Starting /dee2/code/volunteer_pipeline.sh SRR6958378 current disk space = 1549041328128 free memory = 1600414356 SRR6958378 SRAfilesize c51cd99480476ab8ad60111917af41b8 SRR6958378.sra SRR6958378.sra file validated SRR6958378 is paired end SRR6958378 is conventional basespace SRR6958378 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958378_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.28825 32.0 18.0 33.0 18.0 33.0 2 30.14675 31.0 29.0 33.0 25.0 33.0 3 30.98325 33.0 29.0 33.0 27.0 34.0 4 32.2245 33.0 32.0 33.0 31.0 34.0 5 32.552 33.0 33.0 33.0 32.0 34.0 6 37.082 38.0 37.0 38.0 36.0 38.0 7 37.3165 38.0 38.0 38.0 36.0 38.0 8 37.40325 38.0 38.0 38.0 37.0 38.0 9 37.4155 38.0 38.0 38.0 37.0 38.0 10-14 36.226600000000005 38.0 36.0 38.0 31.6 38.0 15-19 37.495250000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.564800000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.53505 38.0 38.0 38.0 38.0 38.0 30-34 37.20715 38.0 38.0 38.0 37.0 38.0 35-39 37.384100000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.3235 38.0 38.0 38.0 36.8 38.0 45-49 36.848650000000006 38.0 37.8 38.0 34.8 38.0 50-54 37.369299999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.3142 38.0 38.0 38.0 36.8 38.0 60-64 37.3078 38.0 38.0 38.0 37.0 38.0 65-69 37.29725 38.0 38.0 38.0 37.0 38.0 70-74 37.31275 38.0 38.0 38.0 37.0 38.0 75-79 37.22175 38.0 38.0 38.0 36.8 38.0 80-84 37.228500000000004 38.0 38.0 38.0 36.4 38.0 85-89 36.1486 38.0 37.0 38.0 30.4 38.0 90-94 35.20655000000001 38.0 35.2 38.0 26.0 38.0 95-99 36.835899999999995 38.0 37.8 38.0 34.8 38.0 100-104 36.9354 38.0 38.0 38.0 35.0 38.0 105-109 36.82835 38.0 38.0 38.0 35.0 38.0 110-114 36.75704999999999 38.0 38.0 38.0 34.8 38.0 115-119 36.57505 38.0 38.0 38.0 34.2 38.0 120-124 36.405649999999994 38.0 38.0 38.0 34.0 38.0 125-129 36.26415000000001 38.0 38.0 38.0 33.6 38.0 130-134 36.1911 38.0 38.0 38.0 33.6 38.0 135-139 36.02230000000001 38.0 37.0 38.0 32.6 38.0 140-144 35.59085 38.0 36.0 38.0 31.6 38.0 145-149 33.825750000000006 38.0 33.6 38.0 24.8 38.0 150-151 30.86 35.5 29.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 2.0 22 4.0 23 6.0 24 6.0 25 5.0 26 12.0 27 15.0 28 22.0 29 36.0 30 32.0 31 38.0 32 47.0 33 99.0 34 167.0 35 275.0 36 820.0 37 2409.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.58902691511387 10.714285714285714 7.272256728778467 40.42443064182194 2 24.5 13.0 32.574999999999996 29.925 3 21.6 15.925 22.6 39.875 4 25.900000000000002 25.35 21.4 27.35 5 25.75 30.5 22.275 21.475 6 21.375 33.425 23.7 21.5 7 16.650000000000002 23.075000000000003 40.5 19.775000000000002 8 20.1 22.625 30.525000000000002 26.75 9 19.900000000000002 21.3 33.5 25.3 10-14 22.555 26.14 26.27 25.035 15-19 23.025000000000002 25.290000000000003 26.634999999999998 25.05 20-24 22.8 25.374999999999996 26.279999999999998 25.545 25-29 22.770000000000003 25.685000000000002 26.400000000000002 25.145 30-34 22.68 26.119999999999997 26.47 24.73 35-39 23.200000000000003 25.314999999999998 26.185000000000002 25.3 40-44 22.425 25.745 26.150000000000002 25.679999999999996 45-49 22.7 25.540000000000003 26.14 25.619999999999997 50-54 22.64 25.66 25.95 25.75 55-59 22.685 25.319999999999997 26.38 25.615 60-64 22.695 25.45 26.325 25.53 65-69 22.945 25.635 25.855 25.564999999999998 