Starting /dee2/code/volunteer_pipeline.sh SRR6958383 current disk space = 1548919447552 free memory = 1597109768 SRR6958383 SRAfilesize ba4d57b213656363994b33673c0ab117 SRR6958383.sra SRR6958383.sra file validated SRR6958383 is paired end SRR6958383 is conventional basespace SRR6958383 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958383_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.96125 18.0 18.0 30.0 18.0 32.0 2 21.8195 18.0 18.0 27.0 18.0 30.0 3 27.01625 28.0 25.0 30.0 18.0 31.0 4 28.5125 29.0 27.0 31.0 15.0 33.0 5 31.153 32.0 32.0 33.0 27.0 33.0 6 35.83425 37.0 36.0 38.0 32.0 38.0 7 36.75325 38.0 37.0 38.0 34.0 38.0 8 37.08775 38.0 38.0 38.0 35.0 38.0 9 37.1715 38.0 38.0 38.0 36.0 38.0 10-14 37.357 38.0 38.0 38.0 37.0 38.0 15-19 37.37835 38.0 38.0 38.0 37.0 38.0 20-24 37.4414 38.0 38.0 38.0 37.0 38.0 25-29 37.3609 38.0 38.0 38.0 37.0 38.0 30-34 37.31975 38.0 38.0 38.0 37.0 38.0 35-39 37.17225 38.0 38.0 38.0 36.4 38.0 40-44 37.125 38.0 38.0 38.0 36.2 38.0 45-49 37.089749999999995 38.0 38.0 38.0 36.0 38.0 50-54 37.1419 38.0 38.0 38.0 36.0 38.0 55-59 36.9285 38.0 38.0 38.0 35.6 38.0 60-64 36.84435 38.0 38.0 38.0 35.0 38.0 65-69 36.901250000000005 38.0 38.0 38.0 35.4 38.0 70-74 37.01535 38.0 38.0 38.0 35.6 38.0 75-79 36.902 38.0 38.0 38.0 35.0 38.0 80-84 36.49594999999999 38.0 38.0 38.0 33.8 38.0 85-89 36.47565 38.0 37.8 38.0 34.0 38.0 90-94 36.43675 38.0 37.8 38.0 33.8 38.0 95-99 36.458000000000006 38.0 37.6 38.0 33.8 38.0 100-104 36.23465 38.0 37.2 38.0 33.2 38.0 105-109 36.1623 38.0 37.0 38.0 33.0 38.0 110-114 35.772149999999996 38.0 36.2 38.0 31.0 38.0 115-119 35.76935 38.0 36.2 38.0 31.2 38.0 120-124 35.537850000000006 38.0 36.0 38.0 31.0 38.0 125-129 35.221799999999995 38.0 35.2 38.0 28.6 38.0 130-134 35.12859999999999 38.0 35.0 38.0 28.8 38.0 135-139 34.738600000000005 38.0 35.0 38.0 27.6 38.0 140-144 34.252449999999996 38.0 34.2 38.0 24.4 38.0 145-149 33.42715 38.0 33.8 38.0 20.8 38.0 150-151 28.949875 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 1.0 20 1.0 21 3.0 22 3.0 23 4.0 24 7.0 25 11.0 26 18.0 27 16.0 28 30.0 29 36.0 30 69.0 31 75.0 32 98.0 33 148.0 34 258.0 35 445.0 36 1105.0 37 1670.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.40843621399177 20.318930041152264 5.632716049382716 49.63991769547325 2 11.091637456184277 18.30245368052078 36.429644466700054 34.17626439659489 3 17.125 15.65 24.025 43.2 4 22.225 23.65 21.425 32.7 5 25.444083062296723 28.29622216662497 23.01726294721041 23.2424318238679 6 22.075 32.324999999999996 24.224999999999998 21.375 7 17.224999999999998 24.875 39.6 18.3 8 19.3 24.6 30.175 25.924999999999997 9 18.5 23.150000000000002 33.175 25.174999999999997 10-14 21.105 26.729999999999997 27.195000000000004 24.97 15-19 22.14 25.53 27.04 25.290000000000003 20-24 21.605 26.16 26.790000000000003 25.445 25-29 21.455 26.005 27.295 25.245 30-34 21.815 25.915 26.474999999999998 25.795 35-39 22.175 25.840000000000003 26.505000000000003 25.480000000000004 40-44 21.645 25.825 26.805 25.724999999999998 45-49 22.095000000000002 26.235000000000003 26.555 25.115 50-54 21.365000000000002 26.334999999999997 27.155 25.145 55-59 21.654999999999998 25.759999999999998 27.229999999999997 25.355 60-64 21.575 26.005 26.72 25.7 65-69 22.43 25.380000000000003 26.314999999999998 25.874999999999996 70-74 