Starting /dee2/code/volunteer_pipeline.sh SRR6958387 current disk space = 1548930854912 free memory = 1601548692 SRR6958387 SRAfilesize aa3c238e0c67297ddce40cb89b492009 SRR6958387.sra SRR6958387.sra file validated SRR6958387 is paired end SRR6958387 is conventional basespace SRR6958387 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958387_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.19425 33.0 28.0 33.0 18.0 33.0 2 29.95475 31.0 29.0 33.0 18.0 33.0 3 30.25275 31.0 29.0 33.0 25.0 33.0 4 31.47325 33.0 32.0 33.0 28.0 33.0 5 32.09325 33.0 32.0 33.0 31.0 34.0 6 36.12725 38.0 36.0 38.0 33.0 38.0 7 36.82 38.0 37.0 38.0 35.0 38.0 8 37.21025 38.0 38.0 38.0 36.0 38.0 9 37.27875 38.0 38.0 38.0 36.0 38.0 10-14 37.212849999999996 38.0 38.0 38.0 36.4 38.0 15-19 37.23695 38.0 38.0 38.0 36.2 38.0 20-24 37.29415 38.0 38.0 38.0 36.8 38.0 25-29 37.214999999999996 38.0 38.0 38.0 36.4 38.0 30-34 37.10744999999999 38.0 38.0 38.0 36.0 38.0 35-39 36.99925 38.0 38.0 38.0 35.6 38.0 40-44 36.90474999999999 38.0 38.0 38.0 35.2 38.0 45-49 37.0044 38.0 38.0 38.0 35.6 38.0 50-54 36.88445 38.0 38.0 38.0 35.4 38.0 55-59 36.7211 38.0 38.0 38.0 34.6 38.0 60-64 36.703700000000005 38.0 38.0 38.0 34.6 38.0 65-69 36.664649999999995 38.0 38.0 38.0 34.4 38.0 70-74 36.766299999999994 38.0 38.0 38.0 34.6 38.0 75-79 36.61225 38.0 38.0 38.0 34.2 38.0 80-84 36.326049999999995 38.0 37.6 38.0 33.4 38.0 85-89 36.066100000000006 38.0 37.0 38.0 32.6 38.0 90-94 36.207350000000005 38.0 37.2 38.0 33.2 38.0 95-99 36.140499999999996 38.0 37.0 38.0 33.0 38.0 100-104 35.9799 38.0 37.0 38.0 32.2 38.0 105-109 35.710350000000005 38.0 36.0 38.0 31.0 38.0 110-114 35.5149 38.0 36.0 38.0 30.2 38.0 115-119 35.452600000000004 38.0 36.0 38.0 30.2 38.0 120-124 35.25215 38.0 35.4 38.0 28.8 38.0 125-129 34.6992 38.0 35.0 38.0 27.0 38.0 130-134 34.511399999999995 38.0 35.0 38.0 25.6 38.0 135-139 34.17295 38.0 34.2 38.0 23.8 38.0 140-144 33.7695 38.0 34.0 38.0 22.0 38.0 145-149 32.8771 37.6 33.6 38.0 18.4 38.0 150-151 28.3525 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 7.0 20 4.0 21 3.0 22 7.0 23 10.0 24 9.0 25 14.0 26 23.0 27 25.0 28 33.0 29 41.0 30 71.0 31 86.0 32 119.0 33 164.0 34 232.0 35 413.0 36 940.0 37 1795.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.55038759689923 7.72609819121447 8.113695090439277 42.60981912144703 2 19.8 12.625 38.475 29.099999999999998 3 19.125 15.174999999999999 24.7 41.0 4 25.374999999999996 23.474999999999998 21.5 29.65 5 27.25681420355089 27.506876719179797 23.330832708177045 21.905476369092273 6 23.549999999999997 31.95 23.5 21.0 7 19.75 25.275 36.825 18.15 8 20.225 22.8 31.0 25.974999999999998 9 20.474999999999998 21.4 33.025 25.1 10-14 22.96 26.52 26.0 24.52 15-19 22.7 25.619999999999997 26.490000000000002 25.19 20-24 22.625 25.665 26.009999999999998 25.7 25-29 22.91 25.169999999999998 26.240000000000002 25.679999999999996 30-34 22.88 25.009999999999998 26.135 25.974999999999998 35-39 22.770000000000003 25.085 26.32 25.825 40-44 22.96 25.785000000000004 25.405 25.85 45-49 23.27 