70-74 23.06 25.71 25.895000000000003 25.335 75-79 22.8 25.915 25.290000000000003 25.995 80-84 23.01 25.11 26.25 25.629999999999995 85-89 23.43 25.314999999999998 25.55 25.705 90-94 23.215 25.724999999999998 25.814999999999998 25.245 95-99 23.01 25.674999999999997 25.585 25.729999999999997 100-104 23.07 25.455 26.055 25.419999999999998 105-109 23.576178808940448 25.716285814290714 25.5962798139907 25.11125556277814 110-114 23.45 25.405 25.955000000000002 25.19 115-119 24.085 25.25 25.759999999999998 24.905 120-124 23.36 25.69 25.195 25.755 125-129 23.215 25.885 25.365 25.535000000000004 130-134 24.135 25.474999999999998 25.259999999999998 25.130000000000003 135-139 24.115000000000002 25.69 25.46 24.735 140-144 23.61 25.5 25.314999999999998 25.575 145-149 24.3 25.39 25.185000000000002 25.124999999999996 150-151 23.5 25.162499999999998 25.624999999999996 25.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 3.5 27 5.0 28 7.5 29 9.0 30 12.0 31 15.5 32 17.0 33 16.0 34 23.0 35 47.5 36 59.0 37 60.0 38 84.0 39 109.5 40 132.5 41 161.0 42 178.0 43 182.0 44 205.5 45 223.0 46 220.0 47 203.5 48 186.5 49 176.0 50 149.5 51 141.0 52 136.5 53 115.5 54 104.5 55 105.0 56 91.5 57 76.0 58 75.0 59 76.5 60 76.5 61 64.5 62 57.5 63 63.0 64 50.0 65 41.5 66 44.5 67 41.5 68 35.0 69 30.0 70 23.5 71 14.5 72 9.5 73 9.5 74 9.0 75 7.0 76 4.0 77 2.5 78 2.5 79 2.5 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.175 0.0 0.0 0.0 0.0 120-121 2.475 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.225 0.0 0.0 0.0 0.0 126-127 3.6624999999999996 0.0 0.0 0.0 0.0 128-129 4.050000000000001 0.0 0.0 0.0 0.0 130-131 4.325 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 5.0625 0.0 0.0 0.0 0.0 136-137 5.5875 0.0 0.0 0.0 0.0 138-139 6.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCCGC 10 0.0063298983 148.6923 1 CTACCAT 10 0.0063298983 148.6923 1 >>END_MODULE SRR6958378 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958378_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68775 33.0 33.0 34.0 32.0 34.0 2 33.022 34.0 33.0 34.0 32.0 34.0 3 33.11025 34.0 33.0 34.0 33.0 34.0 4 32.68425 34.0 33.0 34.0 32.0 34.0 5 32.997 34.0 33.0 34.0 32.0 34.0 6 37.26325 38.0 38.0 38.0 37.0 38.0 7 37.23525 38.0 38.0 38.0 37.0 38.0 8 37.19375 38.0 38.0 38.0 37.0 38.0 9 37.237 38.0 38.0 38.0 37.0 38.0 10-14 36.93445 38.0 38.0 38.0 35.8 38.0 15-19 37.14725 38.0 38.0 38.0 36.8 38.0 20-24 37.190599999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.1657 38.0 38.0 38.0 37.0 38.0 30-34 37.18665 38.0 38.0 38.0 37.0 38.0 35-39 36.796549999999996 38.0 38.0 38.0 35.4 38.0 40-44 36.4379 38.0 37.8 38.0 33.8 38.0 45-49 36.7722 38.0 38.0 38.0 36.0 38.0 50-54 36.736000000000004 38.0 38.0 38.0 35.4 38.0 55-59 36.608250000000005 38.0 38.0 38.0 34.0 38.0 60-64 36.644 38.0 38.0 38.0 34.6 38.0 65-69 36.569050000000004 38.0 38.0 38.0 34.4 38.0 70-74 36.40355 38.0 37.8 38.0 33.6 38.0 75-79 36.86895 38.0 38.0 38.0 35.8 38.0 80-84 36.79285 38.0 38.0 38.0 35.8 38.0 85-89 36.69575 38.0 38.0 38.0 35.2 38.0 90-94 34.6297 38.0 34.6 38.0 26.2 38.0 95-99 36.22565 38.0 37.8 38.0 33.0 38.0 100-104 36.44799999999999 38.0 38.0 38.0 34.0 38.0 105-109 35.73205 38.0 36.8 38.0 30.6 38.0 110-114 36.23955000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.1279 38.0 38.0 38.0 