Starting /dee2/code/volunteer_pipeline.sh SRR6958379 current disk space = 1548985135104 free memory = 1596585324 SRR6958379 SRAfilesize 33ed0c8f2958c42a4640c1b3e9093edf SRR6958379.sra SRR6958379.sra file validated SRR6958379 is paired end SRR6958379 is conventional basespace SRR6958379 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958379_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.268 25.0 18.0 32.0 18.0 33.0 2 30.118 31.0 29.0 33.0 27.0 33.0 3 31.081 33.0 31.0 33.0 27.0 33.0 4 31.838 33.0 31.0 33.0 29.0 34.0 5 32.3715 33.0 33.0 33.0 32.0 34.0 6 36.302 38.0 36.0 38.0 33.0 38.0 7 36.9705 38.0 38.0 38.0 35.0 38.0 8 37.064 38.0 38.0 38.0 35.0 38.0 9 37.2085 38.0 38.0 38.0 36.0 38.0 10-14 37.382099999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.39835 38.0 38.0 38.0 37.0 38.0 20-24 37.50005 38.0 38.0 38.0 37.2 38.0 25-29 37.401650000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.33095 38.0 38.0 38.0 37.0 38.0 35-39 37.273 38.0 38.0 38.0 36.8 38.0 40-44 37.1896 38.0 38.0 38.0 36.6 38.0 45-49 37.2016 38.0 38.0 38.0 36.2 38.0 50-54 37.1923 38.0 38.0 38.0 36.2 38.0 55-59 37.0544 38.0 38.0 38.0 35.8 38.0 60-64 36.95125 38.0 38.0 38.0 35.4 38.0 65-69 37.04305 38.0 38.0 38.0 36.0 38.0 70-74 37.0984 38.0 38.0 38.0 36.0 38.0 75-79 36.90605 38.0 38.0 38.0 35.2 38.0 80-84 36.643899999999995 38.0 38.0 38.0 34.2 38.0 85-89 36.557500000000005 38.0 38.0 38.0 34.2 38.0 90-94 36.586 38.0 38.0 38.0 34.0 38.0 95-99 36.5167 38.0 38.0 38.0 34.0 38.0 100-104 36.3146 38.0 37.2 38.0 33.4 38.0 105-109 36.21745 38.0 37.0 38.0 33.2 38.0 110-114 35.945800000000006 38.0 37.0 38.0 32.4 38.0 115-119 35.877300000000005 38.0 36.6 38.0 32.2 38.0 120-124 35.64405 38.0 36.0 38.0 31.0 38.0 125-129 35.4331 38.0 36.0 38.0 30.6 38.0 130-134 35.19519999999999 38.0 35.4 38.0 29.0 38.0 135-139 34.76649999999999 38.0 35.0 38.0 27.6 38.0 140-144 34.49005 38.0 35.0 38.0 26.6 38.0 145-149 33.53065 38.0 34.0 38.0 21.2 38.0 150-151 29.1775 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 2.0 20 3.0 21 3.0 22 1.0 23 6.0 24 7.0 25 9.0 26 7.0 27 25.0 28 21.0 29 39.0 30 53.0 31 56.0 32 78.0 33 134.0 34 211.0 35 403.0 36 968.0 37 1971.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.23480947476828 14.340885684860968 6.719876416065912 46.70442842430484 2 18.386773547094187 13.001002004008017 37.62525050100201 30.98697394789579 3 21.25 15.075 24.75 38.925 4 25.85 23.075000000000003 23.825 27.250000000000004 5 24.055068836045056 30.48811013767209 23.103879849812266 22.35294117647059 6 22.625 33.625 23.549999999999997 20.200000000000003 7 17.375 25.1 39.475 18.05 8 20.775 22.900000000000002 30.55 25.775 9 20.05 21.6 33.324999999999996 25.025 10-14 22.3 26.950000000000003 25.785000000000004 24.965 15-19 22.005 25.919999999999998 26.605 25.47 20-24 22.665 25.915 26.56 24.86 25-29 22.205 26.215 26.155 25.424999999999997 30-34 22.395 25.775 26.045 25.785000000000004 35-39 22.025 25.56 26.724999999999998 25.69 40-44 22.185 26.32 25.905 25.590000000000003 45-49 22.145 26.284999999999997 25.95 25.619999999999997 50-54 22.869999999999997 25.345000000000002 26.35 25.435000000000002 55-59 22.3 26.555 26.279999999999998 