Starting /dee2/code/volunteer_pipeline.sh SRR6958385 current disk space = 1548929363968 free memory = 1600101672 SRR6958385 SRAfilesize 6dc9426028405fe148614206a3210f4b SRR6958385.sra SRR6958385.sra file validated SRR6958385 is paired end SRR6958385 is conventional basespace SRR6958385 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958385_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.33325 33.0 31.0 34.0 25.0 34.0 2 32.8755 33.0 33.0 34.0 31.0 34.0 3 33.203 34.0 33.0 34.0 33.0 34.0 4 32.8655 33.0 33.0 34.0 31.0 34.0 5 32.8555 33.0 33.0 34.0 32.0 34.0 6 37.05575 38.0 37.0 38.0 36.0 38.0 7 37.057 38.0 38.0 38.0 35.0 38.0 8 37.44925 38.0 38.0 38.0 37.0 38.0 9 37.58775 38.0 38.0 38.0 38.0 38.0 10-14 37.5869 38.0 38.0 38.0 38.0 38.0 15-19 37.6169 38.0 38.0 38.0 38.0 38.0 20-24 37.60335 38.0 38.0 38.0 38.0 38.0 25-29 37.586749999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.59845 38.0 38.0 38.0 38.0 38.0 35-39 37.543899999999994 38.0 38.0 38.0 37.8 38.0 40-44 37.5406 38.0 38.0 38.0 37.8 38.0 45-49 37.52775 38.0 38.0 38.0 37.6 38.0 50-54 37.50145 38.0 38.0 38.0 37.2 38.0 55-59 37.09734999999999 38.0 38.0 38.0 37.0 38.0 60-64 36.5828 38.0 38.0 38.0 36.0 38.0 65-69 37.25485 38.0 38.0 38.0 36.6 38.0 70-74 37.31815 38.0 38.0 38.0 37.0 38.0 75-79 37.29215000000001 38.0 38.0 38.0 36.4 38.0 80-84 37.21475 38.0 38.0 38.0 36.0 38.0 85-89 37.08315 38.0 38.0 38.0 36.0 38.0 90-94 37.067 38.0 38.0 38.0 36.0 38.0 95-99 36.981849999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.761700000000005 38.0 38.0 38.0 34.8 38.0 105-109 36.594350000000006 38.0 38.0 38.0 34.2 38.0 110-114 36.572649999999996 38.0 38.0 38.0 34.2 38.0 115-119 36.33635 38.0 38.0 38.0 34.0 38.0 120-124 35.974 38.0 37.0 38.0 32.2 38.0 125-129 35.86005 38.0 36.8 38.0 31.4 38.0 130-134 35.54744999999999 38.0 36.4 38.0 31.0 38.0 135-139 34.885299999999994 38.0 35.8 38.0 29.0 38.0 140-144 34.43365 38.0 35.0 38.0 27.2 38.0 145-149 34.118700000000004 38.0 34.8 38.0 26.2 38.0 150-151 28.996375 34.5 17.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 0.0 20 2.0 21 4.0 22 4.0 23 9.0 24 12.0 25 10.0 26 8.0 27 21.0 28 22.0 29 23.0 30 31.0 31 32.0 32 61.0 33 90.0 34 143.0 35 282.0 36 689.0 37 2555.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.65 10.674999999999999 10.075000000000001 36.6 2 23.65 12.2 32.95 31.2 3 20.575 16.475 26.375 36.575 4 25.674999999999997 22.525000000000002 22.925 28.875 5 27.400000000000002 26.674999999999997 23.775 22.15 6 25.324999999999996 30.475 23.474999999999998 20.724999999999998 7 17.2 23.5 38.4 20.9 8 21.65 23.5 28.875 25.974999999999998 9 20.849999999999998 21.5 32.300000000000004 25.35 10-14 23.409363745498197 25.875350140056025 26.120448179271712 24.59483793517407 15-19 23.455000000000002 24.47 25.89 26.185000000000002 20-24 23.275000000000002 25.465 25.4 25.86 25-29 23.669999999999998 24.88 25.69 25.759999999999998 30-34 23.294999999999998 24.845 25.619999999999997 26.240000000000002 35-39 23.75 24.66 25.385 26.205000000000002 40-44 23.755000000000003 24.83 25.395 26.02 45-49 23.54 25.045 25.615 25.8 50-54 23.849999999999998 25.124999999999996 25.61 25.415 55-59 23.844098220138154 25.08949730247567 25.265970856653052 25.80043362073312 60-64 23.58668501809655 25.192435132792983 24.932456542794515 26.28842330631595 65-69 23.93 25.19 25.15 25.729999999999997 70-74 23.915 24.834999999999997 25.97 25.28 75-79 23.985 23.925 25.575 26.515 80-84 24.224999999999998 24.98 24.98 25.814999999999998 85-89 23.375 24.23 25.569999999999997 26.825 90-94 24.01 24.395 25.6 25.995 95-99 23.71 24.375 25.46 26.455000000000002 100-104 24.59 24.595 25.115 25.7 105-109 23.745 24.235 25.94 26.08 110-114 24.145 24.154999999999998 25.345000000000002 26.355 115-119 24.21 24.01 25.259999999999998 26.52 120-124 24.404999999999998 24.26 25.445 25.89 125-129 24.25 24.169999999999998 25.240000000000002 26.340000000000003 130-134 24.585 24.955 24.785 25.674999999999997 135-139 24.245 24.635 25.155 25.965 140-144 24.044999999999998 24.425 24.93 26.6 145-149 24.235 24.81 25.47 25.485000000000003 150-151 24.5375 24.4125 25.087500000000002 25.