 37.8 38.0 34.8 38.0 80-84 37.035199999999996 38.0 38.0 38.0 35.6 38.0 85-89 37.1766 38.0 38.0 38.0 36.2 38.0 90-94 35.638099999999994 38.0 35.6 38.0 29.8 38.0 95-99 36.846799999999995 38.0 38.0 38.0 34.8 38.0 100-104 36.932249999999996 38.0 38.0 38.0 35.2 38.0 105-109 36.74515 38.0 38.0 38.0 34.8 38.0 110-114 36.65955 38.0 38.0 38.0 34.4 38.0 115-119 36.2943 38.0 37.6 38.0 33.2 38.0 120-124 36.1706 38.0 37.6 38.0 33.6 38.0 125-129 36.13315000000001 38.0 37.6 38.0 33.6 38.0 130-134 36.1303 38.0 37.8 38.0 33.4 38.0 135-139 35.8861 38.0 37.2 38.0 32.2 38.0 140-144 35.611399999999996 38.0 36.2 38.0 31.0 38.0 145-149 34.89895 38.0 35.8 38.0 30.2 38.0 150-151 30.719125 35.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 0.0 18 2.0 19 0.0 20 1.0 21 1.0 22 2.0 23 7.0 24 7.0 25 9.0 26 10.0 27 15.0 28 17.0 29 24.0 30 32.0 31 48.0 32 69.0 33 105.0 34 124.0 35 279.0 36 756.0 37 2487.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.49550475211919 14.076547649627535 6.396095556126381 32.03185204212689 2 24.725 12.825000000000001 31.424999999999997 31.025000000000002 3 19.950000000000003 18.325 25.674999999999997 36.05 4 25.674999999999997 24.85 21.85 27.625 5 25.825 30.525000000000002 22.325 21.325 6 22.1 33.1 23.200000000000003 21.6 7 16.475 23.875 40.65 19.0 8 19.35 24.5 29.925 26.224999999999998 9 19.075 21.175 34.150000000000006 25.6 10-14 22.8 26.61 25.965 24.625 15-19 22.275 26.365 26.005 25.355 20-24 22.52 26.365 25.795 25.319999999999997 25-29 22.955000000000002 25.75 26.31 24.985 30-34 22.395 25.874999999999996 26.705000000000002 25.025 35-39 22.605 25.535000000000004 26.445 25.415 40-44 22.18 25.814999999999998 26.31 25.695 45-49 22.585 26.275 25.835 25.305 50-54 22.814999999999998 25.695 26.41 25.080000000000002 55-59 23.275000000000002 25.945 25.795 24.985 60-64 22.945 25.330000000000002 26.650000000000002 25.074999999999996 65-69 23.5 25.455 25.929999999999996 25.115 70-74 23.16 25.380000000000003 26.174999999999997 25.285000000000004 75-79 22.825 25.490000000000002 26.05 25.635 80-84 22.875 25.21 26.150000000000002 25.765 85-89 22.745 25.569999999999997 25.66 26.025 90-94 23.705000000000002 24.995 26.145000000000003 25.155 95-99 22.264999999999997 25.045 26.625 26.064999999999998 100-104 22.975 25.575 25.72 25.729999999999997 105-109 22.6 25.91 25.679999999999996 25.81 110-114 23.365 25.369999999999997 26.484999999999996 24.779999999999998 115-119 23.415 25.56 25.85 25.174999999999997 120-124 23.369999999999997 25.28 26.02 25.330000000000002 125-129 23.155 25.759999999999998 25.395 25.69 130-134 23.494999999999997 25.590000000000003 25.965 24.95 135-139 23.385 25.590000000000003 25.595000000000002 25.430000000000003 140-144 23.185 25.46 25.45 25.905 145-149 23.785 25.569999999999997 25.525 25.119999999999997 150-151 22.8625 25.724999999999998 25.85 25.5625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.5 26 2.5 27 3.5 28 8.5 29 8.5 30 7.5 31 10.5 32 13.5 33 24.5 34 35.0 35 42.0 36 48.5 37 65.5 38 86.5 39 104.5 40 128.0 41 147.0 42 179.5 43 207.0 44 219.0 45 229.0 46 223.0 47 206.0 48 192.0 49 178.5 50 170.0 51 153.5 52 137.0 53 119.0 54 98.0 55 89.5 56 75.0 57 75.0 58 79.0 59 69.5 60 66.0 61 62.0 62 59.0 63 58.5 64 54.0 65 49.0 66 43.0 67 38.0 68 30.0 69 23.5 70 19.0 71 14.0 72 12.0 73 10.5 74 8.5 75 6.0 76 3.0 77 2.0 78 1.