Starting /dee2/code/volunteer_pipeline.sh SRR6958380 current disk space = 1548958892032 free memory = 1600242448 SRR6958380 SRAfilesize 206cbbb8ca0757e7297f6f46f0422cc7 SRR6958380.sra SRR6958380.sra file validated SRR6958380 is paired end SRR6958380 is conventional basespace SRR6958380 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958380_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.11 18.0 18.0 30.0 2.0 32.0 2 26.78475 28.0 25.0 31.0 18.0 33.0 3 30.00675 31.0 28.0 33.0 27.0 33.0 4 32.12 33.0 32.0 33.0 32.0 33.0 5 32.00775 33.0 33.0 33.0 31.0 34.0 6 36.47225 38.0 37.0 38.0 34.0 38.0 7 37.11925 38.0 38.0 38.0 36.0 38.0 8 37.24825 38.0 38.0 38.0 36.0 38.0 9 37.56025 38.0 38.0 38.0 37.0 38.0 10-14 37.51625 38.0 38.0 38.0 37.8 38.0 15-19 37.55835 38.0 38.0 38.0 37.8 38.0 20-24 37.43195 38.0 38.0 38.0 37.4 38.0 25-29 37.140600000000006 38.0 38.0 38.0 36.4 38.0 30-34 37.18945 38.0 38.0 38.0 36.6 38.0 35-39 37.5621 38.0 38.0 38.0 38.0 38.0 40-44 37.5303 38.0 38.0 38.0 38.0 38.0 45-49 37.4349 38.0 38.0 38.0 37.2 38.0 50-54 37.3639 38.0 38.0 38.0 37.0 38.0 55-59 37.3382 38.0 38.0 38.0 37.0 38.0 60-64 37.3662 38.0 38.0 38.0 37.0 38.0 65-69 37.39205 38.0 38.0 38.0 37.0 38.0 70-74 37.3756 38.0 38.0 38.0 37.0 38.0 75-79 36.188100000000006 38.0 36.4 38.0 30.8 38.0 80-84 37.0488 38.0 38.0 38.0 35.8 38.0 85-89 36.786500000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.5703 38.0 38.0 38.0 34.2 38.0 95-99 36.15365 38.0 37.8 38.0 33.0 38.0 100-104 36.18825 38.0 37.8 38.0 33.6 38.0 105-109 36.0366 38.0 37.4 38.0 32.4 38.0 110-114 36.05455 38.0 37.2 38.0 33.0 38.0 115-119 36.36405 38.0 38.0 38.0 34.0 38.0 120-124 36.56355 38.0 38.0 38.0 34.2 38.0 125-129 36.5179 38.0 38.0 38.0 33.8 38.0 130-134 36.23755 38.0 38.0 38.0 34.0 38.0 135-139 35.4799 38.0 36.0 38.0 29.4 38.0 140-144 35.46825 38.0 36.2 38.0 31.0 38.0 145-149 33.431799999999996 38.0 33.0 38.0 21.0 38.0 150-151 29.3615 35.5 25.5 38.0 7.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 1.0 20 3.0 21 4.0 22 4.0 23 5.0 24 6.0 25 8.0 26 16.0 27 17.0 28 24.0 29 33.0 30 29.0 31 57.0 32 74.0 33 100.0 34 173.0 35 317.0 36 841.0 37 2285.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.264976958525345 15.841013824884792 8.035714285714286 35.85829493087558 2 22.325 13.625000000000002 32.65 31.4 3 22.6 18.025 23.799999999999997 35.575 4 26.1 25.874999999999996 22.025 26.0 5 24.5 29.5 24.075 21.925 6 20.549999999999997 33.050000000000004 24.375 22.025 7 16.925 23.05 39.825 20.200000000000003 8 20.125 22.925 30.675 26.275 9 19.525000000000002 23.849999999999998 32.6 24.025 10-14 22.155 26.19 26.86 24.795 15-19 21.9 26.115 27.165 24.82 20-24 22.075 26.365 27.115000000000002 24.445 25-29 22.384999999999998 26.484999999999996 26.119999999999997 25.009999999999998 30-34 21.990000000000002 26.279999999999998 26.165 25.564999999999998 35-39 22.134999999999998 26.145000000000003 26.69 