Starting /dee2/code/volunteer_pipeline.sh SRR6958382 current disk space = 1548919787520 free memory = 1600341948 SRR6958382 SRAfilesize b69b888db370095f51a54e570b443654 SRR6958382.sra SRR6958382.sra file validated SRR6958382 is paired end SRR6958382 is conventional basespace SRR6958382 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958382_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.7185 32.0 28.0 34.0 18.0 34.0 2 32.40475 33.0 31.0 34.0 30.0 34.0 3 33.01025 33.0 33.0 34.0 33.0 34.0 4 32.6725 33.0 33.0 34.0 31.0 34.0 5 33.0485 33.0 33.0 34.0 32.0 34.0 6 36.61375 38.0 37.0 38.0 34.0 38.0 7 37.10675 38.0 38.0 38.0 35.0 38.0 8 37.33575 38.0 38.0 38.0 36.0 38.0 9 37.532 38.0 38.0 38.0 37.0 38.0 10-14 37.5606 38.0 38.0 38.0 38.0 38.0 15-19 37.6203 38.0 38.0 38.0 38.0 38.0 20-24 37.59225 38.0 38.0 38.0 38.0 38.0 25-29 37.5503 38.0 38.0 38.0 38.0 38.0 30-34 37.5197 38.0 38.0 38.0 38.0 38.0 35-39 37.48395 38.0 38.0 38.0 37.6 38.0 40-44 37.455650000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.43915 38.0 38.0 38.0 37.2 38.0 50-54 37.38535 38.0 38.0 38.0 37.0 38.0 55-59 36.9913 38.0 38.0 38.0 36.4 38.0 60-64 36.4142 38.0 38.0 38.0 35.6 38.0 65-69 37.19065 38.0 38.0 38.0 36.4 38.0 70-74 37.2661 38.0 38.0 38.0 36.6 38.0 75-79 37.20975 38.0 38.0 38.0 36.2 38.0 80-84 37.150099999999995 38.0 38.0 38.0 36.0 38.0 85-89 37.016000000000005 38.0 38.0 38.0 35.6 38.0 90-94 36.9709 38.0 38.0 38.0 35.4 38.0 95-99 36.905249999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.74935000000001 38.0 38.0 38.0 35.0 38.0 105-109 36.58004999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.51345 38.0 38.0 38.0 34.0 38.0 115-119 36.362350000000006 38.0 38.0 38.0 33.8 38.0 120-124 36.0016 38.0 37.2 38.0 32.2 38.0 125-129 35.87645 38.0 37.0 38.0 31.4 38.0 130-134 35.649649999999994 38.0 36.4 38.0 31.2 38.0 135-139 35.0676 38.0 36.0 38.0 29.8 38.0 140-144 34.50315 38.0 35.4 38.0 27.2 38.0 145-149 34.0909 38.0 35.0 38.0 26.0 38.0 150-151 28.78675 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 5.0 20 2.0 21 4.0 22 4.0 23 7.0 24 8.0 25 5.0 26 10.0 27 20.0 28 28.0 29 22.0 30 35.0 31 49.0 32 56.0 33 84.0 34 135.0 35 283.0 36 708.0 37 2530.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.525 11.924999999999999 7.025 36.525 2 22.375 12.45 32.324999999999996 32.85 3 20.825 15.85 27.3 36.025 4 26.224999999999998 23.875 21.349999999999998 28.549999999999997 5 26.375 27.750000000000004 23.625 22.25 6 24.3 30.575000000000003 23.45 21.675 7 18.775 24.9 37.875 18.45 8 20.4 24.375 29.2 26.025 9 20.225 21.275 33.800000000000004 24.7 10-14 23.93957583033213 25.620248099239696 25.665266106442573 24.774909963985596 15-19 23.87 24.54 26.155 25.435000000000002 20-24 23.195 25.145 25.330000000000002 26.33 25-29 23.155 24.93 25.665 26.25 30-34 23.765 24.93 25.53 25.775 35-39 23.599999999999998 25.195 25.635 25.569999999999997 40-44 23.71 24.825 25.509999999999998 25.955000000000002 45-49 23.150000000000002 24.645 25.845000000000002 26.36 50-54 23.43 25.230000000000004 25.64 25.7 55-59 24.292274309935912 24.468890346672048 25.10470807892214 26.134127264469896 60-64 23.2461751010592 24.576574732640843 26.050248170700506 26.127001995599446 65-69 23.895 24.7 25.629999999999995 25.775 70-74 23.849999999999998 24.45 25.564999999999998 26.135 75-79 23.855 24.58 25.775 25.790000000000003 80-84 23.630000000000003 24.834999999999997 25.4 26.135 85-89 23.580000000000002 24.585 25.66 26.174999999999997 90-94 23.625 24.65 25.635 26.090000000000003 95-99 24.48 24.325 25.674999999999997 25.52 100-104 23.93 24.455 25.965 25.650000000000002 105-109 24.145 24.474999999999998 25.28 26.1 110-114 24.015 24.79 25.275 25.919999999999998 115-119 24.325 24.395 25.045 26.235000000000003 