Starting /dee2/code/volunteer_pipeline.sh SRR6958381 current disk space = 1548943273984 free memory = 1600415816 SRR6958381 SRAfilesize 9adf5a5acf40822209e9ae3b58ac2c3a SRR6958381.sra SRR6958381.sra file validated SRR6958381 is paired end SRR6958381 is conventional basespace SRR6958381 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958381_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.36025 32.0 18.0 33.0 18.0 34.0 2 29.52625 31.0 27.0 33.0 25.0 34.0 3 30.82275 31.0 29.0 33.0 27.0 33.0 4 31.811 33.0 31.0 33.0 29.0 33.0 5 32.29725 33.0 33.0 33.0 31.0 34.0 6 35.77475 37.0 36.0 38.0 31.0 38.0 7 37.09075 38.0 37.0 38.0 35.0 38.0 8 37.374 38.0 38.0 38.0 37.0 38.0 9 37.33025 38.0 38.0 38.0 37.0 38.0 10-14 37.18055 38.0 38.0 38.0 36.0 38.0 15-19 37.3913 38.0 38.0 38.0 37.0 38.0 20-24 37.389450000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.488 38.0 38.0 38.0 37.4 38.0 30-34 37.53 38.0 38.0 38.0 37.8 38.0 35-39 37.541250000000005 38.0 38.0 38.0 37.6 38.0 40-44 37.53430000000001 38.0 38.0 38.0 37.4 38.0 45-49 37.2002 38.0 38.0 38.0 36.2 38.0 50-54 37.30650000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.0338 38.0 38.0 38.0 35.8 38.0 60-64 37.14505 38.0 38.0 38.0 36.2 38.0 65-69 37.152249999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.76765 38.0 38.0 38.0 34.8 38.0 75-79 36.9251 38.0 38.0 38.0 35.6 38.0 80-84 37.04495 38.0 38.0 38.0 36.0 38.0 85-89 36.9876 38.0 38.0 38.0 35.6 38.0 90-94 36.904250000000005 38.0 38.0 38.0 35.0 38.0 95-99 36.76365 38.0 38.0 38.0 34.8 38.0 100-104 36.641200000000005 38.0 38.0 38.0 34.2 38.0 105-109 36.438 38.0 37.6 38.0 34.0 38.0 110-114 36.36985 38.0 37.4 38.0 33.8 38.0 115-119 36.15565 38.0 37.2 38.0 33.4 38.0 120-124 35.96900000000001 38.0 36.8 38.0 32.6 38.0 125-129 35.9263 38.0 36.6 38.0 32.4 38.0 130-134 35.6871 38.0 36.0 38.0 31.6 38.0 135-139 35.34905 38.0 35.6 38.0 30.6 38.0 140-144 35.029650000000004 38.0 35.4 38.0 29.8 38.0 145-149 34.293549999999996 38.0 35.0 38.0 27.4 38.0 150-151 30.336 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 4.0 22 4.0 23 3.0 24 4.0 25 9.0 26 7.0 27 12.0 28 30.0 29 21.0 30 33.0 31 53.0 32 75.0 33 98.0 34 175.0 35 318.0 36 864.0 37 2285.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.257909390027844 16.147810680840294 8.85851683118198 43.735763097949885 2 20.349999999999998 15.85 36.25 27.55 3 19.39924906132666 16.270337922403 26.032540675844807 38.297872340425535 4 24.45 24.5 23.474999999999998 27.575 5 24.875 31.775 23.65 19.7 6 23.3 34.325 22.925 19.45 7 16.975 25.650000000000002 38.925 18.45 8 19.475 24.85 29.775000000000002 25.900000000000002 9 19.45 22.425 34.449999999999996 23.674999999999997 10-14 22.115000000000002 28.605000000000004 25.89 23.39 15-19 21.925 27.525 26.795 23.755000000000003 20-24 22.32611630581529 28.14140707035352 25.791289564478227 23.741187059352967 25-29 22.035 27.74 26.255 23.97 30-34 22.1 27.584999999999997 26.6 23.715 35-39 21.695 27.515 26.86 23.93 40-44 22.29 28.18 26.135 23.395 45-49 22.415 27.605 25.69 24.29 50-54 22.37 26.645000000000003 26.619999999999997 24.365000000000002 55-59 21.92 27.46 26.06 24.560000000000002 60-64 21.995 27.52 26.26 24.224999999999998 65-69 22.07 26.875 26.565 24.490000000000002 70-74 22.31 