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.5 27 3.5 28 3.0 29 2.0 30 2.0 31 4.5 32 9.0 33 14.0 34 26.0 35 32.0 36 35.5 37 49.0 38 72.0 39 97.0 40 124.0 41 147.0 42 164.5 43 185.5 44 192.5 45 193.5 46 196.0 47 190.0 48 185.0 49 177.5 50 158.0 51 143.5 52 142.0 53 140.0 54 123.5 55 106.5 56 100.5 57 100.5 58 90.5 59 85.0 60 83.5 61 72.5 62 70.5 63 69.0 64 64.5 65 54.0 66 45.5 67 41.5 68 41.5 69 43.0 70 33.0 71 25.5 72 21.0 73 12.0 74 7.5 75 6.5 76 3.5 77 2.0 78 3.0 79 2.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.04 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.835 60-64 1.915 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39577039274926 98.7 2 0.5287009063444109 1.05 3 0.050352467270896276 0.15 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.48750000000000004 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.3375 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.6625 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.4000000000000004 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCGTC 10 0.006830828 145.0 2 >>END_MODULE SRR6958385 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958385_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01425 33.0 33.0 34.0 32.0 34.0 2 33.123 34.0 33.0 34.0 33.0 34.0 3 33.12075 34.0 33.0 34.0 33.0 34.0 4 33.061 34.0 33.0 34.0 33.0 34.0 5 33.01875 34.0 33.0 34.0 33.0 34.0 6 37.20075 38.0 38.0 38.0 37.0 38.0 7 37.224 38.0 38.0 38.0 37.0 38.0 8 37.13125 38.0 38.0 38.0 37.0 38.0 9 37.1685 38.0 38.0 38.0 37.0 38.0 10-14 37.173249999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.15255 38.0 38.0 38.0 37.0 38.0 20-24 37.117200000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.036950000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.03665 38.0 38.0 38.0 36.8 38.0 35-39 37.0221 38.0 38.0 38.0 37.0 38.0 40-44 36.99455 38.0 38.0 38.0 36.8 38.0 45-49 36.98185 38.0 38.0 38.0 36.4 38.0 50-54 36.898399999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.84305 38.0 38.0 38.0 36.0 38.0 60-64 36.799 38.0 38.0 38.0 36.0 38.0 65-69 36.761399999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.747699999999995 38.0 38.0 38.0 35.8 38.0 75-79 36.783 38.0 38.0 38.0 36.0 38.0 80-84 36.685249999999996 38.0 38.0 38.0 35.4 38.0 85-89 36.534400000000005 38.0 38.0 38.0 34.8 38.0 90-94 36.5046 38.0 38.0 38.0 34.8 38.0 95-99 36.309349999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.28445000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.1763 38.0 38.0 38.0 34.0 38.0 110-114 35.885299999999994 38.0 38.0 38.0 33.2 38.0 115-119 35.814800000000005 38.0 38.0 38.0 33.0 38.0 120-124 35.826299999999996 38.0 37.6 38.0 33.0 38.0 125-129 35.70485 38.0 37.0 38.0 32.6 38.0 130-134 35.597950000000004 38.0 36.6 38.0 32.0 38.0 135-139 35.23625 38.0 36.0 38.0 30.6 38.0 140-144 34.856899999999996 38.0 36.0 38.0 29.6 38.0 145-149 34.2766 38.0 35.2 38.0 27.4 38.0 150-151 30.25875 35.5 28.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 10.0 4 2.0 5 4.0 6 0.0 7 2.0 8 2.0 9 2.0 10 3.0 11 1.0 12 0.0 13 2.0 14 2.0 15 4.0 16 3.0 17 1.0 18 2.0 19 1.0 20 2.0 21 4.0 22 8.0 23 8.0 24 10.0 25 12.0 26 17.0 27 17.0 28 23.0 29 31.0 30 31.0 31 52.0 32 67.0 33 71.0 34 132.0 35 204.0 36 500.0 37 2760.