Starting /dee2/code/volunteer_pipeline.sh SRR6958377 current disk space = 1549123641344 free memory = 1603605488 SRR6958377 SRAfilesize c2dc8e6aa7491ed39d7e614653320b08 SRR6958377.sra SRR6958377.sra file validated SRR6958377 is paired end SRR6958377 is conventional basespace SRR6958377 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958377_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.56125 32.0 18.0 33.0 18.0 34.0 2 31.37375 33.0 30.0 34.0 27.0 34.0 3 31.955 33.0 31.0 33.0 29.0 34.0 4 32.63725 33.0 33.0 34.0 31.0 34.0 5 33.0415 33.0 33.0 34.0 33.0 34.0 6 36.67975 38.0 37.0 38.0 34.0 38.0 7 37.407 38.0 38.0 38.0 37.0 38.0 8 37.5395 38.0 38.0 38.0 37.0 38.0 9 37.514 38.0 38.0 38.0 38.0 38.0 10-14 37.55365 38.0 38.0 38.0 37.8 38.0 15-19 37.56375 38.0 38.0 38.0 38.0 38.0 20-24 37.493399999999994 38.0 38.0 38.0 37.6 38.0 25-29 37.288 38.0 38.0 38.0 36.4 38.0 30-34 37.56525 38.0 38.0 38.0 37.8 38.0 35-39 37.462149999999994 38.0 38.0 38.0 37.4 38.0 40-44 37.215599999999995 38.0 38.0 38.0 36.2 38.0 45-49 37.3352 38.0 38.0 38.0 37.0 38.0 50-54 37.221450000000004 38.0 38.0 38.0 36.4 38.0 55-59 37.1571 38.0 38.0 38.0 36.0 38.0 60-64 37.20565 38.0 38.0 38.0 36.2 38.0 65-69 37.1317 38.0 38.0 38.0 36.0 38.0 70-74 36.87385 38.0 38.0 38.0 35.2 38.0 75-79 37.04145 38.0 38.0 38.0 36.0 38.0 80-84 36.950250000000004 38.0 38.0 38.0 35.4 38.0 85-89 36.791250000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.6296 38.0 38.0 38.0 34.2 38.0 95-99 36.649150000000006 38.0 38.0 38.0 34.2 38.0 100-104 36.4495 38.0 38.0 38.0 34.0 38.0 105-109 36.2792 38.0 37.8 38.0 33.4 38.0 110-114 35.9816 38.0 37.2 38.0 32.8 38.0 115-119 35.76514999999999 38.0 36.8 38.0 31.4 38.0 120-124 35.728049999999996 38.0 36.4 38.0 31.4 38.0 125-129 35.40605000000001 38.0 36.0 38.0 30.6 38.0 130-134 35.0025 38.0 35.4 38.0 28.0 38.0 135-139 34.9918 38.0 35.2 38.0 29.0 38.0 140-144 34.4639 38.0 33.8 38.0 27.4 38.0 145-149 33.23895 38.0 33.0 38.0 19.4 38.0 150-151 28.846625 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 1.0 17 0.0 18 3.0 19 1.0 20 0.0 21 6.0 22 3.0 23 6.0 24 4.0 25 12.0 26 11.0 27 20.0 28 26.0 29 30.0 30 45.0 31 49.0 32 88.0 33 133.0 34 190.0 35 336.0 36 826.0 37 2208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.139365574622985 12.246489859594384 8.996359854394175 44.61778471138845 2 22.225 12.825000000000001 36.925000000000004 28.025 3 19.375 16.900000000000002 25.674999999999997 38.05 4 24.45 26.950000000000003 22.275 26.325 5 25.6 29.375 24.55 20.474999999999998 6 22.175 33.300000000000004 22.45 22.075 7 17.825 27.3 37.525 17.349999999999998 8 19.900000000000002 23.549999999999997 30.675 25.874999999999996 9 19.6 23.175 32.925 24.3 10-14 21.94 27.93 25.95 24.18 15-19 21.61 26.57 27.235 24.585 20-24 21.91 26.63 26.840000000000003 24.62 25-29 22.285 26.605 26.965 24.145 30-34 22.59 26.245 26.245 24.92 35-39 21.735 26.255 27.229999999999997 24.779999999999998 40-44 21.67 26.645000000000003 26.85 24.834999999999997 45-49 22.09 26.565 26.790000000000003 24.555 50-54 21.575 26.619999999999997 27.0 24.805 55-59 22.345000000000002 26.66 26.625 24.37 60-64 22.045 26.68 26.21 25.064999999999998 65-69 22.539507901580315 