25.790000000000003 25.19 25.75 50-54 23.150000000000002 25.005 25.985000000000003 25.86 55-59 22.81 25.374999999999996 26.515 25.3 60-64 22.86 25.275 25.555 26.31 65-69 23.52 25.45 25.474999999999998 25.555 70-74 23.005 25.3 25.855 25.840000000000003 75-79 23.565 24.89 25.430000000000003 26.115 80-84 23.21 25.085 25.755 25.95 85-89 23.66 24.895 25.8 25.645 90-94 23.305 24.610000000000003 26.33 25.755 95-99 23.805 24.645 25.929999999999996 25.619999999999997 100-104 23.9 24.765 25.669999999999998 25.665 105-109 23.49 25.16 25.480000000000004 25.869999999999997 110-114 23.505000000000003 25.145 25.41 25.94 115-119 23.849999999999998 25.119999999999997 25.319999999999997 25.71 120-124 24.07 25.330000000000002 25.005 25.595000000000002 125-129 23.745 25.145 25.34 25.77 130-134 24.015 24.555 26.179999999999996 25.25 135-139 24.505 24.645 25.135 25.715 140-144 24.08 24.13 26.029999999999998 25.759999999999998 145-149 23.93 24.79 25.419999999999998 25.86 150-151 23.19039879984998 23.80297537192149 26.365795724465556 26.64083010376297 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 1.5 26 1.0 27 1.0 28 2.0 29 3.5 30 6.5 31 9.0 32 8.5 33 16.0 34 23.0 35 26.0 36 43.0 37 56.0 38 68.0 39 104.5 40 133.5 41 164.5 42 193.0 43 192.0 44 204.0 45 222.0 46 218.0 47 214.0 48 204.5 49 174.0 50 153.5 51 147.5 52 132.0 53 123.5 54 110.0 55 91.0 56 91.5 57 81.5 58 71.5 59 74.0 60 81.0 61 73.0 62 68.5 63 61.5 64 43.5 65 47.5 66 42.0 67 30.5 68 35.5 69 33.0 70 24.0 71 23.5 72 23.0 73 17.5 74 12.0 75 7.5 76 3.0 77 1.0 78 1.0 79 1.5 80 0.5 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.25 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.81012658227849 97.575 2 1.1139240506329113 2.1999999999999997 3 0.0759493670886076 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.36250000000000004 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.5375 0.0 0.0 0.0 0.0 130-131 1.825 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.25 0.0 0.0 0.0 0.0 136-137 2.4749999999999996 0.0 0.0 0.0 0.0 138-139 2.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGTTT 10 0.0063298983 148.6923 1 >>END_MODULE SRR6958387 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958387_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82375 33.0 33.0 34.0 32.0 34.0 2 32.783 33.0 33.0 34.0 32.0 34.0 3 32.81025 33.0 33.0 34.0 32.0 34.0 4 32.68075 33.0 33.0 34.0 32.0 34.0 5 32.7255 34.0 33.0 34.0 32.0 34.0 6 36.8745 38.0 38.0 38.0 36.0 38.0 7 36.7565 38.0 38.0 38.0 35.0 38.0 8 36.8165 38.0 38.0 38.0 35.0 38.0 9 36.67275 38.0 38.0 38.0 35.0 38.0 10-14 36.61959999999999 38.0 38.0 38.0 34.6 38.0 15-19 36.503099999999996 38.0 38.0 38.0 34.0 38.0 20-24 36.68915 38.0 38.0 38.0 34.8 38.0 25-29 36.82045 38.0 38.0 38.0 35.4 38.0 30-34 36.7576 38.0 38.0 38.0 35.2 38.0 35-39 36.8004 38.0 38.0 38.0 35.2 38.0 40-44 36.679 38.0 38.0 38.0 35.0 38.0 45-49 36.56905 38.0 38.0 38.0 34.4 38.0 50-54 36.55105 38.0 38.0 38.0 34.2 38.0 55-59 36.635200000000005 38.0 38.0 38.0 34.8 38.0 60-64 36.5151 38.0 38.0 38.0 34.2 38.0 65-69 36.31464999999999 