22.165000000000003 25.72 26.575 25.540000000000003 75-79 21.67 25.119999999999997 27.450000000000003 25.759999999999998 80-84 21.995 25.480000000000004 27.32 25.205 85-89 22.205 25.729999999999997 26.674999999999997 25.39 90-94 22.79 24.955 26.889999999999997 25.365 95-99 22.985 25.56 26.525 24.93 100-104 22.655 25.615 26.705000000000002 25.025 105-109 22.155 25.840000000000003 26.39 25.615 110-114 22.57 25.995 26.165 25.27 115-119 22.345000000000002 25.97 26.14 25.545 120-124 22.6 25.585 26.495 25.319999999999997 125-129 22.275 25.735000000000003 26.455000000000002 25.535000000000004 130-134 22.695 25.795 26.135 25.374999999999996 135-139 23.044999999999998 25.46 25.835 25.66 140-144 22.715 25.505 25.900000000000002 25.88 145-149 23.535 25.590000000000003 25.545 25.330000000000002 150-151 23.686843421710854 25.07503751875938 25.76288144072036 25.475237618809405 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 0.5 27 1.0 28 3.5 29 5.0 30 6.5 31 11.0 32 14.5 33 19.5 34 28.5 35 39.0 36 56.5 37 77.0 38 94.0 39 118.5 40 149.0 41 178.0 42 201.0 43 207.5 44 219.5 45 236.0 46 232.0 47 223.0 48 221.5 49 201.0 50 174.5 51 149.5 52 127.5 53 113.0 54 108.0 55 102.0 56 86.0 57 76.5 58 68.0 59 57.5 60 45.0 61 42.0 62 45.0 63 37.0 64 32.5 65 36.5 66 31.5 67 24.5 68 19.5 69 15.0 70 15.5 71 15.5 72 12.0 73 8.5 74 4.5 75 3.0 76 2.0 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.8000000000000003 2 0.15 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4275653923541248 0.8500000000000001 3 0.05030181086519115 0.15 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.775 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.4874999999999998 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.2249999999999996 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.725 0.0 0.0 0.0 0.0 138-139 2.9749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGGCT 10 0.0063298983 148.6923 1 TCAGGCA 10 0.0068343505 144.975 8 CTGGCTG 10 0.0068343505 144.975 2 GTTGTCG 10 0.0068343505 144.975 145 >>END_MODULE SRR6958383 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958383_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84575 33.0 33.0 34.0 32.0 34.0 2 32.7595 33.0 33.0 34.0 32.0 34.0 3 32.94125 34.0 33.0 34.0 32.0 34.0 4 32.90725 34.0 33.0 34.0 32.0 34.0 5 32.92 34.0 33.0 34.0 32.0 34.0 6 37.04325 38.0 38.0 38.0 36.0 38.0 7 36.91325 38.0 38.0 38.0 36.0 38.0 8 36.926 38.0 38.0 38.0 36.0 38.0 9 36.98075 38.0 38.0 38.0 36.0 38.0 10-14 36.87165 38.0 38.0 38.0 35.8 38.0 15-19 36.7097 38.0 38.0 38.0 35.0 38.0 20-24 36.83465 38.0 38.0 38.0 35.6 38.0 25-29 36.92205 38.0 38.0 38.0 36.0 38.0 30-34 36.9145 38.0 38.0 38.0 36.0 38.0 35-39 36.890350000000005 38.0 38.0 38.0 35.8 38.0 40-44 36.8563 38.0 38.0 38.0 35.8 38.0 45-49 36.765550000000005 38.0 38.0 38.0 35.6 38.0 50-54 36.73245 38.0 38.0 38.0 35.2 38.0 55-59 36.80485 38.0 38.0 38.0 35.2 38.0 60-64 36.69865 38.0 38.0 38.0 35.0 38.0 65-69 36.538900000000005 38.0 38.0 38.0 34.2 38.0 70-74 36.44385 38.0 38.0 38.0 34.0 38.0 75-79 36.21335 38.0 38.0 38.0 33.4 38.0 80-84 36.20455 38.0 38.0 38.0 33.6 38.0 85-89 36.03415 38.0 37.4 38.0 33.0 38.0 90-94 36.04725 38.0 37.6 38.0 33.0 38.0 95-99 35.9711 38.0 37.2 38.0 33.2 38.0 100-104 35.72485 38.0 37.0 38.0 31.6 38.0 105-109 35.62534999999999 38.0 36.8 38.0 31.0 38.0 110-114 35.337 