Starting /dee2/code/volunteer_pipeline.sh SRR6958386 current disk space = 1548949905408 free memory = 1598500452 SRR6958386 SRAfilesize c11e6d8fa3ca3624edf4b8f2e1335de1 SRR6958386.sra SRR6958386.sra file validated SRR6958386 is paired end SRR6958386 is conventional basespace SRR6958386 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958386_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.07075 18.0 18.0 25.0 18.0 32.0 2 20.9675 18.0 18.0 25.0 18.0 29.0 3 25.173 27.0 18.0 29.0 18.0 31.0 4 27.31375 27.0 25.0 32.0 15.0 33.0 5 30.985 32.0 32.0 33.0 27.0 33.0 6 35.607 37.0 35.0 38.0 31.0 38.0 7 36.126 38.0 36.0 38.0 33.0 38.0 8 36.707 38.0 37.0 38.0 34.0 38.0 9 37.01025 38.0 38.0 38.0 35.0 38.0 10-14 37.11865 38.0 38.0 38.0 36.0 38.0 15-19 37.20055 38.0 38.0 38.0 36.2 38.0 20-24 37.28535 38.0 38.0 38.0 36.6 38.0 25-29 37.18605 38.0 38.0 38.0 36.2 38.0 30-34 37.149 38.0 38.0 38.0 36.0 38.0 35-39 37.057100000000005 38.0 38.0 38.0 35.8 38.0 40-44 36.96255000000001 38.0 38.0 38.0 35.4 38.0 45-49 36.9899 38.0 38.0 38.0 35.6 38.0 50-54 36.95935000000001 38.0 38.0 38.0 35.6 38.0 55-59 36.793899999999994 38.0 38.0 38.0 35.0 38.0 60-64 36.7386 38.0 38.0 38.0 34.8 38.0 65-69 36.594500000000004 38.0 38.0 38.0 34.0 38.0 70-74 36.75515 38.0 38.0 38.0 34.4 38.0 75-79 36.6704 38.0 38.0 38.0 34.4 38.0 80-84 36.3897 38.0 37.6 38.0 33.6 38.0 85-89 36.1837 38.0 37.0 38.0 33.0 38.0 90-94 36.23335 38.0 37.0 38.0 33.0 38.0 95-99 36.1456 38.0 37.0 38.0 33.0 38.0 100-104 36.027049999999996 38.0 37.0 38.0 32.4 38.0 105-109 35.810500000000005 38.0 36.6 38.0 31.0 38.0 110-114 35.586200000000005 38.0 36.0 38.0 30.8 38.0 115-119 35.3834 38.0 36.0 38.0 29.2 38.0 120-124 35.22515 38.0 35.4 38.0 28.4 38.0 125-129 34.77515 38.0 35.0 38.0 27.2 38.0 130-134 34.591899999999995 38.0 34.8 38.0 26.4 38.0 135-139 34.25875 38.0 34.4 38.0 24.4 38.0 140-144 33.6514 38.0 34.0 38.0 22.2 38.0 145-149 32.7742 38.0 33.6 38.0 18.0 38.0 150-151 28.46925 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 3.0 21 1.0 22 9.0 23 7.0 24 12.0 25 18.0 26 15.0 27 21.0 28 45.0 29 50.0 30 71.0 31 79.0 32 150.0 33 173.0 34 294.0 35 497.0 36 1151.0 37 1403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.146124523506987 26.70902160101652 5.209656925031767 52.93519695044473 2 12.9 23.775 29.599999999999998 33.725 3 18.15 17.075000000000003 23.1 41.675000000000004 4 23.200000000000003 23.625 20.674999999999997 32.5 5 25.900000000000002 28.725 24.099999999999998 21.275 6 21.75 33.75 22.900000000000002 21.6 7 16.45 25.25 39.825 18.475 8 20.25 24.025 29.775000000000002 25.95 9 19.400000000000002 22.525000000000002 34.425 23.65 10-14 21.59 27.205000000000002 25.995 25.21 15-19 21.58 25.64 27.060000000000002 25.72 20-24 21.990000000000002 26.595000000000002 26.575 24.84 25-29 21.75 26.534999999999997 26.840000000000003 24.875 30-34 21.88 26.255 26.815 25.05 35-39 21.905 26.76 26.57 24.765 40-44 21.855 26.345000000000002 27.200000000000003 24.6 45-49 22.025 25.97 27.16 24.845 50-54 21.725 26.395000000000003 26.529999999999998 25.35 55-59 22.245 26.085 26.63 25.040000000000003 60-64 22.055 26.19 26.38 25.374999999999996 65-69 22.235 26.125 26.345000000000002 