38.0 38.0 38.0 33.6 38.0 70-74 36.182700000000004 38.0 37.6 38.0 33.6 38.0 75-79 36.12005 38.0 37.8 38.0 33.0 38.0 80-84 35.987 38.0 37.2 38.0 32.6 38.0 85-89 35.84315 38.0 37.0 38.0 31.8 38.0 90-94 35.64775 38.0 36.8 38.0 30.4 38.0 95-99 35.6518 38.0 37.0 38.0 31.0 38.0 100-104 35.50925 38.0 36.2 38.0 30.8 38.0 105-109 35.2016 38.0 36.0 38.0 28.8 38.0 110-114 34.8276 38.0 35.2 38.0 27.4 38.0 115-119 34.795700000000004 38.0 35.0 38.0 27.4 38.0 120-124 34.4474 38.0 35.0 38.0 25.2 38.0 125-129 34.280899999999995 38.0 35.0 38.0 24.4 38.0 130-134 33.8984 38.0 34.2 38.0 22.6 38.0 135-139 33.5249 38.0 34.0 38.0 21.8 38.0 140-144 32.9016 38.0 33.2 38.0 15.6 38.0 145-149 31.994249999999994 38.0 32.0 38.0 11.0 38.0 150-151 26.914375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 3.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 3.0 11 0.0 12 3.0 13 2.0 14 2.0 15 6.0 16 4.0 17 7.0 18 8.0 19 2.0 20 12.0 21 6.0 22 11.0 23 19.0 24 16.0 25 19.0 26 25.0 27 41.0 28 37.0 29 54.0 30 70.0 31 75.0 32 121.0 33 162.0 34 229.0 35 369.0 36 820.0 37 1860.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.28332083020755 17.62940735183796 12.05301325331333 37.034258564641156 2 27.131782945736433 25.23130782695674 29.532383095773945 18.104526131532882 3 23.386693346673336 25.86293146573287 26.93846923461731 23.81190595297649 4 25.26263131565783 31.86593296648324 20.335167583791897 22.536268134067033 5 26.638319159579787 32.641320660330166 20.810405202601302 19.909954977488745 6 22.125 36.575 20.825 20.474999999999998 7 22.125 20.325 33.800000000000004 23.75 8 23.925 23.025000000000002 25.25 27.800000000000004 9 23.474999999999998 23.325000000000003 28.050000000000004 25.15 10-14 26.055 26.645000000000003 23.200000000000003 24.099999999999998 15-19 25.805 25.3 24.48 24.415 20-24 25.180000000000003 26.14 24.88 23.799999999999997 25-29 25.691284564228212 25.631281564078208 24.751237561878096 23.926196309815488 30-34 25.16 26.015 24.25 24.575 35-39 25.47 25.624999999999996 24.335 24.57 40-44 25.569999999999997 25.55 24.474999999999998 24.404999999999998 45-49 25.240000000000002 25.540000000000003 24.36 24.86 50-54 25.695 25.445 24.865000000000002 23.995 55-59 25.705 25.330000000000002 24.39 24.575 60-64 25.3 25.080000000000002 25.1 24.52 65-69 25.39 25.115 24.73 24.765 70-74 25.85 25.040000000000003 24.665 24.445 75-79 25.7 24.895 24.9 24.505 80-84 25.655 25.435000000000002 24.715 24.195 85-89 26.145000000000003 25.335 24.37 24.15 90-94 26.045 25.3 24.785 23.87 95-99 25.865 25.490000000000002 25.0 23.645 100-104 26.150000000000002 25.295 24.165 24.39 105-109 25.290000000000003 25.86 24.9 23.95 110-114 25.775 25.785000000000004 24.745 23.695 115-119 26.545 25.319999999999997 24.945 23.189999999999998 120-124 25.905 25.985000000000003 24.25 23.86 125-129 26.545 25.629999999999995 24.305 23.52 130-134 26.340000000000003 25.965 24.23 23.465 135-139 26.365 26.115 24.005000000000003 23.515 140-144 26.375 25.785000000000004 25.290000000000003 22.55 145-149 25.755 25.985000000000003 24.595 23.665 150-151 