25.03 40-44 21.78 26.900000000000002 25.900000000000002 25.419999999999998 45-49 22.255 25.840000000000003 26.36 25.545 50-54 22.31 26.645000000000003 26.015 25.03 55-59 22.18 25.900000000000002 26.47 25.45 60-64 22.225 26.090000000000003 26.235000000000003 25.45 65-69 22.105 26.055 26.369999999999997 25.47 70-74 22.555 25.95 26.445 25.05 75-79 22.065 26.08 26.27 25.585 80-84 21.845 26.305 26.650000000000002 25.2 85-89 22.134999999999998 25.665 26.965 25.235000000000003 90-94 21.605 26.155 26.534999999999997 25.705 95-99 22.509999999999998 25.935000000000002 26.669999999999998 24.884999999999998 100-104 22.32 26.32 26.474999999999998 24.884999999999998 105-109 22.59 26.064999999999998 26.235000000000003 25.11 110-114 22.384999999999998 26.314999999999998 26.400000000000002 24.9 115-119 22.689999999999998 26.0 26.38 24.93 120-124 21.91 26.055 26.6 25.435000000000002 125-129 23.135 25.919999999999998 26.105 24.84 130-134 22.905 25.7 26.205000000000002 25.19 135-139 22.765 26.08 26.119999999999997 25.035 140-144 22.509999999999998 26.515 26.055 24.92 145-149 22.75 26.235000000000003 25.619999999999997 25.395 150-151 22.875 24.8 26.6625 25.662499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.0 28 2.5 29 4.5 30 8.0 31 12.0 32 17.0 33 22.0 34 33.0 35 43.5 36 51.0 37 69.5 38 94.0 39 117.0 40 145.5 41 170.0 42 199.5 43 233.0 44 253.5 45 260.0 46 233.0 47 207.0 48 202.0 49 195.0 50 170.0 51 151.0 52 135.0 53 111.0 54 95.5 55 85.0 56 74.5 57 62.0 58 56.0 59 52.5 60 51.0 61 46.0 62 39.0 63 44.5 64 46.0 65 33.0 66 25.0 67 29.5 68 30.0 69 19.5 70 15.5 71 17.0 72 14.5 73 7.5 74 4.5 75 5.5 76 3.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 13.200000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.3 0.0 0.0 0.0 0.0 120-121 1.6124999999999998 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.3875 0.0 0.0 0.0 0.0 128-129 2.5999999999999996 0.0 0.0 0.0 0.0 130-131 2.8499999999999996 0.0 0.0 0.0 0.0 132-133 3.325 0.0 0.0 0.0 0.0 134-135 3.6375 0.0 0.0 0.0 0.0 136-137 4.0375 0.0 0.0 0.0 0.0 138-139 4.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAAAT 20 0.0059601753 28.975002 140-144 >>END_MODULE SRR6958380 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958380_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.939 33.0 33.0 34.0 32.0 34.0 2 32.9935 34.0 33.0 34.0 32.0 34.0 3 33.1285 34.0 33.0 34.0 33.0 34.0 4 33.07325 34.0 33.0 34.0 33.0 34.0 5 33.08475 34.0 33.0 34.0 33.0 34.0 6 37.19 38.0 38.0 38.0 37.0 38.0 7 37.05125 38.0 38.0 38.0 37.0 38.0 8 37.18125 38.0 38.0 38.0 37.0 38.0 9 37.2375 38.0 38.0 38.0 37.0 38.0 10-14 37.02205 38.0 38.0 38.0 36.8 38.0 15-19 36.89045 38.0 38.0 38.0 36.4 38.0 20-24 36.84245 38.0 38.0 38.0 36.4 38.0 25-29 36.964150000000004 38.0 38.0 38.0 36.6 38.0 30-34 37.1265 38.0 38.0 38.0 37.0 38.0 35-39 37.1717 38.0 38.0 38.0 37.2 38.0 40-44 37.127449999999996 38.0 38.0 38.0 37.4 38.0 45-49 