33.6 38.0 120-124 35.860699999999994 38.0 37.6 38.0 33.0 38.0 125-129 35.58235 38.0 36.8 38.0 31.2 38.0 130-134 35.42 38.0 36.2 38.0 31.0 38.0 135-139 35.2138 38.0 36.0 38.0 31.0 38.0 140-144 34.7645 38.0 36.0 38.0 29.0 38.0 145-149 32.75085 37.6 33.0 38.0 18.6 38.0 150-151 27.454875 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 2.0 4 1.0 5 1.0 6 1.0 7 3.0 8 1.0 9 0.0 10 2.0 11 0.0 12 2.0 13 2.0 14 0.0 15 1.0 16 2.0 17 1.0 18 2.0 19 4.0 20 3.0 21 6.0 22 9.0 23 12.0 24 20.0 25 15.0 26 14.0 27 21.0 28 30.0 29 38.0 30 29.0 31 53.0 32 92.0 33 130.0 34 166.0 35 299.0 36 674.0 37 2354.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.675 17.974999999999998 10.85 32.5 2 29.549999999999997 24.224999999999998 28.125 18.099999999999998 3 22.900000000000002 25.424999999999997 27.775 23.9 4 25.45 32.425 20.599999999999998 21.525 5 26.950000000000003 33.4 19.8 19.85 6 21.75 36.475 20.825 20.95 7 21.875 19.425 35.675000000000004 23.025000000000002 8 23.0 22.075 25.474999999999998 29.45 9 23.375 23.075000000000003 28.299999999999997 25.25 10-14 25.679999999999996 26.3 23.24 24.779999999999998 15-19 25.729999999999997 25.074999999999996 24.709999999999997 24.485 20-24 25.31 26.135 24.48 24.075 25-29 25.5 25.31 24.84 24.349999999999998 30-34 24.959999999999997 26.015 24.81 24.215 35-39 25.55 25.259999999999998 24.935 24.255 40-44 25.88 25.645 24.195 24.279999999999998 45-49 25.645 25.085 25.385 23.885 50-54 25.55 25.89 24.73 23.830000000000002 55-59 25.88 25.374999999999996 24.79 23.955000000000002 60-64 26.029999999999998 25.525 24.635 23.810000000000002 65-69 25.290000000000003 25.465 25.1 24.145 70-74 25.650000000000002 25.740000000000002 24.825 23.785 75-79 25.624999999999996 24.92 25.290000000000003 24.165 80-84 25.679999999999996 25.15 25.380000000000003 23.79 85-89 25.765 25.665 24.555 24.015 90-94 25.665 25.11 25.44 23.785 95-99 25.509999999999998 25.88 24.865000000000002 23.745 100-104 26.064999999999998 25.31 24.740000000000002 23.885 105-109 25.374999999999996 26.075 24.525 24.025 110-114 25.535000000000004 26.005 24.65 23.810000000000002 115-119 26.179999999999996 26.115 24.565 23.14 120-124 26.31 25.935000000000002 24.759999999999998 22.994999999999997 125-129 25.885 25.985000000000003 25.045 23.085 130-134 26.455000000000002 26.095000000000002 24.779999999999998 22.67 135-139 26.69 25.795 25.06 22.455 140-144 27.045 26.009999999999998 24.45 22.495 145-149 26.634999999999998 26.695 24.615000000000002 22.055 150-151 26.8125 25.95 24.725 22.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.5 24 1.0 25 0.5 26 1.0 27 4.0 28 4.5 29 5.5 30 10.0 31 14.0 32 17.5 33 20.0 34 35.5 35 43.0 36 49.5 37 64.0 38 72.5 39 95.0 40 122.5 41 151.0 42 170.0 43 163.0 44 176.0 45 190.5 46 187.0 47 183.5 48 173.5 49 179.5 50 171.0 51 137.0 52 124.5 53 121.0 54 102.0 55 91.0 56 92.0 57 98.0 58 94.0 59 82.0 60 83.0 61 79.5 62 73.5 63 69.5 64 58.5 65 57.5 66 51.5 67 42.0 68 49.0 69 41.5 70 29.0 71 29.5 72 27.5 73 19.5 74 10.5 75 10.0 76 9.5 77 4.5 78 1.0 79 0.0 80 0.5 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98605830164765 97.625 2 0.7858048162230671 1.55 3 0.17743979721166034 0.525 4 0.025348542458808618 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025348542458808618 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.9874999999999999 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.15 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.775 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.6125 0.0 0.0 0.0 0.0 128-129 4.0 0.0 0.0 0.0 0.0 130-131 4.275 0.0 0.0 0.0 0.0 132-133 4.6 0.0 0.0 0.0 0.0 134-135 5.012499999999999 0.0 0.0 0.0 0.0 136-137 5.575 0.0 0.0 0.0 0.0 138-139 6.