Starting /dee2/code/volunteer_pipeline.sh SRR6958384 current disk space = 1548939182080 free memory = 1603567912 SRR6958384 SRAfilesize 792fe08bb2b5a9ca233ae653cb0b6c5a SRR6958384.sra SRR6958384.sra file validated SRR6958384 is paired end SRR6958384 is conventional basespace SRR6958384 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958384_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.357 33.0 32.0 33.0 18.0 34.0 2 31.441 33.0 31.0 33.0 27.0 34.0 3 31.28275 33.0 31.0 33.0 27.0 34.0 4 31.8265 33.0 32.0 33.0 30.0 34.0 5 32.2475 33.0 32.0 33.0 31.0 34.0 6 36.24875 38.0 37.0 38.0 33.0 38.0 7 36.1135 38.0 37.0 38.0 33.0 38.0 8 36.915 38.0 38.0 38.0 35.0 38.0 9 37.10075 38.0 38.0 38.0 36.0 38.0 10-14 37.1675 38.0 38.0 38.0 36.2 38.0 15-19 37.34585 38.0 38.0 38.0 37.0 38.0 20-24 37.3068 38.0 38.0 38.0 37.0 38.0 25-29 37.1639 38.0 38.0 38.0 36.4 38.0 30-34 37.003150000000005 38.0 38.0 38.0 35.6 38.0 35-39 36.9668 38.0 38.0 38.0 35.8 38.0 40-44 36.92435 38.0 38.0 38.0 35.6 38.0 45-49 36.80505 38.0 38.0 38.0 35.0 38.0 50-54 36.6139 38.0 38.0 38.0 34.2 38.0 55-59 36.53225 38.0 38.0 38.0 33.8 38.0 60-64 36.7606 38.0 38.0 38.0 34.6 38.0 65-69 36.765499999999996 38.0 38.0 38.0 34.8 38.0 70-74 36.379149999999996 38.0 37.6 38.0 33.6 38.0 75-79 36.126999999999995 38.0 37.2 38.0 32.8 38.0 80-84 36.1188 38.0 37.0 38.0 32.6 38.0 85-89 36.3866 38.0 37.6 38.0 33.8 38.0 90-94 36.1028 38.0 37.0 38.0 32.4 38.0 95-99 35.77265 38.0 36.6 38.0 31.2 38.0 100-104 35.118399999999994 38.0 35.8 38.0 27.6 38.0 105-109 34.74155 38.0 35.0 38.0 26.0 38.0 110-114 34.967299999999994 38.0 35.0 38.0 27.6 38.0 115-119 35.015049999999995 38.0 35.0 38.0 28.2 38.0 120-124 34.69075 38.0 35.0 38.0 26.4 38.0 125-129 34.701499999999996 38.0 35.0 38.0 27.2 38.0 130-134 34.07875 38.0 34.2 38.0 23.6 38.0 135-139 33.6147 38.0 34.0 38.0 21.2 38.0 140-144 32.587149999999994 37.2 32.8 38.0 14.4 38.0 145-149 30.95335 36.0 30.2 38.0 10.8 38.0 150-151 26.548625 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 3.0 18 7.0 19 4.0 20 5.0 21 5.0 22 4.0 23 7.0 24 12.0 25 20.0 26 40.0 27 26.0 28 49.0 29 54.0 30 88.0 31 101.0 32 131.0 33 200.0 34 251.0 35 455.0 36 962.0 37 1570.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.81719260065289 10.2829162132753 6.556039173014145 36.34385201305767 2 24.075 11.0 34.975 29.95 3 20.925 14.774999999999999 24.85 39.45 4 26.025 22.400000000000002 22.400000000000002 29.175 5 25.55 26.700000000000003 24.15 23.599999999999998 6 22.875 31.25 23.7 22.175 7 18.575 24.625 38.475 18.325 8 21.65 23.150000000000002 28.749999999999996 26.450000000000003 9 20.3 21.275 32.7 25.724999999999998 10-14 23.52 26.295 26.009999999999998 24.175 15-19 22.955000000000002 25.11 26.484999999999996 25.45 20-24 23.080000000000002 25.314999999999998 26.119999999999997 25.485000000000003 25-29 23.474999999999998 25.16 26.119999999999997 25.245 30-34 23.06 24.959999999999997 25.814999999999998 26.165 35-39 23.21 24.705 25.900000000000002 26.185000000000002 40-44 23.27 24.745 25.974999999999998 26.009999999999998 45-49 22.725 25.245 25.96 26.07 50-54 23.16 25.11 25.715 26.015 55-59 22.965 25.055 25.615 26.365 60-64 23.35 24.85 25.619999999999997 26.179999999999996 65-69 23.56 24.985 25.480000000000004 25.974999999999998 70-74 24.065 24.485 25.66 25.790000000000003 75-79 23.565 24.94 25.77 25.724999999999998 80-84 23.169999999999998 24.95 25.615 26.265 85-89 23.41 24.959999999999997 25.465 26.165 90-94 23.5 24.83 25.779999999999998 25.89 95-99 23.57 24.035 26.150000000000002 26.245 100-104 23.375 