27.15339417427178 25.790723840480062 24.428053506688336 22.62782847855982 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.5 26 1.0 27 3.0 28 4.5 29 4.5 30 8.0 31 8.0 32 6.5 33 15.5 34 22.5 35 26.5 36 44.5 37 57.5 38 70.5 39 100.5 40 126.5 41 149.5 42 165.0 43 174.5 44 184.0 45 199.0 46 209.5 47 202.0 48 185.0 49 169.5 50 160.0 51 142.0 52 129.0 53 117.5 54 100.0 55 93.5 56 96.0 57 94.5 58 88.0 59 90.0 60 83.5 61 69.5 62 65.0 63 62.5 64 72.5 65 65.0 66 51.0 67 52.5 68 43.5 69 40.5 70 37.0 71 26.5 72 23.5 73 17.5 74 11.0 75 7.0 76 5.5 77 5.5 78 4.5 79 3.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70426829268293 97.125 2 1.092479674796748 2.15 3 0.12703252032520324 0.375 4 0.05081300813008131 0.2 5 0.0 0.0 6 0.025406504065040653 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.36250000000000004 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 0.925 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.4875 0.0 0.0 0.0 0.0 130-131 1.775 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.45 0.0 0.0 0.0 0.0 138-139 2.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGTT 10 0.006830828 145.0 145 ATGAAAC 10 0.006830828 145.0 6 GGTTACA 10 0.006830828 145.0 5 >>END_MODULE Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047763 spots for SRR6958387.sra Written 1047763 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra Read 1047752 spots for SRR6958387.sra Written 1047752 spots for SRR6958387.sra SRR ids: ['SRR6958387.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p9u4n018 SRR6958387.sra spots: 20955051 blocks: [[1, 1047752], [1047753, 2095504], [2095505, 3143256], [3143257, 4191008], [4191009, 5238760], [5238761, 6286512], [6286513, 7334264], [7334265, 8382016], [8382017, 9429768], [9429769, 10477520], [10477521, 11525272], [11525273, 12573024], [12573025, 13620776], [13620777, 14668528], [14668529, 15716280], [15716281, 16764032], [16764033, 17811784], [17811785, 18859536], [18859537, 19907288], [19907289, 20955051]] SRR6958387 file size 7079278 SRR6958387 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958387 SRR6958387_1.fastq SRR6958387_2.fastq Input file: SRR6958387_1.fastq Paired file: SRR6958387_2.fastq trimmed: SRR6958387-trimmed-pair1.fastq, SRR6958387-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:41:39 2024 >> started Fri Dec 6 21:42:01 2024 >> done (21.821s) 20955051 read pairs processed; of these: 12690 ( 0.06%) short read pairs filtered out after trimming by size control 13448 ( 0.06%) empty read pairs filtered out after trimming by size control 20928913 (99.88%) read pairs available; of these: 7883387 (37.67%) trimmed read pairs available after processing 13045526 (62.