24.865000000000002 60-64 22.59 26.125 26.174999999999997 25.11 65-69 22.48 25.564999999999998 26.674999999999997 25.28 70-74 22.925 25.790000000000003 25.919999999999998 25.365 75-79 22.869999999999997 25.619999999999997 25.71 25.8 80-84 22.875 25.52 25.900000000000002 25.705 85-89 23.055 25.380000000000003 26.735 24.83 90-94 22.685 26.26 26.1 24.955 95-99 22.97 26.02 26.115 24.895 100-104 22.865 25.905 25.61 25.619999999999997 105-109 22.255 26.174999999999997 25.974999999999998 25.595000000000002 110-114 23.485 25.740000000000002 25.615 25.16 115-119 22.685 25.814999999999998 26.200000000000003 25.3 120-124 22.645 25.355 25.71 26.290000000000003 125-129 23.1 25.635 26.090000000000003 25.174999999999997 130-134 22.994999999999997 26.255 25.485000000000003 25.264999999999997 135-139 22.535 25.895000000000003 26.02 25.55 140-144 23.11 25.745 25.929999999999996 25.215 145-149 23.235 25.345000000000002 26.045 25.374999999999996 150-151 23.151044925541235 24.92804404955575 25.728945063196097 26.19196596170692 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 1.0 26 0.5 27 2.0 28 4.0 29 3.0 30 4.5 31 10.5 32 16.5 33 22.5 34 28.5 35 45.5 36 59.5 37 75.0 38 99.0 39 113.0 40 138.5 41 169.0 42 191.0 43 201.5 44 217.0 45 218.5 46 211.0 47 214.5 48 206.0 49 189.5 50 171.5 51 152.5 52 119.0 53 111.0 54 108.5 55 83.5 56 79.5 57 77.0 58 70.5 59 70.5 60 65.5 61 55.0 62 54.0 63 51.0 64 44.5 65 46.0 66 38.0 67 26.5 68 23.0 69 25.0 70 23.0 71 17.0 72 13.0 73 8.0 74 6.0 75 6.0 76 4.0 77 3.0 78 1.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.2 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 0.9874999999999999 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.225 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.5 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.9749999999999999 0.0 0.0 0.0 0.0 138-139 2.1624999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958379 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958379_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.943 33.0 33.0 34.0 32.0 34.0 2 32.897 33.0 33.0 34.0 32.0 34.0 3 33.015 34.0 33.0 34.0 32.0 34.0 4 33.02325 34.0 33.0 34.0 32.0 34.0 5 33.06 34.0 33.0 34.0 32.0 34.0 6 37.05775 38.0 38.0 38.0 36.0 38.0 7 37.0545 38.0 38.0 38.0 36.0 38.0 8 37.09125 38.0 38.0 38.0 37.0 38.0 9 37.117 38.0 38.0 38.0 37.0 38.0 10-14 37.02855 38.0 38.0 38.0 35.8 38.0 15-19 36.8754 38.0 38.0 38.0 35.6 38.0 20-24 37.00935 38.0 38.0 38.0 36.2 38.0 25-29 37.09009999999999 38.0 38.0 38.0 36.4 38.0 30-34 37.0491 38.0 38.0 38.0 36.0 38.0 35-39 37.0269 38.0 38.0 38.0 36.0 38.0 40-44 37.02285 38.0 38.0 38.0 36.0 38.0 45-49 36.9377 38.0 38.0 38.0 36.0 38.0 50-54 36.824400000000004 38.0 38.0 38.0 35.2 38.0 55-59 36.94445 38.0 38.0 38.0 36.0 38.0 60-64 36.84995 38.0 38.0 38.0 35.0 38.0 65-69 36.6606 38.0 38.0 38.0 34.6 38.0 70-74 36.58145 38.0 38.0 38.0 34.0 38.0 75-79 36.35745 38.0 38.0 38.0 33.8 38.0 80-84 36.34075 38.0 38.0 38.0 34.0 38.0 85-89 36.1809 38.0 37.8 38.0 33.4 38.0 90-94 36.211149999999996 38.0 38.0 38.0 33.4 38.0 95-99 36.1322 38.0 37.6 38.0 33.2 38.0 100-104 35.93125 38.0 37.0 38.0 33.0 38.0 105-109 