25.115 26.055 25.455 105-109 23.93 24.21 25.790000000000003 26.07 110-114 23.435 24.85 26.41 25.305 115-119 24.05 24.465 25.624999999999996 25.86 120-124 23.43 24.474999999999998 25.35 26.745 125-129 23.84 24.715 25.380000000000003 26.064999999999998 130-134 23.849999999999998 24.59 25.64 25.919999999999998 135-139 24.09 24.58 25.345000000000002 25.985000000000003 140-144 23.830000000000002 24.425 25.735000000000003 26.009999999999998 145-149 24.47 24.18 25.6 25.75 150-151 23.95 25.0 25.5625 25.4875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 1.5 28 2.0 29 3.0 30 5.5 31 8.0 32 10.5 33 15.5 34 18.5 35 25.5 36 38.5 37 57.5 38 75.0 39 93.5 40 117.5 41 142.0 42 173.5 43 197.0 44 197.0 45 203.5 46 203.0 47 197.0 48 203.5 49 199.5 50 177.5 51 146.0 52 137.5 53 134.5 54 123.0 55 108.0 56 90.5 57 86.0 58 85.5 59 78.0 60 79.0 61 80.0 62 66.0 63 56.0 64 53.0 65 49.5 66 49.0 67 41.5 68 34.0 69 31.0 70 25.0 71 25.5 72 19.0 73 11.0 74 9.5 75 5.5 76 4.0 77 2.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.6559031281533804 1.3 3 0.12613521695257315 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.2875 0.0 0.0 0.0 0.0 130-131 1.45 0.0 0.0 0.0 0.0 132-133 1.6625 0.0 0.0 0.0 0.0 134-135 1.8625 0.0 0.0 0.0 0.0 136-137 2.0999999999999996 0.0 0.0 0.0 0.0 138-139 2.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCACAG 10 0.006841402 144.925 4 >>END_MODULE SRR6958384 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958384_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.15725 33.0 33.0 34.0 30.0 34.0 2 32.1965 33.0 33.0 34.0 30.0 34.0 3 32.24575 33.0 33.0 34.0 31.0 34.0 4 32.094 33.0 33.0 34.0 31.0 34.0 5 32.071 33.0 33.0 34.0 30.0 34.0 6 36.07325 38.0 38.0 38.0 33.0 38.0 7 35.47175 38.0 37.0 38.0 29.0 38.0 8 36.04125 38.0 38.0 38.0 31.0 38.0 9 35.827 38.0 38.0 38.0 31.0 38.0 10-14 36.11895 38.0 38.0 38.0 32.8 38.0 15-19 36.30805 38.0 38.0 38.0 33.8 38.0 20-24 36.3233 38.0 38.0 38.0 33.8 38.0 25-29 36.3797 38.0 38.0 38.0 34.2 38.0 30-34 36.47805 38.0 38.0 38.0 34.8 38.0 35-39 36.21495 38.0 38.0 38.0 33.8 38.0 40-44 36.14 38.0 38.0 38.0 33.4 38.0 45-49 35.90995 38.0 37.8 38.0 32.4 38.0 50-54 36.05050000000001 38.0 38.0 38.0 33.0 38.0 55-59 36.032500000000006 38.0 38.0 38.0 33.4 38.0 60-64 35.79010000000001 38.0 37.4 38.0 31.4 38.0 65-69 35.7701 38.0 37.2 38.0 31.0 38.0 70-74 35.68730000000001 38.0 37.2 38.0 31.4 38.0 75-79 35.599900000000005 38.0 37.0 38.0 30.6 38.0 80-84 35.59905 38.0 37.0 38.0 31.0 38.0 85-89 35.6229 38.0 37.0 38.0 31.6 38.0 90-94 35.2189 38.0 36.6 38.0 29.0 38.0 95-99 34.77145 38.0 35.8 38.0 27.0 38.0 100-104 34.326499999999996 38.0 35.0 38.0 24.6 38.0 105-109 34.2672 38.0 34.8 38.0 23.2 38.0 110-114 33.8338 38.0 34.0 38.0 21.0 38.0 115-119 33.99395 38.0 34.6 38.0 22.2 38.0 120-124 33.74294999999999 38.0 34.4 38.0 21.8 38.0 125-129 33.21525 38.0 34.0 38.0 15.0 38.0 130-134 32.475049999999996 38.0 33.0 38.0 14.2 38.0 135-139 32.278650000000006 37.6 31.4 38.0 13.6 38.0 140-144 31.277350000000002 36.4 30.4 38.0 13.0 38.0 145-149 30.10145 36.0 30.4 38.0 6.4 38.0 150-151 24.44625 32.0 13.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 13.0 4 7.0 5 1.0 6 5.0 7 2.0 8 0.0 9 2.0 10 1.0 11 2.0 12 3.0 13 7.0 14 3.0 15 9.0 16 9.0 17 11.0 18 8.0 19 3.0 20 10.0 21 10.0 22 17.0 23 27.0 24 21.0 25 27.0 26 33.0 27 41.0 28 56.0 29 94.0 30 86.0 31 102.0 32 154.0 33 164.0 34 253.0 35 420.0 36 797.0 37 1584.