26.995 26.16 24.535 75-79 22.105 26.765 26.86 24.27 80-84 22.255 27.345000000000002 26.279999999999998 24.12 85-89 22.59 27.025 26.479999999999997 23.905 90-94 21.715 28.199999999999996 25.785000000000004 24.3 95-99 21.995 27.315 25.89 24.8 100-104 22.464492898579717 27.825565113022606 25.71014202840568 23.999799959992 105-109 22.795 27.165 25.885 24.154999999999998 110-114 22.475618904726183 27.58689672418104 26.101525381345336 23.835958989747436 115-119 22.879871916745884 27.72802321508981 25.82178415970381 23.5703207084605 120-124 22.02 27.255000000000003 26.155 24.57 125-129 22.33733733733734 26.896896896896898 26.59159159159159 24.174174174174173 130-134 22.443977591036415 27.02581032412965 26.17046818727491 24.359743897559024 135-139 22.495 26.775 26.06 24.67 140-144 22.919999999999998 26.415 25.974999999999998 24.69 145-149 22.195 26.66 26.345000000000002 24.8 150-151 22.5125 27.3375 25.912499999999998 24.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 1.0 28 1.5 29 5.0 30 10.5 31 14.5 32 15.5 33 21.5 34 34.5 35 52.0 36 67.0 37 83.0 38 106.0 39 142.5 40 179.0 41 189.5 42 215.5 43 247.5 44 239.0 45 230.0 46 241.5 47 241.0 48 221.5 49 193.5 50 164.0 51 136.5 52 121.0 53 107.0 54 89.0 55 86.0 56 77.5 57 66.5 58 53.0 59 45.0 60 48.5 61 46.0 62 37.5 63 28.5 64 26.0 65 25.0 66 20.0 67 15.5 68 11.5 69 8.0 70 8.0 71 5.0 72 6.5 73 7.5 74 3.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.125 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.0 110-114 0.025 115-119 0.065 120-124 0.0 125-129 0.1 130-134 0.04 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7315842583249244 1.4500000000000002 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.23750000000000002 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.0499999999999998 0.0 0.0 0.0 0.0 112-113 1.2000000000000002 0.0 0.0 0.0 0.0 114-115 1.325 0.0 0.0 0.0 0.0 116-117 1.5 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.85 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.525 0.0 0.0 0.0 0.0 126-127 2.9625 0.0 0.0 0.0 0.0 128-129 3.325 0.0 0.0 0.0 0.0 130-131 3.725 0.0 0.0 0.0 0.0 132-133 4.05 0.0 0.0 0.0 0.0 134-135 4.3125 0.0 0.0 0.0 0.0 136-137 4.675000000000001 0.0 0.0 0.0 0.0 138-139 5.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTCAT 10 0.006832588 144.9875 5 >>END_MODULE SRR6958381 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958381_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.26225 33.0 33.0 34.0 33.0 34.0 2 33.34175 34.0 33.0 34.0 33.0 34.0 3 33.41225 34.0 33.0 34.0 33.0 34.0 4 33.2825 34.0 33.0 34.0 33.0 34.0 5 33.39325 34.0 33.0 34.0 33.0 34.0 6 37.4895 38.0 38.0 38.0 38.0 38.0 7 37.54875 38.0 38.0 38.0 38.0 38.0 8 37.473 38.0 38.0 38.0 38.0 38.0 9 37.4145 38.0 38.0 38.0 38.0 38.0 10-14 37.027499999999996 38.0 38.0 38.0 36.0 38.0 15-19 36.9621 38.0 37.8 38.0 35.6 38.0 20-24 37.437400000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.471599999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.5655 38.0 38.0 38.0 38.0 38.0 35-39 37.05839999999999 38.0 38.0 38.0 36.6 38.0 40-44 37.46395 38.0 38.0 38.0 37.6 38.0 45-49 37.142450000000004 38.0 38.0 38.0 36.6 38.0 50-54 37.176750000000006 38.0 38.0 38.0 36.6 38.0 55-59 36.7342 38.0 37.8 38.0 