35.75075 38.0 36.8 38.0 31.2 38.0 110-114 35.44125 38.0 36.0 38.0 30.6 38.0 115-119 35.36845 38.0 36.0 38.0 29.8 38.0 120-124 35.16345 38.0 36.0 38.0 29.0 38.0 125-129 34.99635 38.0 35.4 38.0 28.2 38.0 130-134 34.5368 38.0 35.0 38.0 26.2 38.0 135-139 34.171099999999996 38.0 34.4 38.0 24.0 38.0 140-144 33.84435 38.0 33.8 38.0 23.2 38.0 145-149 33.05604999999999 38.0 33.4 38.0 19.8 38.0 150-151 28.002125 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 0.0 5 1.0 6 0.0 7 1.0 8 2.0 9 2.0 10 1.0 11 1.0 12 0.0 13 2.0 14 2.0 15 1.0 16 3.0 17 0.0 18 4.0 19 6.0 20 8.0 21 6.0 22 11.0 23 12.0 24 11.0 25 17.0 26 19.0 27 25.0 28 35.0 29 50.0 30 46.0 31 59.0 32 94.0 33 135.0 34 207.0 35 331.0 36 791.0 37 2112.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.16658329164582 17.75887943971986 12.331165582791396 36.743371685842924 2 27.975 24.474999999999998 28.075 19.475 3 23.425 24.625 28.449999999999996 23.5 4 25.324999999999996 30.325000000000003 22.55 21.8 5 26.85 32.025 21.2 19.925 6 22.6 36.1 20.45 20.849999999999998 7 22.225 19.375 35.25 23.150000000000002 8 22.525000000000002 23.525 26.200000000000003 27.750000000000004 9 24.65 23.625 28.849999999999998 22.875 10-14 25.11 26.76 23.799999999999997 24.33 15-19 24.93 25.900000000000002 25.53 23.64 20-24 25.21 26.43 25.06 23.3 25-29 25.505 26.115 24.445 23.935000000000002 30-34 25.385 26.27 24.97 23.375 35-39 25.085 26.169999999999998 24.85 23.895 40-44 25.259999999999998 26.290000000000003 24.915000000000003 23.535 45-49 25.509999999999998 25.735000000000003 25.419999999999998 23.335 50-54 25.324999999999996 25.985000000000003 25.180000000000003 23.51 55-59 26.52 25.485000000000003 25.025 22.97 60-64 25.55 25.94 24.995 23.515 65-69 25.585 25.985000000000003 25.335 23.095 70-74 25.979999999999997 25.935000000000002 25.245 22.84 75-79 26.27 25.77 25.205 22.755 80-84 26.06 26.245 24.575 23.119999999999997 85-89 26.055 25.569999999999997 25.685000000000002 22.689999999999998 90-94 25.485000000000003 25.585 25.840000000000003 23.09 95-99 26.174999999999997 26.435 24.395 22.994999999999997 100-104 25.724999999999998 25.605 25.205 23.465 105-109 25.455 25.66 25.445 23.44 110-114 25.7 26.19 25.569999999999997 22.54 115-119 24.975 26.884999999999998 25.205 22.935 120-124 25.39 26.55 25.14 22.919999999999998 125-129 25.064999999999998 26.47 24.88 23.585 130-134 26.200000000000003 25.95 25.05 22.8 135-139 26.169999999999998 26.015 25.105 22.71 140-144 25.755 26.595000000000002 25.525 22.125 145-149 25.929999999999996 26.075 25.275 22.720000000000002 150-151 25.8008008008008 26.664164164164166 24.637137137137138 22.8978978978979 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 1.5 26 3.0 27 3.5 28 4.0 29 4.5 30 7.5 31 10.5 32 12.5 33 17.0 34 19.0 35 31.5 36 49.5 37 63.5 38 88.0 39 114.0 40 136.0 41 151.5 42 165.5 43 192.0 44 215.5 45 218.5 46 219.5 47 201.0 48 178.5 49 171.0 50 158.0 51 136.0 52 115.0 53 120.0 54 115.5 55 94.0 56 82.0 57 84.5 58 89.0 59 83.0 60 84.5 61 78.5 62 70.5 63 67.0 64 54.5 65 47.0 66 40.5 67 42.5 68 38.5 69 31.0 70 24.5 71 16.0 72 14.0 73 11.0 74 8.0 75 4.5 76 3.0 77 2.5 78 1.