37.039649999999995 38.0 38.0 38.0 36.8 38.0 50-54 36.7182 38.0 38.0 38.0 35.8 38.0 55-59 36.8118 38.0 38.0 38.0 36.0 38.0 60-64 36.800850000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.71515 38.0 38.0 38.0 35.8 38.0 70-74 36.63555 38.0 38.0 38.0 35.8 38.0 75-79 36.4076 38.0 38.0 38.0 34.6 38.0 80-84 36.1302 38.0 38.0 38.0 33.6 38.0 85-89 35.818850000000005 38.0 38.0 38.0 32.2 38.0 90-94 36.29415 38.0 38.0 38.0 34.4 38.0 95-99 36.495549999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.486000000000004 38.0 38.0 38.0 35.0 38.0 105-109 36.341300000000004 38.0 38.0 38.0 34.4 38.0 110-114 36.1498 38.0 38.0 38.0 34.0 38.0 115-119 33.8196 37.4 32.6 38.0 25.4 38.0 120-124 32.02595 36.2 27.8 38.0 19.0 38.0 125-129 34.454 38.0 34.8 38.0 25.4 38.0 130-134 33.2144 37.6 31.6 38.0 19.8 38.0 135-139 29.666649999999997 33.4 23.4 38.0 16.2 38.0 140-144 34.310500000000005 38.0 34.8 38.0 26.4 38.0 145-149 33.734049999999996 38.0 34.8 38.0 21.6 38.0 150-151 27.8125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 8.0 4 2.0 5 7.0 6 1.0 7 0.0 8 1.0 9 2.0 10 2.0 11 2.0 12 0.0 13 1.0 14 2.0 15 2.0 16 2.0 17 3.0 18 2.0 19 4.0 20 6.0 21 5.0 22 4.0 23 11.0 24 16.0 25 14.0 26 13.0 27 26.0 28 35.0 29 46.0 30 40.0 31 64.0 32 87.0 33 113.0 34 212.0 35 409.0 36 1031.0 37 1811.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.95 16.925 12.0 28.125 2 29.299999999999997 23.849999999999998 27.05 19.8 3 23.75 26.224999999999998 27.325 22.7 4 26.375 32.05 19.8 21.775 5 27.575 33.125 19.950000000000003 19.35 6 22.5 35.875 22.05 19.575 7 21.5 19.900000000000002 35.65 22.95 8 23.3 23.375 25.224999999999998 28.1 9 24.25 22.525000000000002 27.825 25.4 10-14 25.765 27.134999999999998 23.64 23.46 15-19 25.365 26.07 24.985 23.580000000000002 20-24 24.93 26.66 25.645 22.765 25-29 25.21 26.424999999999997 24.865000000000002 23.5 30-34 25.419999999999998 26.619999999999997 24.995 22.965 35-39 25.629999999999995 26.125 25.19 23.055 40-44 25.095 26.095000000000002 25.330000000000002 23.48 45-49 24.87 26.155 25.615 23.36 50-54 25.21 26.615 25.724999999999998 22.45 55-59 25.515 26.135 24.98 23.369999999999997 60-64 25.025 26.384999999999998 25.729999999999997 22.86 65-69 25.215 25.795 25.790000000000003 23.200000000000003 70-74 25.835 26.05 24.995 23.119999999999997 75-79 25.385 26.009999999999998 25.929999999999996 22.675 80-84 25.245 26.27 25.855 22.63 85-89 25.485000000000003 26.045 25.285000000000004 23.185 90-94 25.105 26.484999999999996 25.515 22.895 95-99 25.83 26.465 25.230000000000004 22.475 100-104 25.974999999999998 26.029999999999998 25.480000000000004 22.515 105-109 25.295 26.555 25.35 22.8 110-114 25.230000000000004 26.5 25.745 22.525000000000002 115-119 25.82 26.700000000000003 25.6 21.88 120-124 25.835 26.590000000000003 25.615 21.959999999999997 125-129 25.724999999999998 27.07 25.264999999999997 21.94 130-134 26.015 26.810000000000002 25.165 