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.025 18.8 12.3 28.875 2 29.48237059264816 22.85571392848212 25.85646411602901 21.80545136284071 3 23.217413059794847 25.8443832874656 27.920940705529144 23.01726294721041 4 25.681420355088775 29.782445611402853 20.155038759689923 24.381095273818453 5 27.55 32.800000000000004 18.825 20.825 6 24.09819639278557 35.22044088176352 19.964929859719437 20.716432865731463 7 22.913010779644022 20.030082727500627 33.141138129857104 23.915768362998246 8 24.95615134051616 23.05186670007517 22.92658481583563 29.06539714357304 9 25.425851703406817 22.995991983967937 26.052104208416832 25.526052104208418 10-14 25.726744186046513 25.761828388131512 22.478949478748998 26.032477947072973 15-19 26.248495788206977 25.17549137585239 23.465703971119133 25.1103088648215 20-24 25.995187004913266 25.30833249774391 23.663892509776396 25.03258798756643 25-29 25.858525091492456 25.19677144432747 24.118915125081468 24.82578833909861 30-34 25.668020253672232 25.437409134205645 23.74793201985261 25.146638592269515 35-39 25.93502456632909 25.2832648150005 23.739095558006618 25.042615060663792 40-44 26.173891255324477 25.131545978451513 23.492858932598345 25.20170383362566 45-49 26.281505236257956 25.324447562258857 24.051711179034925 24.342336022448265 50-54 25.551323175621494 25.53127506014435 23.862269446672013 25.05513231756215 55-59 26.778913609941874 25.891962317097615 23.19603126879134 24.133092804169173 60-64 25.57020402025164 25.379718281618125 23.89593463331495 25.154143064815276 65-69 26.094799078063936 25.032568393626615 24.045495540635333 24.827136987674116 70-74 26.31789937863299 25.20545199438765 23.707155742633795 24.76949288434556 75-79 25.851703406813627 24.849699398797593 24.498997995991985 24.799599198396795 80-84 26.41310883944678 25.075165363800362 23.90759671276809 24.604129083984766 85-89 26.118543013177014 25.31188937321509 24.10441404880004 24.465153564807856 90-94 26.31842791257269 25.0551433727692 24.418488068979347 24.207940645678764 95-99 26.35141911543476 24.952361849363154 23.949453414903218 24.746765620298866 100-104 26.11094392617113 25.42381382285084 24.16491122479687 24.300331026181162 105-109 25.547811262096975 25.913854485283057 24.35942435942436 24.17890989319561 110-114 26.313941825476427 26.178535606820464 23.655967903711133 23.851554663991976 115-119 26.207898957497992 25.275661587810745 24.21812349639134 24.29831595829992 120-124 26.702095658277347 25.21808883986764 24.23543567632608 23.84437982552893 125-129 26.11136169999499 25.449807046559414 24.211897960206485 24.22693329323911 130-134 26.311832807096675 25.339547937653485 24.40735728963063 23.941261965619205 135-139 26.27912803808569 26.078677023302433 23.91881733901278 23.7233775995991 140-144 26.596171193745615 25.714142527813973 24.130500150345796 23.559186128094616 145-149 26.64895749799519 25.79190056134723 24.48376102646351 23.075380914194067 150-151 26.719278466741827 25.66704246523863 24.3141676061631 23.299511461856444 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 2.5 3 2.5 4 1.5 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 1.0 26 0.5 27 0.5 28 2.5 29 3.5 30 4.0 31 4.0 32 11.0 33 17.5 34 16.5 35 20.0 36 28.5 37 40.0 38 56.5 39 74.0 40 100.5 41 127.0 42 145.0 43 160.5 44 177.0 45 188.5 46 189.0 47 188.0 48 187.5 49 178.0 50 170.0 51 157.0 52 136.0 53 125.0 54 109.0 55 105.0 56 109.0 57 104.5 58 97.0 59 97.5 60 99.5 61 88.0 62 79.0 63 76.0 64 71.5 65 69.5 66 63.0 67 62.5 68 61.0 69 44.0 70 33.5 71 31.5 72 26.5 73 20.0 74 15.0 75 9.0 