120-124 24.12 24.5 25.345000000000002 26.035000000000004 125-129 23.925 24.275 25.805 25.995 130-134 23.75 24.135 25.759999999999998 26.355 135-139 23.945 24.795 25.569999999999997 25.69 140-144 24.395 24.560000000000002 25.259999999999998 25.785000000000004 145-149 24.435000000000002 24.19 25.195 26.179999999999996 150-151 24.099999999999998 24.224999999999998 25.5375 26.137500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 0.0 25 0.0 26 1.0 27 2.5 28 1.5 29 1.0 30 4.5 31 8.5 32 12.5 33 17.5 34 22.0 35 25.0 36 28.5 37 46.5 38 70.0 39 82.5 40 104.0 41 140.5 42 168.0 43 182.5 44 190.5 45 208.0 46 219.0 47 211.5 48 203.0 49 184.5 50 171.5 51 160.0 52 130.0 53 116.5 54 118.0 55 110.0 56 101.0 57 98.0 58 87.0 59 74.5 60 76.5 61 77.0 62 71.0 63 72.0 64 77.0 65 69.0 66 53.5 67 46.0 68 37.5 69 25.0 70 28.0 71 23.5 72 11.0 73 7.0 74 5.5 75 6.0 76 4.0 77 2.0 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.04 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.915 60-64 2.2849999999999997 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.6811301715438951 1.35 3 0.07568113017154389 0.22499999999999998 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8374999999999999 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.4875 0.0 0.0 0.0 0.0 130-131 1.675 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.2875 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138-139 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGGGG 10 0.0068892627 144.5875 5 >>END_MODULE SRR6958382 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958382_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.995 33.0 33.0 34.0 32.0 34.0 2 33.10125 34.0 33.0 34.0 32.0 34.0 3 33.16575 34.0 33.0 34.0 33.0 34.0 4 33.20325 34.0 33.0 34.0 33.0 34.0 5 33.0925 34.0 33.0 34.0 33.0 34.0 6 37.3135 38.0 38.0 38.0 37.0 38.0 7 37.3735 38.0 38.0 38.0 37.0 38.0 8 37.281 38.0 38.0 38.0 37.0 38.0 9 37.24775 38.0 38.0 38.0 37.0 38.0 10-14 37.313 38.0 38.0 38.0 37.2 38.0 15-19 37.20525 38.0 38.0 38.0 37.0 38.0 20-24 37.173199999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.1227 38.0 38.0 38.0 37.0 38.0 30-34 37.14235 38.0 38.0 38.0 37.0 38.0 35-39 37.11794999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.13785 38.0 38.0 38.0 36.8 38.0 45-49 37.10865 38.0 38.0 38.0 37.0 38.0 50-54 37.02285 38.0 38.0 38.0 36.2 38.0 55-59 37.038650000000004 38.0 38.0 38.0 36.4 38.0 60-64 36.962599999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.902300000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.821749999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.87985 38.0 38.0 38.0 36.0 38.0 80-84 36.8882 38.0 38.0 38.0 36.0 38.0 85-89 36.728899999999996 38.0 38.0 38.0 35.4 38.0 90-94 36.69335 38.0 38.0 38.0 35.2 38.0 95-99 36.53855 38.0 38.0 38.0 34.8 38.0 100-104 36.4304 38.0 38.0 38.0 34.4 38.0 105-109 36.35125000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.18805 38.0 38.0 38.0 33.8 38.0 115-119 35.9875 38.0 38.0 38.0 33.4 38.0 120-124 36.0118 38.0 38.0 38.0 33.6 38.0 125-129 35.9068 38.0 38.0 38.0 33.2 38.0 130-134 35.71155 38.0 37.0 38.0 33.0 38.0 135-139 35.4896 38.0 36.0 38.0 31.6 38.0 140-144 35.160849999999996 38.0 36.0 38.0 31.0 38.0 145-149 34.57985000000001 38.0 35.8 38.0 29.4 38.0 150-151 30.757125 35.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 7.0 4 3.0 5 3.0 6 0.0 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 3.0 15 2.0 16 2.0 17 4.0 18 2.0 19 6.0 20 7.0 21 4.0 22 2.0 23 6.0 24 11.0 25 12.0 26 10.0 27 15.0 28 20.0 29 33.0 30 33.0 31 49.0 32 46.0 33 62.0 34 109.0 35 196.0 36 497.0 37 2843.