22.009999999999998 135-139 26.450000000000003 25.695 26.365 21.490000000000002 140-144 26.195 26.790000000000003 24.91 22.105 145-149 26.105 27.115000000000002 25.05 21.73 150-151 26.387500000000003 26.85 25.474999999999998 21.2875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.0 25 0.5 26 1.0 27 2.5 28 3.5 29 5.0 30 9.5 31 10.0 32 12.0 33 18.0 34 26.5 35 39.5 36 51.0 37 69.5 38 86.5 39 102.0 40 124.5 41 152.0 42 179.0 43 197.5 44 220.0 45 224.5 46 221.5 47 220.5 48 199.0 49 189.0 50 177.0 51 150.5 52 131.0 53 120.5 54 111.0 55 88.5 56 86.5 57 74.0 58 54.0 59 67.0 60 71.0 61 57.0 62 51.0 63 55.0 64 53.5 65 47.5 66 44.5 67 44.0 68 37.5 69 25.5 70 21.0 71 20.0 72 15.5 73 11.0 74 6.0 75 4.0 76 2.0 77 0.5 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11638475132543 98.15 2 0.8331229487503155 1.6500000000000001 3 0.025246149962130777 0.075 4 0.0 0.0 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.05 0.025 0.0 0.0 0.0 82-83 0.05 0.025 0.0 0.0 0.0 84-85 0.05 0.025 0.0 0.0 0.0 86-87 0.0625 0.025 0.0 0.0 0.0 88-89 0.1 0.025 0.0 0.0 0.0 90-91 0.15 0.025 0.0 0.0 0.0 92-93 0.16249999999999998 0.025 0.0 0.0 0.0 94-95 0.21250000000000002 0.025 0.0 0.0 0.0 96-97 0.3 0.025 0.0 0.0 0.0 98-99 0.325 0.025 0.0 0.0 0.0 100-101 0.375 0.025 0.0 0.0 0.0 102-103 0.4 0.025 0.0 0.0 0.0 104-105 0.5125 0.025 0.0 0.0 0.0 106-107 0.6125 0.025 0.0 0.0 0.0 108-109 0.7 0.025 0.0 0.0 0.0 110-111 0.75 0.025 0.0 0.0 0.0 112-113 0.8 0.025 0.0 0.0 0.0 114-115 0.85 0.025 0.0 0.0 0.0 116-117 0.9 0.025 0.0 0.0 0.0 118-119 1.025 0.025 0.0 0.0 0.0 120-121 1.275 0.025 0.0 0.0 0.0 122-123 1.5125 0.025 0.0 0.0 0.0 124-125 1.725 0.025 0.0 0.0 0.0 126-127 1.9375 0.025 0.0 0.0 0.0 128-129 2.0 0.025 0.0 0.0 0.0 130-131 2.2125 0.025 0.0 0.0 0.0 132-133 2.55 0.025 0.0 0.0 0.0 134-135 2.8 0.025 0.0 0.0 0.0 136-137 3.1375 0.025 0.0 0.0 0.0 138-139 3.5374999999999996 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTGCA 10 0.006830828 145.0 4 CCCTTTT 10 0.006830828 145.0 9 TCCCTTT 10 0.006830828 145.0 8 GAGGCTA 10 0.006830828 145.0 7 >>END_MODULE Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282704 spots for SRR6958380.sra Written 1282704 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra Read 1282697 spots for SRR6958380.sra Written 1282697 spots for SRR6958380.sra SRR ids: ['SRR6958380.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_33pansfj SRR6958380.sra spots: 25653947 blocks: [[1, 1282697], [1282698, 2565394], [2565395, 3848091], [3848092, 5130788], [5130789, 6413485], [6413486, 7696182], [7696183, 8978879], [8978880, 10261576], [10261577, 11544273], [11544274, 12826970], [12826971, 14109667], [14109668, 15392364], [15392365, 16675061], [16675062, 17957758], [17957759, 19240455], [19240456, 20523152], [20523153, 21805849], [21805850, 23088546], [23088547, 24371243], [24371244, 25653947]] SRR6958380 file size 8671580 SRR6958380 