26.24524904980996 26.47029405881176 24.74494898979796 70-74 21.950487621905477 26.791697924481124 26.66166541635409 24.596149037259316 75-79 21.995 26.200000000000003 27.04 24.765 80-84 22.41 25.655 26.924999999999997 25.009999999999998 85-89 22.545 26.334999999999997 26.424999999999997 24.695 90-94 22.305 26.235000000000003 26.424999999999997 25.035 95-99 22.615 25.955000000000002 26.69 24.740000000000002 100-104 22.443466079647788 26.110666399839904 26.691014608765258 24.75485291174705 105-109 22.065 26.314999999999998 26.495 25.124999999999996 110-114 22.537261002659708 25.91458824710192 26.6924273598635 24.855723390374866 115-119 22.773020880276402 26.863952731460618 26.31315407340644 24.04987231485654 120-124 22.791652069465993 25.489214754016317 26.550222711575998 25.168910464941696 125-129 22.45983935742972 26.00401606425703 26.410642570281123 25.12550200803213 130-134 23.026085215040304 26.12026235417814 26.300505682671606 24.55314674810995 135-139 22.15 26.38 26.435 25.035 140-144 22.875 25.955000000000002 26.290000000000003 24.88 145-149 22.68 25.19 26.650000000000002 25.480000000000004 150-151 22.8625 27.1 25.650000000000002 24.3875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 4.5 28 5.5 29 6.0 30 7.0 31 9.0 32 17.0 33 23.5 34 34.5 35 41.0 36 60.5 37 85.5 38 109.0 39 134.0 40 157.5 41 169.0 42 185.0 43 218.0 44 216.0 45 226.0 46 244.5 47 233.0 48 214.0 49 208.0 50 184.0 51 145.0 52 129.5 53 115.5 54 95.5 55 90.0 56 85.5 57 74.5 58 64.5 59 58.0 60 57.5 61 45.5 62 33.5 63 34.5 64 34.0 65 27.0 66 22.0 67 21.0 68 20.0 69 13.0 70 7.5 71 9.0 72 8.0 73 4.5 74 3.5 75 1.5 76 1.0 77 1.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.02 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06 105-109 0.0 110-114 0.365 115-119 0.145 120-124 0.095 125-129 0.4 130-134 0.135 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.7125 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.05 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.3875000000000002 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.0999999999999996 0.0 0.0 0.0 0.0 132-133 2.3875 0.0 0.0 0.0 0.0 134-135 2.575 0.0 0.0 0.0 0.0 136-137 2.8875 0.0 0.0 0.0 0.0 138-139 3.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958377 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958377_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.019 33.0 33.0 34.0 32.0 34.0 2 33.1805 34.0 33.0 34.0 33.0 34.0 3 33.20425 34.0 33.0 34.0 33.0 34.0 4 33.23725 34.0 33.0 34.0 33.0 34.0 5 32.871 34.0 33.0 34.0 32.0 34.0 6 37.30725 38.0 38.0 38.0 37.0 38.0 7 37.397 38.0 38.0 38.0 38.0 38.0 8 37.45625 38.0 38.0 38.0 38.0 38.0 9 37.31425 38.0 38.0 38.0 38.0 38.0 10-14 36.59955000000001 38.0 36.6 38.0 33.6 38.0 15-19 37.049 38.0 37.8 38.0 35.6 38.0 20-24 37.45185000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.456450000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.47625 38.0 38.0 38.0 38.0 38.0 35-39 37.46705000000001 38.0 38.0 38.0 38.0 38.0 40-44 36.6192 38.0 37.4 38.0 32.2 38.0 45-49 36.95635 38.0 38.0 38.0 35.2 38.0 50-54 37.33675 38.0 38.0 38.0 37.2 38.0 55-59 37.34525 38.0 38.0 38.0 37.6 38.0 60-64 37.33195 38.0 38.0 38.0 37.6 