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.7 19.400000000000002 11.15 29.75 2 29.532383095773945 23.605901475368842 25.531382845711427 21.330332583145786 3 23.10577644411103 26.03150787696924 28.307076769192296 22.55563890972743 4 26.25656414103526 30.282570642660666 20.05501375343836 23.40585146286572 5 27.35683920980245 31.957989497374346 19.929982495623904 20.7551887971993 6 24.105131414267834 35.018773466833544 19.874843554443054 21.00125156445557 7 23.209814722083124 19.479218828242363 34.2764146219329 23.034551827741613 8 23.610415623435152 23.00951427140711 23.084626940410615 30.29544316474712 9 24.705882352941178 23.028785982478098 26.357947434292868 25.90738423028786 10-14 25.802413499574385 26.4483501076561 22.75299183816534 24.99624455460418 15-19 25.56835252879319 24.84226339509264 24.621932899349023 24.96745117676515 20-24 26.308146812878675 24.85604125982675 23.954734364829005 24.881077562465574 25-29 26.394591887831748 25.24787180771157 23.885828743114672 24.47170756134201 30-34 25.918878317476214 25.38808212318478 23.85077616424637 24.84226339509264 35-39 25.428142213319983 25.658487731597397 24.12618928392589 24.787180771156734 40-44 25.554498573073648 25.58954588694738 23.671957142141892 25.183998397837083 45-49 25.500700981373924 25.285399559383137 24.203885439615462 25.01001401962748 50-54 25.997696660157228 24.936157428270995 24.089930399078664 24.976215512493116 55-59 26.423313805017273 25.36177457313104 23.61924790946873 24.595663712382958 60-64 26.35953930896345 25.478217325988982 23.785678517776667 24.376564847270906 65-69 25.77980273369048 25.244079507334906 24.332849346617934 24.64326841235668 70-74 26.35558003304461 25.068842937966256 24.282781755369747 24.292795273619387 75-79 26.122653316645806 24.545682102628284 24.100125156445557 25.231539424280353 80-84 25.970059580433585 25.299153857707907 24.37290341961648 24.357883142242027 85-89 25.728446981075397 25.41804345649344 24.256533493541603 24.596976068889557 90-94 26.47338641029493 26.213008862851133 23.62926243052426 23.684342296329678 95-99 26.364546820230345 25.353029544316474 23.86079118678017 24.42163244867301 100-104 26.07541689618909 25.24913616104963 23.796885172016626 24.878561770744653 105-109 26.174261392088134 24.98748122183275 24.446670005007512 24.39158738107161 110-114 26.339509263895845 25.833750625938904 23.875813720580872 23.950926389584374 115-119 26.28811777076761 25.672224725852487 24.02984327274548 24.00981423063442 120-124 26.28442663995994 25.81372058087131 23.810716074111166 24.091136705057586 125-129 26.657320248347688 25.700981373923494 23.75325455637893 23.888443821349888 130-134 26.11656318846385 25.15021029441218 24.61946725415582 24.113759262968156 135-139 26.11155617865011 25.255357500500704 24.869817744842777 23.763268576006407 140-144 26.192979820740074 25.767362675880022 23.994792449051126 24.044865054328778 145-149 26.88398177357168 25.747333633768964 23.679335035801913 23.689349556857444 150-151 26.09838527975967 26.661659782200527 24.120665915633996 23.11928902240581 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 1.0 3 1.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.5 26 2.0 27 1.5 28 1.5 29 2.0 30 3.0 31 5.0 32 6.5 33 8.5 34 15.0 35 25.0 36 32.5 37 46.5 38 73.0 39 91.0 40 107.0 41 131.5 42 144.0 43 156.0 44 172.5 45 178.5 46 192.5 47 191.5 48 173.5 49 177.0 50 173.5 51 155.5 52 141.0 53 128.0 54 126.5 55 116.5 56 105.0 57 108.5 58 106.5 59 88.5 60 81.0 61 84.0 62 72.5 63 78.0 64 79.0 65 69.0 66 61.5 67 49.0 68 50.0 69 49.0 70 39.0 71 30.5 72 20.5 73 13.0 74 10.5 75 8.0 76 5.0 77 2.5 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.125 7 0.15 8 0.15 9 0.125 10-14 0.145 15-19 0.15 20-24 0.145 25-29 0.15 30-34 0.15 35-39 0.15 40-44 0.135 45-49 0.13999999999999999 50-54 0.145 55-59 0.145 60-64 0.15 65-69 0.135 70-74 0.135 75-79 0.125 80-84 0.135 