38.0 36.2 38.0 29.2 38.0 115-119 35.26245 38.0 36.0 38.0 29.0 38.0 120-124 35.032300000000006 38.0 35.6 38.0 28.2 38.0 125-129 35.0865 38.0 35.2 38.0 28.4 38.0 130-134 34.5681 38.0 35.0 38.0 25.8 38.0 135-139 34.15035 38.0 34.8 38.0 23.6 38.0 140-144 33.75245 38.0 34.0 38.0 22.6 38.0 145-149 33.204750000000004 38.0 33.6 38.0 19.8 38.0 150-151 27.840249999999997 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 1.0 5 2.0 6 1.0 7 0.0 8 0.0 9 1.0 10 3.0 11 0.0 12 1.0 13 4.0 14 1.0 15 6.0 16 2.0 17 0.0 18 4.0 19 3.0 20 3.0 21 4.0 22 11.0 23 11.0 24 16.0 25 22.0 26 12.0 27 23.0 28 33.0 29 52.0 30 61.0 31 83.0 32 112.0 33 136.0 34 212.0 35 328.0 36 677.0 37 2163.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.883220805201304 19.204801200300075 13.87846961740435 34.03350837709427 2 29.049999999999997 24.075 27.474999999999998 19.400000000000002 3 21.525 26.575 28.749999999999996 23.150000000000002 4 24.7 30.55 22.1 22.650000000000002 5 27.0 31.8 21.85 19.35 6 23.175 35.9 20.9 20.025000000000002 7 23.7 21.375 34.125 20.8 8 23.125 23.925 25.15 27.800000000000004 9 23.05 22.6 28.349999999999998 26.0 10-14 25.34 26.88 24.45 23.330000000000002 15-19 25.085 26.040000000000003 25.095 23.78 20-24 25.4 26.784999999999997 24.765 23.05 25-29 25.679999999999996 26.295 24.725 23.3 30-34 25.15 26.32 25.285000000000004 23.244999999999997 35-39 25.35 25.97 25.669999999999998 23.01 40-44 25.295 26.07 25.3 23.335 45-49 25.31 26.235000000000003 25.505 22.95 50-54 25.645 26.040000000000003 25.155 23.16 55-59 25.369999999999997 25.97 25.435000000000002 23.225 60-64 25.655 26.16 25.169999999999998 23.015 65-69 25.169999999999998 26.119999999999997 25.679999999999996 23.03 70-74 25.979999999999997 25.97 24.905 23.145 75-79 25.52 26.195 25.47 22.814999999999998 80-84 25.645 26.0 25.465 22.89 85-89 25.28 26.484999999999996 25.369999999999997 22.865 90-94 25.669999999999998 26.275 25.255 22.8 95-99 25.419999999999998 26.919999999999998 25.295 22.365 100-104 25.55 26.705000000000002 24.85 22.895 105-109 25.235000000000003 26.66 25.035 23.07 110-114 25.69 25.805 25.81 22.695 115-119 25.929999999999996 26.655 25.085 22.33 120-124 25.679999999999996 26.75 25.169999999999998 22.400000000000002 125-129 25.61 26.46 25.040000000000003 22.89 130-134 25.955000000000002 26.945000000000004 24.654999999999998 22.445 135-139 26.165 25.83 25.629999999999995 22.375 140-144 25.88 26.565 25.53 22.025 145-149 26.245 26.765 25.0 21.990000000000002 150-151 26.384894335375762 26.222333375015634 25.959734900587723 21.433037389020885 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 2.5 27 3.0 28 3.5 29 5.0 30 6.0 31 9.5 32 15.5 33 16.0 34 21.0 35 36.0 36 46.0 37 62.5 38 82.0 39 118.5 40 144.5 41 163.0 42 185.5 43 193.5 44 190.5 45 201.0 46 225.0 47 208.0 48 180.0 49 193.0 50 186.5 51 163.0 52 140.0 53 120.0 54 118.0 55 100.0 56 95.5 57 91.0 58 80.5 59 73.0 60 66.5 61 61.0 62 52.0 63 48.5 64 42.5 65 37.0 66 36.0 67 35.5 68 35.5 69 26.0 70 18.5 71 20.0 72 14.5 73 7.5 74 5.5 75 3.5 76 2.5 77 1.5 78 1.5 79 0.