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.4523749685850716 0.8999999999999999 3 0.0 0.0 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7124999999999999 0.0 0.0 0.0 0.0 104-105 0.8999999999999999 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.1500000000000004 0.0 0.0 0.0 0.0 118-119 2.35 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.8 0.0 0.0 0.0 0.0 128-129 4.1625 0.0 0.0 0.0 0.0 130-131 4.4625 0.0 0.0 0.0 0.0 132-133 4.9125 0.0 0.0 0.0 0.0 134-135 5.475 0.0 0.0 0.0 0.0 136-137 6.0125 0.0 0.0 0.0 0.0 138-139 6.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958376 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958376_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9335 33.0 33.0 34.0 32.0 34.0 2 33.062 34.0 33.0 34.0 33.0 34.0 3 33.0185 34.0 33.0 34.0 33.0 34.0 4 32.996 34.0 33.0 34.0 32.0 34.0 5 32.86525 34.0 33.0 34.0 32.0 34.0 6 37.0705 38.0 38.0 38.0 36.0 38.0 7 37.092 38.0 38.0 38.0 37.0 38.0 8 37.06025 38.0 38.0 38.0 37.0 38.0 9 37.0695 38.0 38.0 38.0 37.0 38.0 10-14 37.163399999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.2033 38.0 38.0 38.0 37.0 38.0 20-24 37.14815 38.0 38.0 38.0 37.0 38.0 25-29 37.04 38.0 38.0 38.0 36.6 38.0 30-34 37.119150000000005 38.0 38.0 38.0 37.0 38.0 35-39 36.6644 38.0 38.0 38.0 35.0 38.0 40-44 36.5089 38.0 38.0 38.0 34.6 38.0 45-49 36.45925 38.0 38.0 38.0 34.2 38.0 50-54 36.8515 38.0 38.0 38.0 35.8 38.0 55-59 35.58965 38.0 36.8 38.0 28.4 38.0 60-64 36.817499999999995 38.0 38.0 38.0 35.6 38.0 65-69 36.8388 38.0 38.0 38.0 36.0 38.0 70-74 36.8052 38.0 38.0 38.0 35.8 38.0 75-79 36.40355 38.0 37.8 38.0 33.4 38.0 80-84 36.5885 38.0 38.0 38.0 35.0 38.0 85-89 35.8743 38.0 37.0 38.0 29.6 38.0 90-94 36.11565 38.0 37.6 38.0 33.2 38.0 95-99 36.2841 38.0 38.0 38.0 34.0 38.0 100-104 36.257600000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.23295 38.0 38.0 38.0 34.0 38.0 110-114 36.10865 38.0 38.0 38.0 33.6 38.0 115-119 36.0103 38.0 38.0 38.0 33.6 38.0 120-124 35.6738 38.0 37.0 38.0 31.8 38.0 125-129 35.29655 38.0 36.4 38.0 30.2 38.0 130-134 34.47735 38.0 34.4 38.0 25.8 38.0 135-139 33.54755 38.0 32.8 38.0 21.2 38.0 140-144 34.12779999999999 38.0 34.8 38.0 25.0 38.0 145-149 33.4736 38.0 33.8 38.0 20.4 38.0 150-151 28.123125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 2.0 5 0.0 6 2.0 7 2.0 8 1.0 9 1.0 10 2.0 11 0.0 12 0.0 13 1.0 14 0.0 15 5.0 16 0.0 17 2.0 18 2.0 19 2.0 20 3.0 21 9.0 22 8.0 23 11.0 24 20.0 25 16.0 26 25.0 27 19.0 28 32.0 29 46.0 30 45.0 31 52.0 32 93.0 33 106.0 34 187.0 35 304.0 36 662.0 37 2324.