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958380 SRR6958380_1.fastq SRR6958380_2.fastq Input file: SRR6958380_1.fastq Paired file: SRR6958380_2.fastq trimmed: SRR6958380-trimmed-pair1.fastq, SRR6958380-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:37:34 2024 >> started Fri Dec 6 21:38:00 2024 >> done (26.806s) 25653947 read pairs processed; of these: 33808 ( 0.13%) short read pairs filtered out after trimming by size control 29344 ( 0.11%) empty read pairs filtered out after trimming by size control 25590795 (99.75%) read pairs available; of these: 8494984 (33.20%) trimmed read pairs available after processing 17095811 (66.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 8 0.00% 21 8 0.00% 22 8 0.00% 23 13 0.00% 24 6 0.00% 25 7 0.00% 26 6 0.00% 27 10 0.00% 28 9 0.00% 29 9 0.00% 30 15 0.00% 31 13 0.00% 32 16 0.00% 33 13 0.00% 34 10 0.00% 35 13 0.00% 36 16 0.00% 37 23 0.00% 38 20 0.00% 39 27 0.00% 40 22 0.00% 41 25 0.00% 42 35 0.00% 43 28 0.00% 44 34 0.00% 45 37 0.00% 46 34 0.00% 47 43 0.00% 48 46 0.00% 49 60 0.00% 50 65 0.00% 51 58 0.00% 52 90 0.00% 53 86 0.00% 54 91 0.00% 55 110 0.00% 56 118 0.00% 57 121 0.00% 58 156 0.00% 59 176 0.00% 60 193 0.00% 61 198 0.00% 62 226 0.00% 63 313 0.00% 64 340 0.00% 65 346 0.00% 66 363 0.00% 67 424 0.00% 68 501 0.00% 69 603 0.00% 70 619 0.00% 71 787 0.00% 72 847 0.00% 73 1013 0.00% 74 1127 0.00% 75 1198 0.00% 76 1486 0.01% 77 1633 0.01% 78 1682 0.01% 79 1835 0.01% 80 2057 0.01% 81 2477 0.01% 82 2722 0.01% 83 3192 0.01% 84 4709 0.02% 85 5904 0.02% 86 6039 0.02% 87 6367 0.02% 88 6554 0.03% 89 6810 0.03% 90 7172 0.03% 91 7722 0.03% 92 8327 0.03% 93 8876 0.03% 94 9618 0.04% 95 10100 0.04% 96 10742 0.04% 97 11349 0.04% 98 11599 0.05% 99 12346 0.05% 100 13206 0.05% 101 13970 0.05% 102 15008 0.06% 103 16061 0.06% 104 17211 0.07% 105 18184 0.07% 106 18619 0.07% 107 19677 0.08% 108 20641 0.08% 109 21354 0.08% 110 22108 0.09% 111 23593 0.09% 112 25075 0.10% 113 26035 0.10% 114 27364 0.11% 115 29017 0.11% 116 30511 0.12% 117 31469 0.12% 118 32191 0.13% 119 33356 0.13% 120 34446 0.13% 121 35863 0.14% 122 37573 0.15% 123 39154 0.15% 124 41753 0.16% 125 43643 0.17% 126 45198 0.18% 127 46935 0.18% 128 47326 0.18% 129 49517 0.19% 130 51198 0.20% 131 52572 0.21% 132 55827 0.22% 133 58649 0.23% 134 61041 0.24% 135 64727 0.25% 136 68093 0.27% 137 71129 0.28% 138 74631 0.29% 139 78383 0.31% 140 81961 0.32% 141 88167 0.34% 142 96447 0.38% 143 106392 0.42% 144 119907 0.47% 145 138182 0.54% 146 165084 0.65% 147 212656 0.83% 148 309703 1.21% 149 617953 2.41% 150 4884111 19.09% 151 17095811 66.80% 25590795 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.22 fanout-score-rank=23 prefix-density=0.29 prefix-fanout=3.