34.0 38.0 60-64 37.461299999999994 38.0 38.0 38.0 38.0 38.0 65-69 37.24635 38.0 38.0 38.0 37.0 38.0 70-74 37.36185 38.0 38.0 38.0 37.4 38.0 75-79 37.1043 38.0 38.0 38.0 36.2 38.0 80-84 37.3575 38.0 38.0 38.0 37.2 38.0 85-89 37.359300000000005 38.0 38.0 38.0 37.2 38.0 90-94 37.210150000000006 38.0 38.0 38.0 36.8 38.0 95-99 37.2274 38.0 38.0 38.0 37.0 38.0 100-104 36.30385 38.0 37.4 38.0 33.2 38.0 105-109 36.3158 38.0 37.6 38.0 32.8 38.0 110-114 36.7802 38.0 38.0 38.0 34.8 38.0 115-119 36.93339999999999 38.0 38.0 38.0 35.2 38.0 120-124 36.7991 38.0 38.0 38.0 35.4 38.0 125-129 36.54635 38.0 38.0 38.0 34.2 38.0 130-134 36.3511 38.0 38.0 38.0 34.0 38.0 135-139 36.15 38.0 37.8 38.0 33.6 38.0 140-144 35.5766 38.0 36.2 38.0 31.8 38.0 145-149 35.21205 38.0 36.6 38.0 31.0 38.0 150-151 28.090874999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 0.0 10 0.0 11 2.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 1.0 18 1.0 19 2.0 20 0.0 21 3.0 22 3.0 23 2.0 24 6.0 25 2.0 26 14.0 27 16.0 28 13.0 29 20.0 30 29.0 31 37.0 32 51.0 33 63.0 34 110.0 35 239.0 36 578.0 37 2802.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.25 17.925 12.425 33.4 2 30.2 23.3 29.175 17.325 3 21.05 27.125 28.599999999999998 23.225 4 25.224999999999998 31.724999999999998 21.15 21.9 5 28.599999999999998 32.925 20.349999999999998 18.125 6 22.075 36.475 21.825 19.625 7 20.45 19.6 37.9 22.05 8 22.825 24.975 26.174999999999997 26.025 9 23.599999999999998 24.45 28.15 23.799999999999997 10-14 25.025 27.150000000000002 24.565 23.26 15-19 24.37 26.66 26.085 22.884999999999998 20-24 24.404999999999998 26.815 26.125 22.655 25-29 24.845 26.97 25.509999999999998 22.675 30-34 24.79 26.595000000000002 26.125 22.49 35-39 23.955000000000002 26.840000000000003 25.924999999999997 23.28 40-44 24.745 26.245 26.57 22.439999999999998 45-49 24.965 26.555 25.97 22.509999999999998 50-54 25.195 26.035000000000004 26.165 22.605 55-59 25.16 26.1 26.275 22.465 60-64 24.825 26.525 26.245 22.405 65-69 24.654999999999998 26.090000000000003 26.57 22.685 70-74 24.21 26.25 26.695 22.845 75-79 24.535 25.814999999999998 27.084999999999997 22.564999999999998 80-84 24.935 25.905 26.665 22.495 85-89 24.555 26.58 26.314999999999998 22.55 90-94 23.84 26.06 27.48 22.62 95-99 24.834999999999997 26.525 26.245 22.395 100-104 24.345 26.484999999999996 27.05 22.12 105-109 24.6 26.634999999999998 26.525 22.24 110-114 24.349999999999998 27.275 26.405 21.97 115-119 24.67 26.435 26.950000000000003 21.945 120-124 24.815 27.455000000000002 25.885 21.845 125-129 24.965 27.029999999999998 26.295 21.709999999999997 130-134 24.765 26.924999999999997 26.479999999999997 21.83 135-139 25.05 27.21 26.345000000000002 21.395 140-144 25.28 26.345000000000002 26.68 21.695 145-149 24.775 26.88 26.740000000000002 21.605 150-151 25.4875 27.35 26.6625 20.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 1.5 28 6.0 29 9.0 30 7.5 31 8.0 32 12.0 33 16.5 34 26.5 35 42.0 36 51.0 37 76.5 38 102.0 39 112.0 40 147.0 41 179.5 42 208.5 43 227.0 44 243.0 45 243.0 46 227.0 47 209.0 48 207.0 49 204.5 50 164.0 51 155.0 52 141.5 53 115.5 54 97.5 55 87.0 56 80.0 57 67.5 58 70.5 59 68.5 60 57.5 61 49.5 62 49.5 63 50.0 64 36.5 65 25.5 66 18.5 67 14.5 68 16.5 69 16.5 70 13.5 71 11.5 72 9.0 73 6.5 74 4.5 75 2.5 76 1.