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.7056451612903225 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 0.9874999999999999 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.225 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.5 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.9749999999999999 0.0 0.0 0.0 0.0 138-139 2.1624999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGATG 10 0.006830828 145.0 145 >>END_MODULE Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867936 spots for SRR6958379.sra Written 867936 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra Read 867919 spots for SRR6958379.sra Written 867919 spots for SRR6958379.sra SRR ids: ['SRR6958379.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_almi2dj8 SRR6958379.sra spots: 17358397 blocks: [[1, 867919], [867920, 1735838], [1735839, 2603757], [2603758, 3471676], [3471677, 4339595], [4339596, 5207514], [5207515, 6075433], [6075434, 6943352], [6943353, 7811271], [7811272, 8679190], [8679191, 9547109], [9547110, 10415028], [10415029, 11282947], [11282948, 12150866], [12150867, 13018785], [13018786, 13886704], [13886705, 14754623], [14754624, 15622542], [15622543, 16490461], [16490462, 17358397]] SRR6958379 file size 5860490 SRR6958379 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958379 SRR6958379_1.fastq SRR6958379_2.fastq Input file: SRR6958379_1.fastq Paired file: SRR6958379_2.fastq trimmed: SRR6958379-trimmed-pair1.fastq, SRR6958379-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:26:33 2024 >> started Fri Dec 6 21:26:51 2024 >> done (18.414s) 17358397 read pairs processed; of these: 10536 ( 0.06%) short read pairs filtered out after trimming by size control 8090 ( 0.05%) empty read pairs filtered out after trimming by size control 17339771 (99.89%) read pairs available; of these: 6096552 (35.16%) trimmed read pairs available after processing 11243219 (64.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 3 0.00% 21 2 0.00% 22 2 0.00% 23 1 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 4 0.00% 28 6 0.00% 29 6 0.00% 30 4 0.00% 31 3 0.00% 32 11 0.00% 33 8 0.00% 34 7 0.00% 35 12 0.00% 36 8 0.00% 37 8 0.00% 38 14 0.00% 39 8 0.00% 40 12 0.00% 41 9 0.00% 42 12 0.00% 43 7 0.00% 44 6 0.00% 45 17 0.00% 46 18 0.00% 47 17 0.00% 48 17 0.00% 49 25 0.00% 50 31 0.00% 51 30 0.00% 52 27 0.00% 53 43 0.00% 54 35 0.00% 55 45 0.00% 56 45 0.00% 57 51 0.00% 58 60 0.00% 59 57 0.00% 60 68 0.00% 61 89 0.00% 62 91 0.00% 63 97 0.00% 64 105 0.00% 65 112 0.00% 66 132 0.00% 67 154 0.00% 68 175 0.00% 69 162 0.00% 70 212 0.00% 71 229 0.00% 72 257 0.00% 73 276 0.00% 74 363 0.00% 75 358 0.00% 76 427 0.00% 77 452 0.00% 78 483 0.00% 79 534 0.00% 80 612 0.00% 81 653 0.00% 82 806 0.00% 83 916 0.01% 84 1437 0.01% 85 1795 0.01% 86 1912 0.01% 87 1964 0.01% 88 2048 0.01% 89 2144 0.01% 90 2346 0.01% 91 2410 0.01% 92 2594 0.01% 93 2846 0.02% 94 2995 0.02% 95 3228 0.02% 96 3506 0.02% 97 3779 0.02% 98 3891 0.02% 99 4192 0.02% 100 4501 0.03% 101 4922 0.03% 102 5129 0.03% 103 5488 0.03% 104 5847 0.03% 105 6227 0.04% 106 6745 0.04% 107 7154 0.04% 108 7441 0.04% 109 7988 0.05% 110 8541 0.05% 111 8916 0.05% 112 9496 0.05% 113 9981 0.06% 114 