85-89 0.13 90-94 0.145 95-99 0.15 100-104 0.155 105-109 0.15 110-114 0.15 115-119 0.145 120-124 0.15 125-129 0.13999999999999999 130-134 0.13999999999999999 135-139 0.13999999999999999 140-144 0.145 145-149 0.145 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.90973630831643 97.52499999999999 2 0.8620689655172413 1.7000000000000002 3 0.15212981744421905 0.44999999999999996 4 0.05070993914807302 0.2 5 0.02535496957403651 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0125 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.025 0.0 0.0 0.0 0.025 88-89 0.025 0.0 0.0 0.0 0.025 90-91 0.037500000000000006 0.0 0.0 0.0 0.025 92-93 0.05 0.0 0.0 0.0 0.025 94-95 0.075 0.0 0.0 0.0 0.025 96-97 0.075 0.0 0.0 0.0 0.025 98-99 0.1 0.0 0.0 0.0 0.025 100-101 0.125 0.0 0.0 0.0 0.025 102-103 0.125 0.0 0.0 0.0 0.025 104-105 0.16249999999999998 0.0 0.0 0.0 0.025 106-107 0.2 0.0 0.0 0.0 0.025 108-109 0.3375 0.0 0.0 0.0 0.025 110-111 0.4 0.0 0.0 0.0 0.025 112-113 0.45 0.0 0.0 0.0 0.025 114-115 0.55 0.0 0.0 0.0 0.025 116-117 0.6375 0.0 0.0 0.0 0.025 118-119 0.7124999999999999 0.0 0.0 0.0 0.025 120-121 0.775 0.0 0.0 0.0 0.025 122-123 0.9375 0.0 0.0 0.0 0.025 124-125 1.15 0.0 0.0 0.0 0.025 126-127 1.3 0.0 0.0 0.0 0.025 128-129 1.4125 0.0 0.0 0.0 0.025 130-131 1.6 0.0 0.0 0.0 0.025 132-133 1.975 0.0 0.0 0.0 0.025 134-135 2.1625 0.0 0.0 0.0 0.025 136-137 2.4749999999999996 0.0 0.0 0.0 0.025 138-139 2.7249999999999996 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305861 spots for SRR6958382.sra Written 1305861 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra Read 1305846 spots for SRR6958382.sra Written 1305846 spots for SRR6958382.sra SRR ids: ['SRR6958382.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vdmu1mz1 SRR6958382.sra spots: 26116935 blocks: [[1, 1305846], [1305847, 2611692], [2611693, 3917538], [3917539, 5223384], [5223385, 6529230], [6529231, 7835076], [7835077, 9140922], [9140923, 10446768], [10446769, 11752614], [11752615, 13058460], [13058461, 14364306], [14364307, 15670152], [15670153, 16975998], [16975999, 18281844], [18281845, 19587690], [19587691, 20893536], [20893537, 22199382], [22199383, 23505228], [23505229, 24811074], [24811075, 26116935]] SRR6958382 file size 8828471 SRR6958382 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958382 SRR6958382_1.fastq SRR6958382_2.fastq Input file: SRR6958382_1.fastq Paired file: SRR6958382_2.fastq trimmed: SRR6958382-trimmed-pair1.fastq, SRR6958382-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:40:37 2024 >> started Fri Dec 6 21:41:07 2024 >> done (30.150s) 26116935 read pairs processed; of these: 40337 ( 0.15%) short read pairs filtered out after trimming by size control 39597 ( 0.15%) empty read pairs filtered out after trimming by size control 26037001 (99.69%) read pairs available; of these: 9531235 (36.61%) trimmed read pairs available after processing 16505766 (63.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 6 0.00% 21 6 0.00% 22 2 0.00% 23 8 0.00% 24 8 0.00% 25 6 0.00% 26 6 0.00% 27 8 0.00% 28 8 0.00% 29 4 0.00% 30 5 0.00% 31 7 0.00% 32 9 0.00% 33 8 0.00% 34 11 0.00% 35 8 0.00% 36 7 0.00% 37 10 0.00% 38 9 0.00% 39 12 0.00% 40 10 0.00% 41 13 0.00% 42 20 0.00% 43 20 0.00% 44 18 0.00% 45 19 0.00% 46 26 0.00% 47 30 0.00% 48 23 0.00% 49 33 0.00% 50 38 0.00% 51 38 0.00% 52 41 0.00% 53 55 0.00% 54 42 0.00% 55 62 0.00% 56 59 0.00% 57 66 0.00% 58 84 0.00% 59 90 0.00% 60 115 0.00% 61 124 0.00% 62 127 0.00% 63 142 0.00% 64 163 0.00% 65 165 0.00% 66 196 0.00% 67 215 0.00% 68 252 0.00% 69 268 0.00% 70 320 0.00% 71 319 0.00% 72 409 0.00% 73 458 0.00% 74 553 0.00% 75 620 0.00% 76 647 0.00% 77 729 0.00% 78 790 0.00% 79 932 0.00% 80 1032 0.00% 81 1218 0.00% 82 1460 0.01% 83 