38.0 65-69 37.313900000000004 38.0 38.0 38.0 37.2 38.0 70-74 37.23905 38.0 38.0 38.0 37.0 38.0 75-79 36.725100000000005 38.0 38.0 38.0 34.4 38.0 80-84 36.15095 38.0 37.2 38.0 30.6 38.0 85-89 35.763 38.0 37.0 38.0 28.2 38.0 90-94 36.5969 38.0 37.8 38.0 34.2 38.0 95-99 36.98805 38.0 38.0 38.0 36.0 38.0 100-104 36.87625 38.0 38.0 38.0 35.6 38.0 105-109 36.8052 38.0 38.0 38.0 35.0 38.0 110-114 36.74580000000001 38.0 38.0 38.0 34.8 38.0 115-119 36.7386 38.0 38.0 38.0 35.0 38.0 120-124 36.653800000000004 38.0 38.0 38.0 35.0 38.0 125-129 36.49485 38.0 38.0 38.0 34.4 38.0 130-134 36.33935 38.0 38.0 38.0 34.0 38.0 135-139 33.241749999999996 37.0 29.4 38.0 24.4 38.0 140-144 34.825900000000004 38.0 35.2 38.0 28.4 38.0 145-149 34.146 38.0 34.2 38.0 25.4 38.0 150-151 29.967 35.5 28.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 1.0 18 1.0 19 4.0 20 3.0 21 1.0 22 3.0 23 3.0 24 8.0 25 5.0 26 14.0 27 22.0 28 21.0 29 23.0 30 30.0 31 37.0 32 64.0 33 78.0 34 138.0 35 272.0 36 806.0 37 2454.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.75 17.5 12.925 34.825 2 28.199999999999996 24.925 28.349999999999998 18.525 3 21.525 26.424999999999997 29.549999999999997 22.5 4 25.424999999999997 31.324999999999996 21.15 22.1 5 27.450000000000003 33.175 20.95 18.425 6 22.3 37.125 21.224999999999998 19.35 7 21.775 20.225 36.425000000000004 21.575 8 24.125 23.05 26.375 26.450000000000003 9 22.85 23.425 29.25 24.474999999999998 10-14 24.84 27.875 24.425 22.86 15-19 25.465 26.540000000000003 25.525 22.470000000000002 20-24 24.63 26.634999999999998 25.679999999999996 23.055 25-29 24.779999999999998 26.450000000000003 25.61 23.16 30-34 24.745 27.01 25.069999999999997 23.175 35-39 25.040000000000003 26.655 25.27 23.035 40-44 24.825 26.595000000000002 25.405 23.175 45-49 25.365 26.31 25.41 22.915 50-54 25.525 26.46 25.44 22.575 55-59 25.41 26.55 25.430000000000003 22.61 60-64 25.155 26.445 25.814999999999998 22.585 65-69 25.629999999999995 26.69 25.305 22.375 70-74 25.240000000000002 26.505000000000003 25.81 22.445 75-79 25.055 26.419999999999998 25.840000000000003 22.685 80-84 25.22 26.61 25.06 23.11 85-89 25.374999999999996 26.955000000000002 25.445 22.225 90-94 25.4 26.41 25.580000000000002 22.61 95-99 25.765 26.145000000000003 25.835 22.255 100-104 25.11 26.08 25.885 22.925 105-109 24.945 26.924999999999997 25.85 22.28 110-114 24.92 26.83 25.455 22.795 115-119 25.41 26.534999999999997 25.679999999999996 22.375 120-124 25.069999999999997 26.995 25.995 21.94 125-129 25.035 27.025 25.759999999999998 22.18 130-134 25.85 26.674999999999997 25.25 22.225 135-139 25.19 26.655 25.95 22.205 140-144 25.619999999999997 27.115000000000002 25.545 21.72 145-149 26.215 26.584999999999997 25.655 21.545 150-151 25.275 27.3 25.8 21.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 2.5 28 3.5 29 4.0 30 7.5 31 13.0 32 18.0 33 20.5 34 29.5 35 42.5 36 56.0 37 77.0 38 99.0 39 110.0 40 129.0 41 163.0 42 190.0 43 211.0 44 213.5 45 203.0 46 209.5 47 212.0 48 206.5 49 205.5 50 178.0 51 150.5 52 140.5 53 123.0 54 108.0 55 94.0 56 85.5 57 85.0 58 75.5 59 70.0 60 69.0 61 56.0 62 46.0 63 47.5 64 38.0 65 32.0 66 36.0 67 34.0 68 27.5 69 20.5 70 14.5 71 11.0 72 10.0 73 7.5 74 5.5 75 3.0 76 1.