76 4.5 77 2.0 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.075 4 0.025 5 0.0 6 0.2 7 0.27499999999999997 8 0.22499999999999998 9 0.2 10-14 0.24 15-19 0.27999999999999997 20-24 0.27 25-29 0.265 30-34 0.265 35-39 0.27 40-44 0.22499999999999998 45-49 0.215 50-54 0.24 55-59 0.22 60-64 0.255 65-69 0.21 70-74 0.22 75-79 0.2 80-84 0.22 85-89 0.20500000000000002 90-94 0.26 95-99 0.29 100-104 0.31 105-109 0.28500000000000003 110-114 0.3 115-119 0.24 120-124 0.27 125-129 0.23500000000000001 130-134 0.23500000000000001 135-139 0.22499999999999998 140-144 0.22999999999999998 145-149 0.24 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96307536671725 97.82499999999999 2 0.9610520991401114 1.9 3 0.05058168942842691 0.15 4 0.0 0.0 5 0.025290844714213456 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.4125 0.0 0.0 0.0 0.0 128-129 1.5750000000000002 0.0 0.0 0.0 0.0 130-131 1.7374999999999998 0.0 0.0 0.0 0.0 132-133 1.975 0.0 0.0 0.0 0.0 134-135 2.2750000000000004 0.0 0.0 0.0 0.0 136-137 2.4375 0.0 0.0 0.0 0.0 138-139 2.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACCTA 10 0.006830828 145.0 8 >>END_MODULE Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374205 spots for SRR6958385.sra Written 1374205 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra Read 1374200 spots for SRR6958385.sra Written 1374200 spots for SRR6958385.sra SRR ids: ['SRR6958385.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qhwb5bcn SRR6958385.sra spots: 27484005 blocks: [[1, 1374200], [1374201, 2748400], [2748401, 4122600], [4122601, 5496800], [5496801, 6871000], [6871001, 8245200], [8245201, 9619400], [9619401, 10993600], [10993601, 12367800], [12367801, 13742000], [13742001, 15116200], [15116201, 16490400], [16490401, 17864600], [17864601, 19238800], [19238801, 20613000], [20613001, 21987200], [21987201, 23361400], [23361401, 24735600], [24735601, 26109800], [26109801, 27484005]] SRR6958385 file size 9291727 SRR6958385 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958385 SRR6958385_1.fastq SRR6958385_2.fastq Input file: SRR6958385_1.fastq Paired file: SRR6958385_2.fastq trimmed: SRR6958385-trimmed-pair1.fastq, SRR6958385-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:40:12 2024 >> started Fri Dec 6 21:40:41 2024 >> done (28.089s) 27484005 read pairs processed; of these: 58586 ( 0.21%) short read pairs filtered out after trimming by size control 54891 ( 0.20%) empty read pairs filtered out after trimming by size control 27370528 (99.59%) read pairs available; of these: 10174801 (37.17%) trimmed read pairs available after processing 17195727 (62.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 8 0.00% 21 5 0.00% 22 7 0.00% 23 8 0.00% 24 10 0.00% 25 4 0.00% 26 9 0.00% 27 13 0.00% 28 7 0.00% 29 9 0.00% 30 4 0.00% 31 4 0.00% 32 9 0.00% 33 6 0.00% 34 10 0.00% 35 15 0.00% 36 8 0.00% 37 3 0.00% 38 15 0.00% 39 10 0.00% 40 15 0.00% 41 16 0.00% 42 19 0.00% 43 17 0.00% 44 21 0.00% 45 16 0.00% 46 19 0.00% 47 25 0.00% 48 26 0.00% 49 29 0.00% 50 38 0.00% 51 28 0.00% 52 28 0.00% 53 43 0.00% 54 48 0.00% 55 48 0.00% 56 59 0.00% 57 65 0.00% 58 58 0.00% 59 92 0.00% 60 81 0.00% 61 92 0.00% 62 105 0.00% 63 112 0.00% 64 117 0.00% 65 144 0.00% 66 173 0.00% 67 170 0.00% 68 215 0.00% 69 222 0.00% 70 239 0.00% 71 300 0.00% 72 320 0.00% 73 422 0.00% 74 435 0.00% 75 475 0.00% 76 615 0.00% 77 649 0.00% 78 700 0.00% 79 786 0.00% 80 957 0.00% 81 1061 0.00% 82 1214 0.00% 83 1440 0.01% 84 3014 0.01% 85 3911 0.01% 86 3867 0.01% 87 4184 0.02% 88 4253 0.02% 89 4319 0.02% 90 4538 0.02% 91 4578 0.02% 92 5050 0.02% 93 5345 0.02% 94 5675 0.02% 95 5984 0.02% 96 6251 0.02% 97 6503 