1688 0.01% 84 2744 0.01% 85 3346 0.01% 86 3409 0.01% 87 3608 0.01% 88 3855 0.01% 89 4090 0.02% 90 4252 0.02% 91 4484 0.02% 92 4882 0.02% 93 5182 0.02% 94 5419 0.02% 95 5764 0.02% 96 6068 0.02% 97 6559 0.03% 98 6869 0.03% 99 7159 0.03% 100 7848 0.03% 101 8405 0.03% 102 9008 0.03% 103 9652 0.04% 104 10203 0.04% 105 11055 0.04% 106 11717 0.05% 107 12289 0.05% 108 12979 0.05% 109 13652 0.05% 110 14324 0.06% 111 15149 0.06% 112 16459 0.06% 113 17166 0.07% 114 18410 0.07% 115 19708 0.08% 116 20803 0.08% 117 21826 0.08% 118 22793 0.09% 119 23615 0.09% 120 24370 0.09% 121 25864 0.10% 122 27305 0.10% 123 28487 0.11% 124 30072 0.12% 125 31754 0.12% 126 33664 0.13% 127 35132 0.13% 128 36306 0.14% 129 37688 0.14% 130 39699 0.15% 131 42105 0.16% 132 44148 0.17% 133 47682 0.18% 134 49572 0.19% 135 53355 0.20% 136 55958 0.21% 137 59708 0.23% 138 62892 0.24% 139 68115 0.26% 140 73271 0.28% 141 79385 0.30% 142 87884 0.34% 143 97993 0.38% 144 113247 0.43% 145 135902 0.52% 146 172109 0.66% 147 253023 0.97% 148 347484 1.33% 149 768728 2.95% 150 6179695 23.73% 151 16505766 63.39% 26037001 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=19 prefix-density=0.75 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=136.76 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.0 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=4.10 fanout-score-rank=18 prefix-density=0.49 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=44.46 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.0 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958382 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:41:55 Started mapping on | Dec 06 21:41:55 Finished on | Dec 06 21:44:46 Mapping speed, Million of reads per hour | 548.15 Number of input reads | 26037001 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 25263921 Uniquely mapped reads % | 97.03% Average mapped length | 297.81 Number of splices: Total | 29466925 Number of splices: Annotated (sjdb) | 27710890 Number of splices: GT/AG | 29068977 Number of splices: GC/AG | 351429 Number of splices: AT/AC | 10788 Number of splices: Non-canonical | 35731 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.51 Insertion rate per base | 0.01% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 211560 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 14868 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.73% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 576389 576389 576389 N_multimapping 211560 211560 211560 N_noFeature 734871 24586741 913152 N_ambiguous 598976 3340 101281 UnstrandedReadsAssigned:23930074 PositiveStrandReadsAssigned:673840 NegativeStrandReadsAssigned:24249488 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958382 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958382-trimmed-pair1.fastq SRR6958382-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,037,001 reads, 24,237,891 reads pseudoaligned [quant] estimated average fragment length: 269.561 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52973 SRR6958382.ke.tsv 35125 SRR6958382.se.tsv 88098 total ==> SRR6958382.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.954 0 0 PNS24247 1044 775.439 98.7558 7.81747 PNS24249 1928 1659.44 58.7885 2.17462 PNS24246 1044 775.439 98.7558 7.81747 PNS24248 1044 775.439 98.7558 7.81747 PNS24244 1471 1202.44 26.9441 1.37547 PNS24243 293 79.6631 0 0 KQK14069 1603 1334.44 6398.71 294.337 KQK14071 474 220.179 87.7764 24.471 ==> SRR6958382.se.tsv <== BRADI_1g14170v3 7286 BRADI_1g53295v3 237 BRADI_1g59795v3 353 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 307 BRADI_1g74790v3 119 BRADI_1g09890v3 0 BRADI_1g77505v3 285 BRADI_1g48960v3 0 SRR6958382 completed mapping pipeline successfully