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=86.11 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=11.9 sequence=CAGCTGCAGCTTCTTCTGTCACTTGGGACGCCTGCTGCAGAGTGCAGATAAGGTTGCGGTCCCCGTACACGTTGTCCACACGACATGTTGTTGGCCAGAACTTGGCACCCCGAAGCCAAGCCGCAGGGAACGCGGCGTACTCCCTAGAGTACGGCTTAGTCCATGCATCGCTCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTCTGCAATTTCTTCCCTGATTGAGACAAGGGCATCACAGAACCTGTCTAGTTCAGCCTTGCTTTCGCTTTCAGTGGGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCGTGGAATCCATAGTCCATCAAGCGCTTTGCCACATCCTCAGGCTCTATACCAGCAGTTGCCTTAAACCCTCTTAAGTCAATAATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTGCTTCTCCAG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.20 fanout-score-rank=29 prefix-density=0.23 prefix-fanout=3.2 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=111.63 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=17.3 sequence=CGCCGCCGCCGC SRR6958380 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:38:49 Started mapping on | Dec 06 21:38:49 Finished on | Dec 06 21:40:48 Mapping speed, Million of reads per hour | 774.18 Number of input reads | 25590795 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 24896398 Uniquely mapped reads % | 97.29% Average mapped length | 296.56 Number of splices: Total | 30259699 Number of splices: Annotated (sjdb) | 28607540 Number of splices: GT/AG | 29849291 Number of splices: GC/AG | 352993 Number of splices: AT/AC | 16208 Number of splices: Non-canonical | 41207 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.51 Insertion rate per base | 0.01% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280717 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 11386 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.29% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 436555 436555 436555 N_multimapping 280717 280717 280717 N_noFeature 1013612 24279587 1191490 N_ambiguous 528084 3267 90568 UnstrandedReadsAssigned:23354702 PositiveStrandReadsAssigned:613544 NegativeStrandReadsAssigned:23614340 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958380 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958380-trimmed-pair1.fastq SRR6958380-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,590,795 reads, 23,673,559 reads pseudoaligned [quant] estimated average fragment length: 263.056 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52973 SRR6958380.ke.tsv 35125 SRR6958380.se.tsv 88098 total ==> SRR6958380.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 674.308 4.73361e-07 4.49985e-08 PNS24247 1044 781.944 66.885 5.48299 PNS24249 1928 1665.94 48.0348 1.84825 PNS24246 1044 781.944 66.885 5.48299 PNS24248 1044 781.944 66.885 5.48299 PNS24244 1471 1208.94 55.3103 2.93268 PNS24243 293 86.7524 0 0 KQK14069 1603 1340.94 635.113 30.3602 KQK14071 474 227.948 3.31332 0.931732 ==> SRR6958380.se.tsv <== BRADI_1g14170v3 724 BRADI_1g53295v3 596 BRADI_1g59795v3 542 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 695 BRADI_1g74790v3 273 BRADI_1g09890v3 0 BRADI_1g77505v3 488 BRADI_1g48960v3 3 SRR6958380 completed mapping pipeline successfully