25.295 70-74 22.08 26.47 26.615 24.834999999999997 75-79 21.88 26.31 26.69 25.119999999999997 80-84 21.63 26.505000000000003 27.005000000000003 24.86 85-89 21.745 26.400000000000002 26.355 25.5 90-94 22.48 25.929999999999996 26.495 25.095 95-99 22.145 26.169999999999998 26.455000000000002 25.230000000000004 100-104 22.475 26.150000000000002 26.640000000000004 24.735 105-109 22.11 26.540000000000003 26.340000000000003 25.009999999999998 110-114 22.134999999999998 26.150000000000002 26.035000000000004 25.679999999999996 115-119 22.314999999999998 26.57 25.86 25.255 120-124 23.055 25.495 26.705000000000002 24.745 125-129 22.11 26.205000000000002 26.345000000000002 25.34 130-134 22.495 26.314999999999998 26.21 24.98 135-139 22.939999999999998 25.919999999999998 25.995 25.145 140-144 22.64 25.835 26.009999999999998 25.515 145-149 22.625 25.66 26.36 25.355 150-151 23.29041130141268 24.315539442430303 27.17839729966246 25.21565195649456 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 1.5 26 1.5 27 3.5 28 7.0 29 6.5 30 4.0 31 9.0 32 15.5 33 23.5 34 33.5 35 42.0 36 58.5 37 81.5 38 100.5 39 122.0 40 144.0 41 176.5 42 212.5 43 218.5 44 222.0 45 236.5 46 240.0 47 230.5 48 214.0 49 199.5 50 180.0 51 149.5 52 132.0 53 114.5 54 100.5 55 89.5 56 70.0 57 65.5 58 61.0 59 54.5 60 50.0 61 41.5 62 35.5 63 35.5 64 36.5 65 34.0 66 29.5 67 25.0 68 20.5 69 14.5 70 13.5 71 13.5 72 7.0 73 4.0 74 4.5 75 4.5 76 3.5 77 1.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.775 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1375000000000002 0.0 0.0 0.0 0.0 126-127 1.2125 0.0 0.0 0.0 0.0 128-129 1.2875 0.0 0.0 0.0 0.0 130-131 1.4500000000000002 0.0 0.0 0.0 0.0 132-133 1.5625 0.0 0.0 0.0 0.0 134-135 1.75 0.0 0.0 0.0 0.0 136-137 2.0250000000000004 0.0 0.0 0.0 0.0 138-139 2.2249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958386 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958386_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.893 33.0 33.0 34.0 32.0 34.0 2 32.85675 33.0 33.0 34.0 32.0 34.0 3 32.8645 33.0 33.0 34.0 32.0 34.0 4 32.77375 34.0 33.0 34.0 32.0 34.0 5 32.87125 34.0 33.0 34.0 32.0 34.0 6 36.9525 38.0 38.0 38.0 36.0 38.0 7 36.89125 38.0 38.0 38.0 35.0 38.0 8 36.94825 38.0 38.0 38.0 36.0 38.0 9 36.95975 38.0 38.0 38.0 36.0 38.0 10-14 36.8463 38.0 38.0 38.0 35.2 38.0 15-19 36.68509999999999 38.0 38.0 38.0 34.6 38.0 20-24 36.7892 38.0 38.0 38.0 35.2 38.0 25-29 36.9277 38.0 38.0 38.0 35.8 38.0 30-34 36.88485 38.0 38.0 38.0 35.6 38.0 35-39 36.8977 38.0 38.0 38.0 35.4 38.0 40-44 36.7643 38.0 38.0 38.0 35.0 38.0 45-49 36.69395 38.0 38.0 38.0 34.6 38.0 50-54 36.629650000000005 38.0 38.0 38.0 34.4 38.0 55-59 36.687349999999995 38.0 38.0 38.0 34.8 38.0 60-64 36.59349999999999 38.0 38.0 38.0 34.4 38.0 65-69 36.397999999999996 38.0 38.0 38.0 33.8 38.0 70-74 36.3177 38.0 37.8 38.0 33.6 38.0 75-79 36.32115 38.0 38.0 38.0 33.8 38.0 80-84 36.1216 38.0 37.4 38.0 33.0 38.0 85-89 36.045950000000005 38.0 37.0 38.0 33.0 38.0 90-94 35.815999999999995 38.0 37.0 38.0 32.0 38.0 95-99 35.72945 38.0 37.0 38.0 31.0 38.0 100-104 35.6537 38.0 36.8 38.0 31.0 38.0 105-109 35.488800000000005 38.0 36.2 38.0 29.8 38.0 110-114 