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.900000000000006 20.05 10.225 29.825000000000003 2 30.25 24.45 25.05 20.25 3 21.775 25.85 29.049999999999997 23.325000000000003 4 26.174999999999997 31.125000000000004 20.125 22.575 5 27.275 33.175 19.6 19.950000000000003 6 23.547094188376754 34.66933867735471 19.864729458917836 21.9188376753507 7 22.82064128256513 20.140280561122246 33.26653306613226 23.772545090180362 8 23.772545090180362 23.49699398797595 24.749498997995993 27.980961923847698 9 23.879849812265334 23.779724655819777 25.857321652065078 26.48310387984981 10-14 26.2132518655782 26.46366504732809 22.677417739269796 24.645665347823908 15-19 25.4382450165281 25.773815486326757 24.151056796554144 24.636882700591002 20-24 25.514547548700484 25.66978817166608 24.237568230757674 24.578096048875757 25-29 25.211599138578656 25.902739520208346 23.68908699353934 25.19657434767366 30-34 25.689542974420583 25.344145767632774 24.23787355458778 24.728437703358864 35-39 25.42304996495444 25.63332332031641 24.176429358165617 24.767197356563532 40-44 25.892365456821025 25.151439299123908 24.340425531914896 24.615769712140175 45-49 25.78238445746332 25.547043212658355 24.044865054328778 24.625707275549548 50-54 25.716002403364712 25.705988383737232 24.203885439615462 24.374123773282598 55-59 25.88977323922511 25.213996095509838 24.3229714171297 24.573259248135358 60-64 25.64333633723841 25.428056473415438 24.84229498347852 24.086312205867628 65-69 26.37192068896455 25.025035049068695 24.399158822351293 24.203885439615462 70-74 26.716716716716714 25.195195195195197 24.47947947947948 23.60860860860861 75-79 25.765765765765764 25.33033033033033 24.734734734734733 24.16916916916917 80-84 25.998398558702835 24.81233109798819 24.4920428385547 24.69722750475428 85-89 25.927409261576972 25.50688360450563 24.490613266583228 24.075093867334168 90-94 25.963559915907496 25.638202022224448 24.12653919311242 24.27169886875563 95-99 25.80855111645139 26.27916291178532 24.111344748172627 23.80094122359067 100-104 25.78852508260739 25.30289376189046 24.637028136577552 24.271553018924603 105-109 26.505179920924878 24.958710775236476 24.728492067464092 23.807617236374558 110-114 26.152690863579476 26.09261576971214 24.09511889862328 23.659574468085108 115-119 26.715723081543775 25.789658106822845 24.247885067828 23.246733743805375 120-124 26.76176176176176 25.975975975975974 24.294294294294293 22.96796796796797 125-129 26.01711454736526 25.07631486763749 25.49166791773007 23.414902667267175 130-134 26.75809600080084 25.681966064367582 24.445667951348916 23.114269983482657 135-139 25.970776621297038 26.065852682145717 24.82485988791033 23.138510808646917 140-144 26.908454227113555 25.85792896448224 24.4072036018009 22.826413206603302 145-149 27.393284291647902 25.746884852124307 23.85527698543762 23.004553870790172 150-151 27.358018513885412 25.581686264698522 24.568426319739807 22.491868901676256 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.5 4 2.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 1.0 26 1.0 27 1.5 28 1.5 29 1.5 30 2.0 31 6.0 32 12.5 33 11.5 34 13.5 35 26.5 36 39.5 37 54.5 38 65.5 39 72.5 40 108.5 41 157.0 42 165.0 43 162.0 44 172.5 45 186.0 46 196.0 47 198.0 48 191.0 49 186.5 50 166.0 51 144.0 52 147.0 53 140.5 54 115.0 55 99.0 56 97.5 57 96.0 58 102.0 59 99.0 60 85.5 61 74.5 62 75.0 63 75.5 64 66.5 65 59.5 66 55.0 67 50.0 68 44.0 69 38.0 70 34.5 71 29.0 72 23.0 73 17.0 74 9.5 75 5.5 76 4.0 77 2.5 78 1.5 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.2 7 0.2 8 0.2 9 0.125 10-14 0.165 15-19 0.16999999999999998 20-24 0.155 25-29 0.165 30-34 0.11499999999999999 35-39 0.13 40-44 