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5537377296753083 1.0999999999999999 3 0.025169896803423106 0.075 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 0.9874999999999999 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.425 0.0 0.0 0.0 0.0 126-127 1.6375 0.0 0.0 0.0 0.0 128-129 1.875 0.0 0.0 0.0 0.0 130-131 2.05 0.0 0.0 0.0 0.0 132-133 2.2750000000000004 0.0 0.0 0.0 0.0 134-135 2.4125 0.0 0.0 0.0 0.0 136-137 2.7125 0.0 0.0 0.0 0.0 138-139 2.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877344 spots for SRR6958377.sra Written 877344 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra Read 877331 spots for SRR6958377.sra Written 877331 spots for SRR6958377.sra SRR ids: ['SRR6958377.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ztwjdy5 SRR6958377.sra spots: 17546633 blocks: [[1, 877331], [877332, 1754662], [1754663, 2631993], [2631994, 3509324], [3509325, 4386655], [4386656, 5263986], [5263987, 6141317], [6141318, 7018648], [7018649, 7895979], [7895980, 8773310], [8773311, 9650641], [9650642, 10527972], [10527973, 11405303], [11405304, 12282634], [12282635, 13159965], [13159966, 14037296], [14037297, 14914627], [14914628, 15791958], [15791959, 16669289], [16669290, 17546633]] SRR6958377 file size 5924277 SRR6958377 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958377 SRR6958377_1.fastq SRR6958377_2.fastq Input file: SRR6958377_1.fastq Paired file: SRR6958377_2.fastq trimmed: SRR6958377-trimmed-pair1.fastq, SRR6958377-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:23:09 2024 >> started Fri Dec 6 21:23:29 2024 >> done (19.874s) 17546633 read pairs processed; of these: 11362 ( 0.06%) short read pairs filtered out after trimming by size control 10198 ( 0.06%) empty read pairs filtered out after trimming by size control 17525073 (99.88%) read pairs available; of these: 5913343 (33.74%) trimmed read pairs available after processing 11611730 (66.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 2 0.00% 21 0 0.00% 22 3 0.00% 23 2 0.00% 24 4 0.00% 25 3 0.00% 26 3 0.00% 27 3 0.00% 28 6 0.00% 29 7 0.00% 30 2 0.00% 31 5 0.00% 32 6 0.00% 33 5 0.00% 34 3 0.00% 35 5 0.00% 36 1 0.00% 37 4 0.00% 38 6 0.00% 39 3 0.00% 40 5 0.00% 41 8 0.00% 42 9 0.00% 43 6 0.00% 44 14 0.00% 45 13 0.00% 46 8 0.00% 47 15 0.00% 48 14 0.00% 49 18 0.00% 50 16 0.00% 51 20 0.00% 52 23 0.00% 53 24 0.00% 54 22 0.00% 55 28 0.00% 56 26 0.00% 57 37 0.00% 58 41 0.00% 59 59 0.00% 60 58 0.00% 61 65 0.00% 62 73 0.00% 63 76 0.00% 64 87 0.00% 65 86 0.00% 66 112 0.00% 67 115 0.00% 68 158 0.00% 69 166 0.00% 70 194 0.00% 71 227 0.00% 72 247 0.00% 73 314 0.00% 74 337 0.00% 75 393 0.00% 76 444 0.00% 77 492 0.00% 78 539 0.00% 79 601 0.00% 80 723 0.00% 81 758 0.00% 82 886 0.01% 83 1043 0.01% 84 1515 0.01% 85 1823 0.01% 86 1873 0.01% 87 2086 0.01% 88 2249 0.01% 89 2297 0.01% 90 2583 0.01% 91 2796 0.02% 92 3051 0.02% 93 3258 0.02% 94 3582 0.02% 95 3759 0.02% 96 4138 0.02% 97 4537 0.03% 98 4846 0.03% 99 5163 0.03% 100 5517 0.03% 101 5983 0.03% 102 6300 0.04% 103 6781 0.04% 104 7344 0.04% 105 7594 0.04% 106 8153 0.05% 107 8585 0.05% 108 9005 0.05% 109 9646 0.06% 110 10129 0.06% 111 