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31972789115646 98.55000000000001 2 0.6298815822625347 1.25 3 0.0 0.0 4 0.05039052658100278 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.025 100-101 0.15 0.0 0.0 0.0 0.025 102-103 0.225 0.0 0.0 0.0 0.025 104-105 0.25 0.0 0.0 0.0 0.025 106-107 0.275 0.0 0.0 0.0 0.025 108-109 0.375 0.0 0.0 0.0 0.025 110-111 0.4875 0.0 0.0 0.0 0.025 112-113 0.55 0.0 0.0 0.0 0.025 114-115 0.6375 0.0 0.0 0.0 0.025 116-117 0.7124999999999999 0.0 0.0 0.0 0.025 118-119 0.775 0.0 0.0 0.0 0.025 120-121 0.9375 0.0 0.0 0.0 0.025 122-123 1.1125 0.0 0.0 0.0 0.025 124-125 1.275 0.0 0.0 0.0 0.025 126-127 1.4625 0.0 0.0 0.0 0.025 128-129 1.6625 0.0 0.0 0.0 0.025 130-131 1.85 0.0 0.0 0.0 0.025 132-133 2.2 0.0 0.0 0.0 0.025 134-135 2.425 0.0 0.0 0.0 0.025 136-137 2.725 0.0 0.0 0.0 0.025 138-139 2.9749999999999996 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109651 spots for SRR6958383.sra Written 1109651 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra Read 1109643 spots for SRR6958383.sra Written 1109643 spots for SRR6958383.sra SRR ids: ['SRR6958383.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m8heeort SRR6958383.sra spots: 22192868 blocks: [[1, 1109643], [1109644, 2219286], [2219287, 3328929], [3328930, 4438572], [4438573, 5548215], [5548216, 6657858], [6657859, 7767501], [7767502, 8877144], [8877145, 9986787], [9986788, 11096430], [11096431, 12206073], [12206074, 13315716], [13315717, 14425359], [14425360, 15535002], [15535003, 16644645], [16644646, 17754288], [17754289, 18863931], [18863932, 19973574], [19973575, 21083217], [21083218, 22192868]] SRR6958383 file size 7498734 SRR6958383 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958383 SRR6958383_1.fastq SRR6958383_2.fastq Input file: SRR6958383_1.fastq Paired file: SRR6958383_2.fastq trimmed: SRR6958383-trimmed-pair1.fastq, SRR6958383-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:37:58 2024 >> started Fri Dec 6 21:38:21 2024 >> done (22.962s) 22192868 read pairs processed; of these: 14037 ( 0.06%) short read pairs filtered out after trimming by size control 11886 ( 0.05%) empty read pairs filtered out after trimming by size control 22166945 (99.88%) read pairs available; of these: 7598873 (34.28%) trimmed read pairs available after processing 14568072 (65.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 3 0.00% 21 6 0.00% 22 6 0.00% 23 4 0.00% 24 3 0.00% 25 9 0.00% 26 6 0.00% 27 5 0.00% 28 13 0.00% 29 9 0.00% 30 5 0.00% 31 6 0.00% 32 6 0.00% 33 11 0.00% 34 7 0.00% 35 8 0.00% 36 11 0.00% 37 10 0.00% 38 12 0.00% 39 10 0.00% 40 14 0.00% 41 9 0.00% 42 16 0.00% 43 14 0.00% 44 14 0.00% 45 12 0.00% 46 16 0.00% 47 20 0.00% 48 25 0.00% 49 25 0.00% 50 19 0.00% 51 31 0.00% 52 33 0.00% 53 29 0.00% 54 46 0.00% 55 32 0.00% 56 47 0.00% 57 52 0.00% 58 55 0.00% 59 64 0.00% 60 84 0.00% 61 89 0.00% 62 94 0.00% 63 101 0.00% 64 103 0.00% 65 135 0.00% 66 136 0.00% 67 138 0.00% 68 168 0.00% 69 193 0.00% 70 224 0.00% 71 273 0.00% 72 299 0.00% 73 358 0.00% 74 363 0.00% 75 420 0.00% 76 447 0.00% 77 511 0.00% 78 561 0.00% 79 635 0.00% 80 686 0.00% 81 794 0.00% 82 946 0.00% 83 1052 0.00% 84 1742 0.01% 85 2181 0.01% 86 2253 0.01% 87 2455 0.01% 88 2471 0.01% 89 2576 0.01% 90 2791 0.01% 91 2946 0.01% 92 3136 0.01% 93 3382 0.02% 94 3680 0.02% 95 4031 0.02% 96 4390 0.02% 97 4690 0.02% 98 5002 0.02% 99 5297 0.02% 100 5678 0.03% 101 6090 0.03% 102 6446 0.03% 103 6818 0.03% 104 7500 0.03% 105 7795 0.04% 106 8606 0.04% 107 9180 0.04% 108 9776 0.04% 109 10359 0.05% 110 10840 0.05% 111 11370 0.05% 112 12325 0.06% 113 12800 0.06% 114 13684 0.06% 115 14868 