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACAC 10 0.006830828 145.0 6 GCACACA 10 0.006830828 145.0 5 >>END_MODULE Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083537 spots for SRR6958378.sra Written 1083537 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra Read 1083530 spots for SRR6958378.sra Written 1083530 spots for SRR6958378.sra SRR ids: ['SRR6958378.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zsrldwnc SRR6958378.sra spots: 21670607 blocks: [[1, 1083530], [1083531, 2167060], [2167061, 3250590], [3250591, 4334120], [4334121, 5417650], [5417651, 6501180], [6501181, 7584710], [7584711, 8668240], [8668241, 9751770], [9751771, 10835300], [10835301, 11918830], [11918831, 13002360], [13002361, 14085890], [14085891, 15169420], [15169421, 16252950], [16252951, 17336480], [17336481, 18420010], [18420011, 19503540], [19503541, 20587070], [20587071, 21670607]] SRR6958378 file size 7321757 SRR6958378 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958378 SRR6958378_1.fastq SRR6958378_2.fastq Input file: SRR6958378_1.fastq Paired file: SRR6958378_2.fastq trimmed: SRR6958378-trimmed-pair1.fastq, SRR6958378-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:25:38 2024 >> started Fri Dec 6 21:26:00 2024 >> done (21.548s) 21670607 read pairs processed; of these: 19101 ( 0.09%) short read pairs filtered out after trimming by size control 16331 ( 0.08%) empty read pairs filtered out after trimming by size control 21635175 (99.84%) read pairs available; of these: 7964618 (36.81%) trimmed read pairs available after processing 13670557 (63.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 7 0.00% 20 9 0.00% 21 10 0.00% 22 17 0.00% 23 9 0.00% 24 14 0.00% 25 10 0.00% 26 9 0.00% 27 10 0.00% 28 10 0.00% 29 9 0.00% 30 7 0.00% 31 18 0.00% 32 17 0.00% 33 12 0.00% 34 20 0.00% 35 23 0.00% 36 16 0.00% 37 30 0.00% 38 27 0.00% 39 22 0.00% 40 24 0.00% 41 25 0.00% 42 27 0.00% 43 26 0.00% 44 34 0.00% 45 48 0.00% 46 39 0.00% 47 50 0.00% 48 43 0.00% 49 50 0.00% 50 73 0.00% 51 75 0.00% 52 73 0.00% 53 113 0.00% 54 96 0.00% 55 119 0.00% 56 119 0.00% 57 138 0.00% 58 150 0.00% 59 184 0.00% 60 217 0.00% 61 225 0.00% 62 251 0.00% 63 276 0.00% 64 311 0.00% 65 346 0.00% 66 369 0.00% 67 429 0.00% 68 478 0.00% 69 498 0.00% 70 633 0.00% 71 723 0.00% 72 748 0.00% 73 917 0.00% 74 1085 0.01% 75 1065 0.00% 76 1335 0.01% 77 1480 0.01% 78 1574 0.01% 79 1843 0.01% 80 1955 0.01% 81 2303 0.01% 82 2537 0.01% 83 2966 0.01% 84 4095 0.02% 85 4893 0.02% 86 5075 0.02% 87 5327 0.02% 88 5851 0.03% 89 6230 0.03% 90 6699 0.03% 91 7306 0.03% 92 7878 0.04% 93 8348 0.04% 94 9103 0.04% 95 9682 0.04% 96 10678 0.05% 97 11198 0.05% 98 11950 0.06% 99 12489 0.06% 100 13617 0.06% 101 14221 0.07% 102 15074 0.07% 103 16439 0.08% 104 17409 0.08% 105 18439 0.09% 106 19649 0.09% 107 20197 0.09% 108 21360 0.10% 109 22686 0.10% 110 23495 0.11% 111 24980 