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.45 20.9 9.35 24.3 2 30.599999999999998 22.6 27.450000000000003 19.35 3 23.0 25.15 29.625 22.225 4 25.775 32.175 20.75 21.3 5 26.974999999999998 34.55 19.650000000000002 18.825 6 21.675 37.5 20.4 20.424999999999997 7 21.825 20.45 35.35 22.375 8 22.900000000000002 23.525 24.825 28.749999999999996 9 23.275000000000002 22.875 27.675 26.174999999999997 10-14 25.555 26.625 23.61 24.21 15-19 25.745149029805965 25.5251050210042 25.25505101020204 23.4746949389878 20-24 25.386346586646663 26.261565391347837 24.566141535383846 23.785946486621658 25-29 25.56 25.825 24.404999999999998 24.21 30-34 25.430000000000003 26.205000000000002 24.715 23.65 35-39 24.993749062359356 26.118917837675653 24.413662049307398 24.4736710506576 40-44 25.71 25.790000000000003 24.7 23.799999999999997 45-49 25.69 25.345000000000002 25.28 23.685000000000002 50-54 25.905 25.535000000000004 24.845 23.715 55-59 25.885 25.97 24.645 23.5 60-64 25.380000000000003 26.5 24.43 23.69 65-69 26.056514128532132 26.18154538634659 24.346086521630408 23.415853963490875 70-74 26.345000000000002 25.055 24.955 23.645 75-79 25.135 25.85 25.275 23.74 80-84 25.259999999999998 25.929999999999996 25.28 23.53 85-89 25.136284071017755 26.22155538884721 24.621155288822205 24.021005251312825 90-94 25.619999999999997 25.929999999999996 24.75 23.7 95-99 25.395 26.77 24.65 23.185 100-104 25.633845076761514 26.173926088913333 25.068760314047108 23.123468520278042 105-109 25.1 25.674999999999997 25.6 23.625 110-114 25.643846576986544 26.35895384307646 24.8887333099965 23.108466269940493 115-119 26.391597899474867 26.266566641660415 24.63115778944736 22.710677669417354 120-124 25.965 26.505000000000003 24.65 22.88 125-129 26.179999999999996 26.82 24.099999999999998 22.900000000000002 130-134 26.075215043008605 26.400280056011205 24.97999599919984 22.544508901780354 135-139 26.66166541635409 26.03650912728182 25.09127281820455 22.210552638159538 140-144 26.584999999999997 26.119999999999997 25.595000000000002 21.7 145-149 27.21 26.340000000000003 24.18 22.27 150-151 26.987499999999997 26.9125 24.637500000000003 21.462500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.0 25 0.0 26 0.5 27 3.0 28 6.0 29 5.5 30 8.5 31 12.5 32 12.5 33 17.0 34 31.0 35 38.0 36 43.0 37 53.5 38 71.0 39 103.5 40 134.5 41 158.0 42 170.0 43 175.0 44 190.0 45 197.5 46 202.5 47 202.5 48 192.5 49 187.5 50 158.0 51 157.0 52 162.5 53 117.5 54 93.5 55 93.5 56 79.5 57 80.0 58 90.0 59 81.5 60 70.5 61 63.0 62 57.0 63 61.5 64 62.0 65 54.5 66 57.5 67 49.5 68 42.5 69 44.0 70 28.0 71 16.5 72 17.0 73 13.5 74 11.0 75 7.0 76 5.0 77 4.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.02 20-24 0.025 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.025 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.025 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.015 115-119 0.025 120-124 0.0 125-129 0.0 130-134 0.02 135-139 0.025 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03602232369354 97.6 2 0.684931506849315 1.35 3 0.15220700152207 0.44999999999999996 4 0.076103500761035 0.3 5 0.025367833587011668 0.125 6 0.0 0.0 7 0.025367833587011668 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 7 0.17500000000000002 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.8 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.375 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.2875 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.3125 0.0 0.0 0.0 0.0 132-133 4.725 0.0 0.0 0.0 0.0 134-135 5.25 0.0 0.0 0.0 0.0 136-137 5.7875 0.0 0.0 0.0 0.0 138-139 6.