10862 0.06% 112 11465 0.07% 113 11999 0.07% 114 12789 0.07% 115 13634 0.08% 116 14166 0.08% 117 14999 0.09% 118 15647 0.09% 119 16373 0.09% 120 17270 0.10% 121 18046 0.10% 122 18753 0.11% 123 19714 0.11% 124 20892 0.12% 125 21948 0.13% 126 23248 0.13% 127 24027 0.14% 128 25166 0.14% 129 26766 0.15% 130 28556 0.16% 131 28682 0.16% 132 30229 0.17% 133 32348 0.18% 134 34238 0.20% 135 36067 0.21% 136 38822 0.22% 137 41512 0.24% 138 42903 0.24% 139 46326 0.26% 140 49843 0.28% 141 54421 0.31% 142 60289 0.34% 143 67269 0.38% 144 77765 0.44% 145 93539 0.53% 146 115719 0.66% 147 159141 0.91% 148 247823 1.41% 149 526769 3.01% 150 3620049 20.66% 151 11611730 66.26% 17525073 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=21 prefix-density=0.75 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=40.23 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=18 prefix-density=0.52 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=44.17 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.3 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958377 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:24:33 Started mapping on | Dec 06 21:24:34 Finished on | Dec 06 21:26:35 Mapping speed, Million of reads per hour | 521.41 Number of input reads | 17525073 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16820370 Uniquely mapped reads % | 95.98% Average mapped length | 297.63 Number of splices: Total | 20138020 Number of splices: Annotated (sjdb) | 18986151 Number of splices: GT/AG | 19861374 Number of splices: GC/AG | 232415 Number of splices: AT/AC | 7466 Number of splices: Non-canonical | 36765 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281991 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 28987 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.06% % of reads unmapped: other | 1.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 427617 427617 427617 N_multimapping 281991 281991 281991 N_noFeature 689244 16314037 827306 N_ambiguous 429493 2036 61960 UnstrandedReadsAssigned:15701633 PositiveStrandReadsAssigned:504297 NegativeStrandReadsAssigned:15931104 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958377 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958377-trimmed-pair1.fastq SRR6958377-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,525,073 reads, 15,962,377 reads pseudoaligned [quant] estimated average fragment length: 248.823 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52973 SRR6958377.ke.tsv 35125 SRR6958377.se.tsv 88098 total ==> SRR6958377.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 688.573 0 0 PNS24247 1044 796.177 46.0599 5.48361 PNS24249 1928 1680.18 23.3988 1.32006 PNS24246 1044 796.177 46.0599 5.48361 PNS24248 1044 796.177 46.0599 5.48361 PNS24244 1471 1223.18 40.4215 3.1324 PNS24243 293 81.9134 0 0 KQK14069 1603 1355.18 5313.15 371.629 KQK14071 474 231.965 76.7433 31.3597 ==> SRR6958377.se.tsv <== BRADI_1g14170v3 5998 BRADI_1g53295v3 881 BRADI_1g59795v3 86 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 319 BRADI_1g74790v3 58 BRADI_1g09890v3 0 BRADI_1g77505v3 234 BRADI_1g48960v3 0 SRR6958377 completed mapping pipeline successfully