35.1238 38.0 35.4 38.0 28.4 38.0 115-119 35.0275 38.0 35.4 38.0 27.8 38.0 120-124 34.67614999999999 38.0 35.0 38.0 26.8 38.0 125-129 34.48975 38.0 34.8 38.0 25.2 38.0 130-134 34.20655 38.0 34.4 38.0 23.8 38.0 135-139 33.8657 38.0 34.0 38.0 22.6 38.0 140-144 33.39970000000001 38.0 33.6 38.0 20.2 38.0 145-149 32.42385 38.0 32.8 38.0 13.8 38.0 150-151 27.292 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 2.0 10 1.0 11 1.0 12 1.0 13 2.0 14 4.0 15 1.0 16 5.0 17 3.0 18 2.0 19 5.0 20 3.0 21 3.0 22 4.0 23 18.0 24 18.0 25 20.0 26 28.0 27 27.0 28 40.0 29 45.0 30 75.0 31 83.0 32 138.0 33 173.0 34 229.0 35 365.0 36 789.0 37 1905.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.300000000000004 18.7 12.45 35.55 2 27.888944472236116 24.262131065532767 29.014507253626814 18.8344172086043 3 22.56128064032016 26.663331665832917 27.838919459729865 22.936468234117058 4 24.262131065532767 31.79089544772386 21.135567783891947 22.811405702851424 5 27.538769384692348 32.36618309154578 20.96048024012006 19.13456728364182 6 22.175 36.075 21.349999999999998 20.4 7 20.375 21.0 36.125 22.5 8 22.400000000000002 23.674999999999997 26.974999999999998 26.950000000000003 9 23.075000000000003 22.575 28.95 25.4 10-14 25.485000000000003 27.189999999999998 23.849999999999998 23.474999999999998 15-19 25.755 26.31 25.165 22.770000000000003 20-24 25.135 26.795 24.79 23.28 25-29 25.44 26.43 24.86 23.27 30-34 24.65 26.815 25.7 22.835 35-39 25.869999999999997 26.479999999999997 24.855 22.795 40-44 25.019999999999996 26.590000000000003 24.93 23.46 45-49 25.455 26.46 25.555 22.53 50-54 26.090000000000003 26.38 25.305 22.225 55-59 25.650000000000002 26.39 25.1 22.86 60-64 25.705 26.47 25.61 22.215 65-69 25.2 26.334999999999997 25.180000000000003 23.285 70-74 25.145 25.66 26.314999999999998 22.88 75-79 24.97 26.215 25.795 23.02 80-84 25.369999999999997 26.305 25.03 23.294999999999998 85-89 25.874999999999996 26.1 25.255 22.770000000000003 90-94 24.66 26.82 25.685000000000002 22.835 95-99 25.405 25.53 26.26 22.805 100-104 25.94 26.375 25.115 22.57 105-109 25.795 26.21 25.650000000000002 22.345000000000002 110-114 25.485000000000003 26.6 25.41 22.505 115-119 25.36 26.405 25.729999999999997 22.505 120-124 26.055 26.855 25.169999999999998 21.92 125-129 25.674999999999997 26.25 26.174999999999997 21.9 130-134 26.295 26.55 25.605 21.55 135-139 25.385 26.71 26.150000000000002 21.755 140-144 25.840000000000003 27.215 25.490000000000002 21.455 145-149 26.169999999999998 26.515 25.695 21.62 150-151 25.9407425928241 26.340792599074884 25.14064258032254 22.577822227778473 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 2.0 24 2.0 25 0.0 26 0.5 27 2.0 28 3.0 29 4.5 30 6.5 31 12.0 32 19.0 33 19.0 34 22.0 35 37.0 36 56.5 37 70.0 38 84.5 39 108.0 40 134.0 41 155.0 42 185.0 43 207.0 44 217.5 45 230.0 46 215.5 47 191.0 48 190.5 49 200.5 50 188.0 51 156.5 52 134.0 53 116.0 54 99.0 55 93.5 56 92.5 57 84.0 58 78.0 59 71.5 60 60.5 61 57.5 62 59.0 63 56.0 64 40.5 65 35.5 66 37.5 67 32.5 68 28.0 69 25.5 70 25.0 71 20.5 72 13.5 73 6.5 74 3.5 75 4.0 76 2.5 77 1.0 78 0.