0.12% 112 26340 0.12% 113 27283 0.13% 114 29010 0.13% 115 30427 0.14% 116 32368 0.15% 117 33082 0.15% 118 34506 0.16% 119 34928 0.16% 120 36889 0.17% 121 37951 0.18% 122 39281 0.18% 123 41102 0.19% 124 43127 0.20% 125 45134 0.21% 126 46207 0.21% 127 48413 0.22% 128 49353 0.23% 129 50932 0.24% 130 53316 0.25% 131 55098 0.25% 132 57756 0.27% 133 59796 0.28% 134 61965 0.29% 135 64752 0.30% 136 67864 0.31% 137 70571 0.33% 138 73650 0.34% 139 78061 0.36% 140 82113 0.38% 141 88491 0.41% 142 96777 0.45% 143 105806 0.49% 144 119054 0.55% 145 138196 0.64% 146 167173 0.77% 147 216822 1.00% 148 318499 1.47% 149 618750 2.86% 150 4303022 19.89% 151 13670557 63.19% 21635175 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=23 prefix-density=0.47 prefix-fanout=3.3 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=38.52 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=29 prefix-density=0.40 prefix-fanout=2.7 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=73.78 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=11.7 sequence=CCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR6958378 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:26:47 Started mapping on | Dec 06 21:26:47 Finished on | Dec 06 21:28:49 Mapping speed, Million of reads per hour | 638.42 Number of input reads | 21635175 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21123737 Uniquely mapped reads % | 97.64% Average mapped length | 295.73 Number of splices: Total | 23581593 Number of splices: Annotated (sjdb) | 22027587 Number of splices: GT/AG | 23254393 Number of splices: GC/AG | 279912 Number of splices: AT/AC | 10729 Number of splices: Non-canonical | 36559 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.51 Insertion rate per base | 0.01% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 208105 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 11934 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.05% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 316496 316496 316496 N_multimapping 208105 208105 208105 N_noFeature 951349 20505702 1152069 N_ambiguous 506260 3220 89250 UnstrandedReadsAssigned:19666128 PositiveStrandReadsAssigned:614815 NegativeStrandReadsAssigned:19882418 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958378 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958378-trimmed-pair1.fastq SRR6958378-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,635,175 reads, 19,906,329 reads pseudoaligned [quant] estimated average fragment length: 265.104 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR6958378.ke.tsv 35125 SRR6958378.se.tsv 88098 total ==> SRR6958378.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.502 0 0 PNS24247 1044 779.896 73.2688 7.11469 PNS24249 1928 1663.9 77.3283 3.51954 PNS24246 1044 779.896 73.2688 7.11469 PNS24248 1044 779.896 73.2688 7.11469 PNS24244 1471 1206.9 38.8654 2.43875 PNS24243 293 90.5476 0 0 KQK14069 1603 1338.9 4608.13 260.646 KQK14071 474 230.414 102.794 33.7855 ==> SRR6958378.se.tsv <== BRADI_1g14170v3 5467 BRADI_1g53295v3 368 BRADI_1g59795v3 797 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 251 BRADI_1g74790v3 93 BRADI_1g09890v3 1 BRADI_1g77505v3 359 BRADI_1g48960v3 0 SRR6958378 completed mapping pipeline successfully