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42036290322581 98.625 2 0.4284274193548387 0.8500000000000001 3 0.10080645161290322 0.3 4 0.025201612903225805 0.1 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1625 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.6000000000000001 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.1625 0.0 0.0 0.0 0.0 124-125 2.575 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.4000000000000004 0.0 0.0 0.0 0.0 130-131 3.825 0.0 0.0 0.0 0.0 132-133 4.15 0.0 0.0 0.0 0.0 134-135 4.4125 0.0 0.0 0.0 0.0 136-137 4.775 0.0 0.0 0.0 0.0 138-139 5.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCCTG 10 0.006830828 145.0 9 >>END_MODULE Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519896 spots for SRR6958381.sra Written 519896 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra Read 519888 spots for SRR6958381.sra Written 519888 spots for SRR6958381.sra SRR ids: ['SRR6958381.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fs9je_kl SRR6958381.sra spots: 10397768 blocks: [[1, 519888], [519889, 1039776], [1039777, 1559664], [1559665, 2079552], [2079553, 2599440], [2599441, 3119328], [3119329, 3639216], [3639217, 4159104], [4159105, 4678992], [4678993, 5198880], [5198881, 5718768], [5718769, 6238656], [6238657, 6758544], [6758545, 7278432], [7278433, 7798320], [7798321, 8318208], [8318209, 8838096], [8838097, 9357984], [9357985, 9877872], [9877873, 10397768]] SRR6958381 file size 3501762 SRR6958381 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958381 SRR6958381_1.fastq SRR6958381_2.fastq Input file: SRR6958381_1.fastq Paired file: SRR6958381_2.fastq trimmed: SRR6958381-trimmed-pair1.fastq, SRR6958381-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:35:57 2024 >> started Fri Dec 6 21:36:08 2024 >> done (10.771s) 10397768 read pairs processed; of these: 5401 ( 0.05%) short read pairs filtered out after trimming by size control 2945 ( 0.03%) empty read pairs filtered out after trimming by size control 10389422 (99.92%) read pairs available; of these: 3591147 (34.57%) trimmed read pairs available after processing 6798275 (65.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 6 0.00% 25 2 0.00% 26 2 0.00% 27 3 0.00% 28 2 0.00% 29 2 0.00% 30 1 0.00% 31 0 0.00% 32 2 0.00% 33 2 0.00% 34 5 0.00% 35 7 0.00% 36 2 0.00% 37 2 0.00% 38 1 0.00% 39 7 0.00% 40 8 0.00% 41 5 0.00% 42 5 0.00% 43 4 0.00% 44 4 0.00% 45 10 0.00% 46 8 0.00% 47 8 0.00% 48 11 0.00% 49 14 0.00% 50 9 0.00% 51 14 0.00% 52 13 0.00% 53 22 0.00% 54 20 0.00% 55 25 0.00% 56 25 0.00% 57 16 0.00% 58 27 0.00% 59 31 0.00% 60 37 0.00% 61 53 0.00% 62 57 0.00% 63 61 0.00% 64 65 0.00% 65 69 0.00% 66 82 0.00% 67 94 0.00% 68 87 0.00% 69 118 0.00% 70 109 0.00% 71 138 0.00% 72 165 0.00% 73 154 0.00% 74 211 0.00% 75 247 0.00% 76 287 0.00% 77 290 0.00% 78 377 0.00% 79 406 0.00% 80 383 0.00% 81 493 0.00% 82 556 0.01% 83 695 0.01% 84 845 0.01% 85 1019 0.01% 86 1107 0.01% 87 1208 0.01% 88 1278 0.01% 89 1392 0.01% 90 1565 0.02% 91 1661 0.02% 92 1983 0.02% 93 2024 0.02% 94 2281 0.02% 95 2359 0.02% 96 2530 0.02% 97 2689 0.03% 98 2959 0.03% 99 3233 0.03% 100 3577 0.03% 101 3836 0.04% 102 4067 0.04% 103 4349 0.04% 