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGACCA 10 0.006830828 145.0 145 GCTTCGT 10 0.006830828 145.0 6 CTCGTGG 10 0.006830828 145.0 145 >>END_MODULE Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152790 spots for SRR6958376.sra Written 1152790 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra Read 1152787 spots for SRR6958376.sra Written 1152787 spots for SRR6958376.sra SRR ids: ['SRR6958376.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6xtqeixx SRR6958376.sra spots: 23055743 blocks: [[1, 1152787], [1152788, 2305574], [2305575, 3458361], [3458362, 4611148], [4611149, 5763935], [5763936, 6916722], [6916723, 8069509], [8069510, 9222296], [9222297, 10375083], [10375084, 11527870], [11527871, 12680657], [12680658, 13833444], [13833445, 14986231], [14986232, 16139018], [16139019, 17291805], [17291806, 18444592], [18444593, 19597379], [19597380, 20750166], [20750167, 21902953], [21902954, 23055743]] SRR6958376 file size 7791134 SRR6958376 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958376 SRR6958376_1.fastq SRR6958376_2.fastq Input file: SRR6958376_1.fastq Paired file: SRR6958376_2.fastq trimmed: SRR6958376-trimmed-pair1.fastq, SRR6958376-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:24:28 2024 >> started Fri Dec 6 21:24:54 2024 >> done (26.319s) 23055743 read pairs processed; of these: 29230 ( 0.13%) short read pairs filtered out after trimming by size control 25138 ( 0.11%) empty read pairs filtered out after trimming by size control 23001375 (99.76%) read pairs available; of these: 8824645 (38.37%) trimmed read pairs available after processing 14176730 (61.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 12 0.00% 20 11 0.00% 21 17 0.00% 22 13 0.00% 23 17 0.00% 24 12 0.00% 25 11 0.00% 26 17 0.00% 27 12 0.00% 28 20 0.00% 29 16 0.00% 30 17 0.00% 31 18 0.00% 32 23 0.00% 33 14 0.00% 34 17 0.00% 35 13 0.00% 36 21 0.00% 37 22 0.00% 38 38 0.00% 39 28 0.00% 40 25 0.00% 41 37 0.00% 42 24 0.00% 43 39 0.00% 44 43 0.00% 45 48 0.00% 46 44 0.00% 47 59 0.00% 48 56 0.00% 49 76 0.00% 50 78 0.00% 51 90 0.00% 52 93 0.00% 53 84 0.00% 54 106 0.00% 55 112 0.00% 56 143 0.00% 57 169 0.00% 58 177 0.00% 59 193 0.00% 60 251 0.00% 61 295 0.00% 62 313 0.00% 63 366 0.00% 64 376 0.00% 65 407 0.00% 66 496 0.00% 67 557 0.00% 68 598 0.00% 69 698 0.00% 70 785 0.00% 71 812 0.00% 72 977 0.00% 73 1221 0.01% 74 1391 0.01% 75 1481 0.01% 76 1714 0.01% 77 1968 0.01% 78 2156 0.01% 79 2384 0.01% 80 2694 0.01% 81 3008 0.01% 82 3440 0.01% 83 3827 0.02% 84 5488 0.02% 85 6568 0.03% 86 7078 0.03% 87 7532 0.03% 88 8024 0.03% 89 8268 0.04% 90 8877 0.04% 91 9450 0.04% 92 10387 0.05% 93 10915 0.05% 94 11823 0.05% 95 12589 0.05% 96 13323 0.06% 97 14351 0.06% 98 14861 0.06% 99 16137 0.07% 100 17144 0.07% 101 17861 0.08% 102 19582 0.09% 103 20733 0.09% 104 21842 0.09% 105 22917 0.10% 106 24090 0.10% 107 25164 0.11% 108 26535 0.12% 109 27626 0.12% 110 28962 0.13% 111 30482 0.13% 112 32115 0.14% 113 33529 0.15% 114 35687 0.16% 115 37652 0.16% 116 39014 0.17% 117 