0.07% 116 15890 0.07% 117 16545 0.07% 118 17421 0.08% 119 18512 0.08% 120 19405 0.09% 121 20422 0.09% 122 21585 0.10% 123 22784 0.10% 124 24073 0.11% 125 25541 0.12% 126 26618 0.12% 127 28567 0.13% 128 29901 0.13% 129 31891 0.14% 130 33481 0.15% 131 35337 0.16% 132 37185 0.17% 133 39767 0.18% 134 42717 0.19% 135 45146 0.20% 136 48570 0.22% 137 51891 0.23% 138 55270 0.25% 139 60961 0.28% 140 66036 0.30% 141 71987 0.32% 142 81417 0.37% 143 91716 0.41% 144 108276 0.49% 145 130467 0.59% 146 169666 0.77% 147 228188 1.03% 148 361447 1.63% 149 753935 3.40% 150 4549559 20.52% 151 14568072 65.72% 22166945 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=23 prefix-density=0.49 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=39.79 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=26 prefix-density=0.42 prefix-fanout=2.9 sequence=CTTCGACAACACCATGGGAGGCTTTTACATCGCCCCGGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGCGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACCGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=47.51 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=9.7 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR6958383 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:39:06 Started mapping on | Dec 06 21:39:07 Finished on | Dec 06 21:40:53 Mapping speed, Million of reads per hour | 752.84 Number of input reads | 22166945 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21520127 Uniquely mapped reads % | 97.08% Average mapped length | 298.06 Number of splices: Total | 26104181 Number of splices: Annotated (sjdb) | 24590961 Number of splices: GT/AG | 25754859 Number of splices: GC/AG | 309542 Number of splices: AT/AC | 10564 Number of splices: Non-canonical | 29216 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269694 % of reads mapped to multiple loci | 1.22% Number of reads mapped to too many loci | 31586 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.57% % of reads unmapped: other | 0.98% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 385258 385258 385258 N_multimapping 269694 269694 269694 N_noFeature 798108 20914682 976016 N_ambiguous 518137 2808 92143 UnstrandedReadsAssigned:20203882 PositiveStrandReadsAssigned:602637 NegativeStrandReadsAssigned:20451968 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958383 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958383-trimmed-pair1.fastq SRR6958383-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,166,945 reads, 20,499,000 reads pseudoaligned [quant] estimated average fragment length: 272.438 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52973 SRR6958383.ke.tsv 35125 SRR6958383.se.tsv 88098 total ==> SRR6958383.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.004 0 0 PNS24247 1044 772.562 87.101 8.18049 PNS24249 1928 1656.56 43.3345 1.89808 PNS24246 1044 772.562 87.101 8.18049 PNS24248 1044 772.562 87.101 8.18049 PNS24244 1471 1199.56 34.3624 2.0785 PNS24243 293 77.6652 0 0 KQK14069 1603 1331.56 4901.11 267.068 KQK14071 474 217.534 75.7851 25.2782 ==> SRR6958383.se.tsv <== BRADI_1g14170v3 5589 BRADI_1g53295v3 259 BRADI_1g59795v3 376 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 328 BRADI_1g74790v3 84 BRADI_1g09890v3 0 BRADI_1g77505v3 343 BRADI_1g48960v3 1 SRR6958383 completed mapping pipeline successfully