104 4687 0.05% 105 4838 0.05% 106 5274 0.05% 107 5649 0.05% 108 5808 0.06% 109 6322 0.06% 110 6635 0.06% 111 7115 0.07% 112 7412 0.07% 113 7810 0.08% 114 8288 0.08% 115 9025 0.09% 116 9512 0.09% 117 9741 0.09% 118 10152 0.10% 119 10421 0.10% 120 11053 0.11% 121 11748 0.11% 122 12613 0.12% 123 12919 0.12% 124 13779 0.13% 125 14292 0.14% 126 14972 0.14% 127 15788 0.15% 128 16340 0.16% 129 17471 0.17% 130 18235 0.18% 131 18875 0.18% 132 19709 0.19% 133 20844 0.20% 134 21928 0.21% 135 23415 0.23% 136 24736 0.24% 137 26259 0.25% 138 27126 0.26% 139 29588 0.28% 140 31780 0.31% 141 34456 0.33% 142 38334 0.37% 143 41920 0.40% 144 48678 0.47% 145 57622 0.55% 146 72107 0.69% 147 98142 0.94% 148 152930 1.47% 149 325084 3.13% 150 2148184 20.68% 151 6798275 65.43% 10389422 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=17 prefix-density=0.88 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=47.82 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=14 prefix-density=0.65 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=18.51 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=3.9 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958381 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:36:53 Started mapping on | Dec 06 21:36:53 Finished on | Dec 06 21:37:46 Mapping speed, Million of reads per hour | 705.70 Number of input reads | 10389422 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10219116 Uniquely mapped reads % | 98.36% Average mapped length | 297.61 Number of splices: Total | 12314496 Number of splices: Annotated (sjdb) | 11610525 Number of splices: GT/AG | 12150814 Number of splices: GC/AG | 144493 Number of splices: AT/AC | 4571 Number of splices: Non-canonical | 14618 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 84042 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 3938 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.56% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 88135 88135 88135 N_multimapping 84042 84042 84042 N_noFeature 377709 9927471 469108 N_ambiguous 241264 1257 41775 UnstrandedReadsAssigned:9600143 PositiveStrandReadsAssigned:290388 NegativeStrandReadsAssigned:9708233 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958381 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958381-trimmed-pair1.fastq SRR6958381-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,389,422 reads, 9,711,628 reads pseudoaligned [quant] estimated average fragment length: 234.682 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR6958381.ke.tsv 35125 SRR6958381.se.tsv 88098 total ==> SRR6958381.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 702.776 0 0 PNS24247 1044 810.318 27.4833 5.46856 PNS24249 1928 1694.32 20.0477 1.90778 PNS24246 1044 810.318 27.4833 5.46856 PNS24248 1044 810.318 27.4833 5.46856 PNS24244 1471 1237.32 25.5023 3.32321 PNS24243 293 86.3146 0 0 KQK14069 1603 1369.32 2235.25 263.197 KQK14071 474 244.09 30.6309 20.2334 ==> SRR6958381.se.tsv <== BRADI_1g14170v3 2495 BRADI_1g53295v3 158 BRADI_1g59795v3 138 BRADI_1g07683v3 1 BRADI_1g00485v3 4 BRADI_1g20270v3 125 BRADI_1g74790v3 44 BRADI_1g09890v3 0 BRADI_1g77505v3 157 BRADI_1g48960v3 1 SRR6958381 completed mapping pipeline successfully