0.125 45-49 0.145 50-54 0.13999999999999999 55-59 0.11499999999999999 60-64 0.13 65-69 0.13999999999999999 70-74 0.1 75-79 0.1 80-84 0.09 85-89 0.125 90-94 0.11 95-99 0.13 100-104 0.13 105-109 0.095 110-114 0.125 115-119 0.11499999999999999 120-124 0.1 125-129 0.08499999999999999 130-134 0.105 135-139 0.08 140-144 0.05 145-149 0.08499999999999999 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7029501525941 97.02499999999999 2 1.093591047812818 2.15 3 0.0762970498474059 0.22499999999999998 4 0.10172939979654119 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025432349949135298 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.1375000000000002 0.0 0.0 0.0 0.0 128-129 1.3375 0.0 0.0 0.0 0.0 130-131 1.5125 0.0 0.0 0.0 0.0 132-133 1.7374999999999998 0.0 0.0 0.0 0.0 134-135 1.9375 0.0 0.0 0.0 0.0 136-137 2.2 0.0 0.0 0.0 0.0 138-139 2.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGGAG 10 0.006830828 145.0 1 >>END_MODULE Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062962 spots for SRR6958384.sra Written 1062962 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra Read 1062944 spots for SRR6958384.sra Written 1062944 spots for SRR6958384.sra SRR ids: ['SRR6958384.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f3bix1oo SRR6958384.sra spots: 21258898 blocks: [[1, 1062944], [1062945, 2125888], [2125889, 3188832], [3188833, 4251776], [4251777, 5314720], [5314721, 6377664], [6377665, 7440608], [7440609, 8503552], [8503553, 9566496], [9566497, 10629440], [10629441, 11692384], [11692385, 12755328], [12755329, 13818272], [13818273, 14881216], [14881217, 15944160], [15944161, 17007104], [17007105, 18070048], [18070049, 19132992], [19132993, 20195936], [20195937, 21258898]] SRR6958384 file size 7182242 SRR6958384 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958384 SRR6958384_1.fastq SRR6958384_2.fastq Input file: SRR6958384_1.fastq Paired file: SRR6958384_2.fastq trimmed: SRR6958384-trimmed-pair1.fastq, SRR6958384-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:39:19 2024 >> started Fri Dec 6 21:39:46 2024 >> done (26.572s) 21258898 read pairs processed; of these: 42232 ( 0.20%) short read pairs filtered out after trimming by size control 28609 ( 0.13%) empty read pairs filtered out after trimming by size control 21188057 (99.67%) read pairs available; of these: 9029266 (42.61%) trimmed read pairs available after processing 12158791 (57.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 4 0.00% 23 4 0.00% 24 6 0.00% 25 4 0.00% 26 5 0.00% 27 5 0.00% 28 10 0.00% 29 10 0.00% 30 11 0.00% 31 12 0.00% 32 13 0.00% 33 11 0.00% 34 9 0.00% 35 12 0.00% 36 22 0.00% 37 20 0.00% 38 14 0.00% 39 11 0.00% 40 18 0.00% 41 19 0.00% 42 24 0.00% 43 26 0.00% 44 24 0.00% 45 24 0.00% 46 24 0.00% 47 33 0.00% 48 36 0.00% 49 52 0.00% 50 35 0.00% 51 66 0.00% 52 70 0.00% 53 60 0.00% 54 80 0.00% 55 81 0.00% 56 95 0.00% 57 93 0.00% 58 116 0.00% 59 115 0.00% 60 132 0.00% 61 144 0.00% 62 170 0.00% 63 212 0.00% 64 178 0.00% 65 190 0.00% 66 252 0.00% 67 271 0.00% 68 282 0.00% 69 321 0.00% 70 383 0.00% 71 417 0.00% 72 474 0.00% 73 544 0.00% 74 538 0.00% 75 658 0.00% 76 690 0.00% 77 790 0.00% 78 881 0.00% 79 951 0.00% 80 1105 0.01% 81 1247 0.01% 82 1564 0.01% 83 1818 0.01% 84 3459 0.02% 85 4359 0.02% 86 4008 0.02% 87 4146 0.02% 88 4304 0.02% 89 4210 0.02% 90 4448 0.02% 91 5171 0.02% 92 4845 0.02% 93 5374 0.03% 94 5637 0.03% 95 5938 0.03% 96 6128 0.03% 97 6792 0.03% 98 7096 0.03% 99 7616 0.04% 100 7996 0.04% 101 8412 0.04% 102 9091 0.04% 103 9865 0.05% 104 10243 