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29417695991933 98.475 2 0.604991177211999 1.2 3 0.07562389715149988 0.22499999999999998 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.775 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.2375 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.4625 0.0 0.0 0.0 0.0 132-133 1.5625 0.0 0.0 0.0 0.0 134-135 1.75 0.0 0.0 0.0 0.0 136-137 2.0250000000000004 0.0 0.0 0.0 0.0 138-139 2.2249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTCAT 10 0.006830828 145.0 5 >>END_MODULE Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932742 spots for SRR6958386.sra Written 932742 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra Read 932733 spots for SRR6958386.sra Written 932733 spots for SRR6958386.sra SRR ids: ['SRR6958386.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z9ouiz2a SRR6958386.sra spots: 18654669 blocks: [[1, 932733], [932734, 1865466], [1865467, 2798199], [2798200, 3730932], [3730933, 4663665], [4663666, 5596398], [5596399, 6529131], [6529132, 7461864], [7461865, 8394597], [8394598, 9327330], [9327331, 10260063], [10260064, 11192796], [11192797, 12125529], [12125530, 13058262], [13058263, 13990995], [13990996, 14923728], [14923729, 15856461], [15856462, 16789194], [16789195, 17721927], [17721928, 18654669]] SRR6958386 file size 6299754 SRR6958386 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958386 SRR6958386_1.fastq SRR6958386_2.fastq Input file: SRR6958386_1.fastq Paired file: SRR6958386_2.fastq trimmed: SRR6958386-trimmed-pair1.fastq, SRR6958386-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:39:18 2024 >> started Fri Dec 6 21:39:39 2024 >> done (20.212s) 18654669 read pairs processed; of these: 11212 ( 0.06%) short read pairs filtered out after trimming by size control 11146 ( 0.06%) empty read pairs filtered out after trimming by size control 18632311 (99.88%) read pairs available; of these: 6859416 (36.81%) trimmed read pairs available after processing 11772895 (63.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 7 0.00% 21 1 0.00% 22 6 0.00% 23 4 0.00% 24 6 0.00% 25 3 0.00% 26 6 0.00% 27 4 0.00% 28 3 0.00% 29 1 0.00% 30 3 0.00% 31 8 0.00% 32 7 0.00% 33 11 0.00% 34 5 0.00% 35 9 0.00% 36 7 0.00% 37 8 0.00% 38 14 0.00% 39 4 0.00% 40 10 0.00% 41 11 0.00% 42 18 0.00% 43 13 0.00% 44 11 0.00% 45 12 0.00% 46 26 0.00% 47 18 0.00% 48 22 0.00% 49 23 0.00% 50 33 0.00% 51 33 0.00% 52 46 0.00% 53 41 0.00% 54 51 0.00% 55 43 0.00% 56 57 0.00% 57 63 0.00% 58 78 0.00% 59 70 0.00% 60 77 0.00% 61 99 0.00% 62 103 0.00% 63 101 0.00% 64 129 0.00% 65 151 0.00% 66 143 0.00% 67 188 0.00% 68 185 0.00% 69 214 0.00% 70 216 0.00% 71 280 0.00% 72 332 0.00% 73 342 0.00% 74 382 0.00% 75 425 0.00% 76 475 0.00% 77 613 0.00% 78 607 0.00% 79 690 0.00% 80 734 0.00% 81 895 0.00% 82 985 0.01% 83 1118 0.01% 84 1671 0.01% 85 1985 0.01% 86 2065 0.01% 87 2165 0.01% 88 2288 0.01% 89 2607 0.01% 90 2644 0.01% 91 2788 0.01% 92 3121 0.02% 93 3266 0.02% 94 3601 0.02% 95 4067 0.02% 96 4208 0.02% 97 4466 0.02% 98 4673 0.03% 99 5049 0.03% 100 5451 0.03% 101 5661 0.03% 102 6151 0.03% 103 6659 0.04% 104 6969 0.04% 105 7403 0.04% 106 7975 0.04% 107 8814 0.05% 108 9006 0.05% 109 9758 0.05% 110 10259 0.06% 111 11019 0.06% 112 11475 0.06% 