39927 0.17% 118 41282 0.18% 119 42296 0.18% 120 44485 0.19% 121 45641 0.20% 122 47696 0.21% 123 49838 0.22% 124 52760 0.23% 125 54344 0.24% 126 56224 0.24% 127 57549 0.25% 128 58396 0.25% 129 60800 0.26% 130 63363 0.28% 131 65691 0.29% 132 67364 0.29% 133 71388 0.31% 134 73922 0.32% 135 76373 0.33% 136 78850 0.34% 137 81966 0.36% 138 85662 0.37% 139 89968 0.39% 140 94063 0.41% 141 100625 0.44% 142 109492 0.48% 143 118569 0.52% 144 132972 0.58% 145 152763 0.66% 146 183866 0.80% 147 239598 1.04% 148 343152 1.49% 149 672172 2.92% 150 4610690 20.05% 151 14176730 61.63% 23001375 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=33 prefix-density=0.70 prefix-fanout=2.4 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=52.42 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=29 prefix-density=0.42 prefix-fanout=2.4 sequence=GCACCAGCTGCACCTGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=65.69 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=11.4 sequence=CCGCCGCCGCCG SRR6958376 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:25:35 Started mapping on | Dec 06 21:25:35 Finished on | Dec 06 21:27:31 Mapping speed, Million of reads per hour | 713.84 Number of input reads | 23001375 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 22385106 Uniquely mapped reads % | 97.32% Average mapped length | 294.92 Number of splices: Total | 25135521 Number of splices: Annotated (sjdb) | 23548516 Number of splices: GT/AG | 24798700 Number of splices: GC/AG | 290296 Number of splices: AT/AC | 11376 Number of splices: Non-canonical | 35149 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226227 % of reads mapped to multiple loci | 0.98% Number of reads mapped to too many loci | 10567 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.41% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 412143 412143 412143 N_multimapping 226227 226227 226227 N_noFeature 908174 21739765 1120105 N_ambiguous 519172 3416 86243 UnstrandedReadsAssigned:20957760 PositiveStrandReadsAssigned:641925 NegativeStrandReadsAssigned:21178758 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958376 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958376-trimmed-pair1.fastq SRR6958376-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,001,375 reads, 21,225,130 reads pseudoaligned [quant] estimated average fragment length: 261.539 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR6958376.ke.tsv 35125 SRR6958376.se.tsv 88098 total ==> SRR6958376.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 676.137 0 0 PNS24247 1044 783.461 72.9821 6.46174 PNS24249 1928 1667.46 67.6388 2.81378 PNS24246 1044 783.461 72.9821 6.46174 PNS24248 1044 783.461 72.9821 6.46174 PNS24244 1471 1210.46 47.4149 2.71716 PNS24243 293 93.7094 0 0 KQK14069 1603 1342.46 1524.27 78.761 KQK14071 474 234.171 32.6157 9.66151 ==> SRR6958376.se.tsv <== BRADI_1g14170v3 1841 BRADI_1g53295v3 217 BRADI_1g59795v3 660 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 395 BRADI_1g74790v3 108 BRADI_1g09890v3 0 BRADI_1g77505v3 349 BRADI_1g48960v3 0 SRR6958376 completed mapping pipeline successfully