0.05% 105 10811 0.05% 106 11598 0.05% 107 12191 0.06% 108 13083 0.06% 109 13857 0.07% 110 14458 0.07% 111 15281 0.07% 112 16214 0.08% 113 17177 0.08% 114 18423 0.09% 115 19888 0.09% 116 21201 0.10% 117 22016 0.10% 118 23266 0.11% 119 24258 0.11% 120 25526 0.12% 121 26657 0.13% 122 27725 0.13% 123 29728 0.14% 124 31949 0.15% 125 34057 0.16% 126 35842 0.17% 127 37882 0.18% 128 39491 0.19% 129 42106 0.20% 130 44636 0.21% 131 47326 0.22% 132 50042 0.24% 133 53735 0.25% 134 56637 0.27% 135 60119 0.28% 136 64832 0.31% 137 69625 0.33% 138 74367 0.35% 139 80974 0.38% 140 88212 0.42% 141 96718 0.46% 142 108384 0.51% 143 122431 0.58% 144 142969 0.67% 145 174736 0.82% 146 221440 1.05% 147 304939 1.44% 148 472317 2.23% 149 962151 4.54% 150 5003357 23.61% 151 12158791 57.39% 21188057 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=18 prefix-density=0.93 prefix-fanout=3.1 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=45.91 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=21 prefix-density=0.49 prefix-fanout=3.0 sequence=CTTCGACAACACCATGGGAGGCTTTTACATCGCCCCGGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGCGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACCGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.14 sequence-density-rank=17 fanout-score=54.79 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=11.0 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR6958384 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:40:33 Started mapping on | Dec 06 21:40:34 Finished on | Dec 06 21:42:21 Mapping speed, Million of reads per hour | 712.87 Number of input reads | 21188057 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20690419 Uniquely mapped reads % | 97.65% Average mapped length | 296.64 Number of splices: Total | 24228455 Number of splices: Annotated (sjdb) | 22784007 Number of splices: GT/AG | 23912271 Number of splices: GC/AG | 279633 Number of splices: AT/AC | 10034 Number of splices: Non-canonical | 26517 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 180480 % of reads mapped to multiple loci | 0.85% Number of reads mapped to too many loci | 9061 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.17% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 339301 339301 339301 N_multimapping 180480 180480 180480 N_noFeature 553079 20156472 678788 N_ambiguous 484473 2827 77027 UnstrandedReadsAssigned:19652867 PositiveStrandReadsAssigned:531120 NegativeStrandReadsAssigned:19934604 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958384 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958384-trimmed-pair1.fastq SRR6958384-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,188,057 reads, 19,950,695 reads pseudoaligned [quant] estimated average fragment length: 272.338 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 SRR6958384.ke.tsv 35125 SRR6958384.se.tsv 88098 total ==> SRR6958384.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.137 26.5983 2.92492 PNS24247 1044 772.662 64.9141 6.14498 PNS24249 1928 1656.66 66.5473 2.93811 PNS24246 1044 772.662 64.9141 6.14498 PNS24248 1044 772.662 64.9141 6.14498 PNS24244 1471 1199.66 18.1122 1.10429 PNS24243 293 79.7851 0 0 KQK14069 1603 1331.66 1980.96 108.806 KQK14071 474 218.836 17.7276 5.9252 ==> SRR6958384.se.tsv <== BRADI_1g14170v3 2166 BRADI_1g53295v3 152 BRADI_1g59795v3 344 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 526 BRADI_1g74790v3 82 BRADI_1g09890v3 3 BRADI_1g77505v3 311 BRADI_1g48960v3 0 SRR6958384 completed mapping pipeline successfully