10503 0.06% 115 11278 0.07% 116 12139 0.07% 117 12702 0.07% 118 13572 0.08% 119 14118 0.08% 120 15003 0.09% 121 15585 0.09% 122 16348 0.09% 123 17230 0.10% 124 18183 0.10% 125 19169 0.11% 126 20104 0.12% 127 21521 0.12% 128 22402 0.13% 129 23741 0.14% 130 25112 0.14% 131 26882 0.16% 132 28752 0.17% 133 30897 0.18% 134 32507 0.19% 135 35046 0.20% 136 37525 0.22% 137 39940 0.23% 138 42902 0.25% 139 46837 0.27% 140 51085 0.29% 141 56656 0.33% 142 63957 0.37% 143 73038 0.42% 144 86255 0.50% 145 105165 0.61% 146 138664 0.80% 147 187715 1.08% 148 297778 1.72% 149 626590 3.61% 150 3649734 21.05% 151 11243219 64.84% 17339771 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=27 prefix-density=0.91 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=54.85 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.64 fanout-score-rank=18 prefix-density=0.68 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=514.63 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=18.9 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958379 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:27:34 Started mapping on | Dec 06 21:27:34 Finished on | Dec 06 21:29:04 Mapping speed, Million of reads per hour | 693.59 Number of input reads | 17339771 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17103718 Uniquely mapped reads % | 98.64% Average mapped length | 298.26 Number of splices: Total | 19996772 Number of splices: Annotated (sjdb) | 18856608 Number of splices: GT/AG | 19740095 Number of splices: GC/AG | 234057 Number of splices: AT/AC | 7401 Number of splices: Non-canonical | 15219 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 103065 % of reads mapped to multiple loci | 0.59% Number of reads mapped to too many loci | 11132 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.30% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 139277 139277 139277 N_multimapping 103065 103065 103065 N_noFeature 667010 16596339 812747 N_ambiguous 428682 2329 68126 UnstrandedReadsAssigned:16008026 PositiveStrandReadsAssigned:505050 NegativeStrandReadsAssigned:16222845 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958379 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958379-trimmed-pair1.fastq SRR6958379-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,339,771 reads, 16,231,968 reads pseudoaligned [quant] estimated average fragment length: 279.425 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR6958379.ke.tsv 35125 SRR6958379.se.tsv 88098 total ==> SRR6958379.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 658.058 0 0 PNS24247 1044 765.575 53.4954 6.52929 PNS24249 1928 1649.58 13.1108 0.742667 PNS24246 1044 765.575 53.4954 6.52929 PNS24248 1044 765.575 53.4954 6.52929 PNS24244 1471 1192.58 39.4029 3.08731 PNS24243 293 75.1704 0 0 KQK14069 1603 1324.58 4486.8 316.517 KQK14071 474 211.754 70.5684 31.1399 ==> SRR6958379.se.tsv <== BRADI_1g14170v3 5143 BRADI_1g53295v3 321 BRADI_1g59795v3 199 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 332 BRADI_1g74790v3 77 BRADI_1g09890v3 1 BRADI_1g77505v3 140 BRADI_1g48960v3 0 SRR6958379 completed mapping pipeline successfully