0.02% 98 6813 0.02% 99 7369 0.03% 100 7961 0.03% 101 8453 0.03% 102 9011 0.03% 103 9658 0.04% 104 10255 0.04% 105 11003 0.04% 106 12002 0.04% 107 12590 0.05% 108 13102 0.05% 109 13912 0.05% 110 14973 0.05% 111 15768 0.06% 112 16826 0.06% 113 18003 0.07% 114 19540 0.07% 115 20349 0.07% 116 22075 0.08% 117 22994 0.08% 118 23908 0.09% 119 25050 0.09% 120 26106 0.10% 121 27091 0.10% 122 29280 0.11% 123 30283 0.11% 124 32175 0.12% 125 33783 0.12% 126 35627 0.13% 127 37002 0.14% 128 38590 0.14% 129 40314 0.15% 130 42352 0.15% 131 45285 0.17% 132 47841 0.17% 133 50906 0.19% 134 53802 0.20% 135 57133 0.21% 136 60955 0.22% 137 64613 0.24% 138 68088 0.25% 139 73803 0.27% 140 80040 0.29% 141 86557 0.32% 142 96203 0.35% 143 106669 0.39% 144 123325 0.45% 145 148405 0.54% 146 187212 0.68% 147 273515 1.00% 148 378519 1.38% 149 831951 3.04% 150 6566365 23.99% 151 17195727 62.83% 27370528 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=23 prefix-density=0.62 prefix-fanout=3.1 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=64.83 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.1 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=21 prefix-density=0.55 prefix-fanout=3.0 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=71.59 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.6 sequence=GTGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTT SRR6958385 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:41:26 Started mapping on | Dec 06 21:41:26 Finished on | Dec 06 21:43:48 Mapping speed, Million of reads per hour | 693.90 Number of input reads | 27370528 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 26525043 Uniquely mapped reads % | 96.91% Average mapped length | 297.80 Number of splices: Total | 30799967 Number of splices: Annotated (sjdb) | 28929035 Number of splices: GT/AG | 30378377 Number of splices: GC/AG | 369706 Number of splices: AT/AC | 10927 Number of splices: Non-canonical | 40957 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.56 Insertion rate per base | 0.01% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 213967 % of reads mapped to multiple loci | 0.78% Number of reads mapped to too many loci | 10903 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.01% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 654800 654800 654800 N_multimapping 213967 213967 213967 N_noFeature 719843 25796325 912028 N_ambiguous 644116 3574 108647 UnstrandedReadsAssigned:25161084 PositiveStrandReadsAssigned:725144 NegativeStrandReadsAssigned:25504368 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958385 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958385-trimmed-pair1.fastq SRR6958385-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,370,528 reads, 25,490,147 reads pseudoaligned [quant] estimated average fragment length: 264.239 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,218 rounds 52973 SRR6958385.ke.tsv 35125 SRR6958385.se.tsv 88098 total ==> SRR6958385.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 673.211 0.00191609 0.000163043 PNS24247 1044 780.761 102.449 7.51672 PNS24249 1928 1664.76 91.7858 3.15836 PNS24246 1044 780.761 102.449 7.51672 PNS24248 1044 780.761 102.449 7.51672 PNS24244 1471 1207.76 48.865 2.31769 PNS24243 293 79.7255 0 0 KQK14069 1603 1339.76 11487.3 491.166 KQK14071 474 223.226 138.798 35.6186 ==> SRR6958385.se.tsv <== BRADI_1g14170v3 12597 BRADI_1g53295v3 205 BRADI_1g59795v3 300 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 242 BRADI_1g74790v3 120 BRADI_1g09890v3 0 BRADI_1g77505v3 285 BRADI_1g48960v3 0 SRR6958385 completed mapping pipeline successfully