113 12331 0.07% 114 12704 0.07% 115 13734 0.07% 116 14592 0.08% 117 15376 0.08% 118 16657 0.09% 119 17300 0.09% 120 18099 0.10% 121 19191 0.10% 122 20122 0.11% 123 21191 0.11% 124 22551 0.12% 125 23807 0.13% 126 24981 0.13% 127 26702 0.14% 128 27966 0.15% 129 29307 0.16% 130 31594 0.17% 131 33580 0.18% 132 35673 0.19% 133 38428 0.21% 134 40705 0.22% 135 43633 0.23% 136 47430 0.25% 137 50602 0.27% 138 54065 0.29% 139 58761 0.32% 140 64533 0.35% 141 70752 0.38% 142 80367 0.43% 143 91935 0.49% 144 108499 0.58% 145 132172 0.71% 146 168111 0.90% 147 232383 1.25% 148 358596 1.92% 149 722578 3.88% 150 3890853 20.88% 151 11772895 63.19% 18632311 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=19 prefix-density=0.63 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=61.98 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.5 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=18 prefix-density=0.44 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=84.04 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.6 sequence=TGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAG SRR6958386 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:40:32 Started mapping on | Dec 06 21:40:32 Finished on | Dec 06 21:42:04 Mapping speed, Million of reads per hour | 729.09 Number of input reads | 18632311 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18250813 Uniquely mapped reads % | 97.95% Average mapped length | 297.49 Number of splices: Total | 22327672 Number of splices: Annotated (sjdb) | 21078030 Number of splices: GT/AG | 22027734 Number of splices: GC/AG | 264242 Number of splices: AT/AC | 9250 Number of splices: Non-canonical | 26446 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 167996 % of reads mapped to multiple loci | 0.90% Number of reads mapped to too many loci | 14013 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 219699 219699 219699 N_multimapping 167996 167996 167996 N_noFeature 695271 17752033 840729 N_ambiguous 428250 2398 76773 UnstrandedReadsAssigned:17127292 PositiveStrandReadsAssigned:496382 NegativeStrandReadsAssigned:17333311 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958386 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958386-trimmed-pair1.fastq SRR6958386-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,632,311 reads, 17,353,601 reads pseudoaligned [quant] estimated average fragment length: 274.685 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 SRR6958386.ke.tsv 35125 SRR6958386.se.tsv 88098 total ==> SRR6958386.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 662.779 0 0 PNS24247 1044 770.315 48.0194 5.57391 PNS24249 1928 1654.32 33.8438 1.82925 PNS24246 1044 770.315 48.0194 5.57391 PNS24248 1044 770.315 48.0194 5.57391 PNS24244 1471 1197.32 22.0979 1.65027 PNS24243 293 77.5167 0 0 KQK14069 1603 1329.32 2628.64 176.813 KQK14071 474 216.326 45.5855 18.8421 ==> SRR6958386.se.tsv <== BRADI_1g14170v3 3089 BRADI_1g53295v3 319 BRADI_1g59795v3 314 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 253 BRADI_1g74790v3 85 BRADI_1g09890v3 0 BRADI_1g77505v3 240 BRADI_1g48960v3 0 SRR6958386 completed mapping pipeline successfully