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 2 0.00% 21 6 0.00% 22 4 0.00% 23 5 0.00% 24 8 0.00% 25 4 0.00% 26 6 0.00% 27 13 0.00% 28 12 0.00% 29 7 0.00% 30 6 0.00% 31 9 0.00% 32 11 0.00% 33 11 0.00% 34 7 0.00% 35 9 0.00% 36 15 0.00% 37 10 0.00% 38 15 0.00% 39 8 0.00% 40 10 0.00% 41 20 0.00% 42 16 0.00% 43 26 0.00% 44 17 0.00% 45 25 0.00% 46 13 0.00% 47 26 0.00% 48 35 0.00% 49 37 0.00% 50 33 0.00% 51 36 0.00% 52 40 0.00% 53 48 0.00% 54 54 0.00% 55 56 0.00% 56 76 0.00% 57 70 0.00% 58 76 0.00% 59 101 0.00% 60 98 0.00% 61 127 0.00% 62 122 0.00% 63 113 0.00% 64 135 0.00% 65 174 0.00% 66 171 0.00% 67 212 0.00% 68 201 0.00% 69 223 0.00% 70 229 0.00% 71 328 0.00% 72 322 0.00% 73 387 0.00% 74 417 0.00% 75 484 0.00% 76 546 0.00% 77 610 0.00% 78 679 0.00% 79 697 0.00% 80 834 0.00% 81 966 0.00% 82 1096 0.01% 83 1199 0.01% 84 1939 0.01% 85 2431 0.01% 86 2492 0.01% 87 2663 0.01% 88 2690 0.01% 89 2983 0.01% 90 3036 0.01% 91 3325 0.02% 92 3404 0.02% 93 3690 0.02% 94 4181 0.02% 95 4709 0.02% 96 4645 0.02% 97 4944 0.02% 98 5341 0.03% 99 5820 0.03% 100 6276 0.03% 101 6476 0.03% 102 7004 0.03% 103 7645 0.04% 104 8076 0.04% 105 8581 0.04% 106 9180 0.04% 107 9926 0.05% 108 10364 0.05% 109 11125 0.05% 110 11723 0.06% 111 12595 0.06% 112 13565 0.06% 113 14616 0.07% 114 15183 0.07% 115 16369 0.08% 116 17232 0.08% 117 18192 0.09% 118 19382 0.09% 119 20140 0.10% 120 20861 0.10% 121 22255 0.11% 122 23490 0.11% 123 24374 0.12% 124 26208 0.13% 125 27357 0.13% 126 29094 0.14% 127 30890 0.15% 128 32551 0.16% 129 34445 0.16% 130 36628 0.18% 131 38470 0.18% 132 40970 0.20% 133 43754 0.21% 134 46823 0.22% 135 49845 0.24% 136 53639 0.26% 137 56966 0.27% 138 61395 0.29% 139 66169 0.32% 140 72914 0.35% 141 79974 0.38% 142 89860 0.43% 143 102766 0.49% 144 121059 0.58% 145 147286 0.70% 146 186819 0.89% 147 258049 1.23% 148 401170 1.92% 149 823156 3.93% 150 4520842 21.60% 151 13045526 62.33% 20928913 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=16 prefix-density=1.05 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=40.23 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.8 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=16 prefix-density=0.79 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=29.95 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.9 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958387 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:42:43 Started mapping on | Dec 06 21:42:43 Finished on | Dec 06 21:44:46 Mapping speed, Million of reads per hour | 612.55 Number of input reads | 20928913 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20504759 Uniquely mapped reads % | 97.97% Average mapped length | 297.56 Number of splices: Total | 24395909 Number of splices: Annotated (sjdb) | 23091934 Number of splices: GT/AG | 24075059 Number of splices: GC/AG | 284558 Number of splices: AT/AC | 9077 Number of splices: Non-canonical | 27215 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.48 Insertion rate per base | 0.01% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 153404 % of reads mapped to multiple loci | 0.73% Number of reads mapped to too many loci | 11041 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.93% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 278687 278687 278687 N_multimapping 153404 153404 153404 N_noFeature 627240 19945735 781089 N_ambiguous 485559 2382 81974 UnstrandedReadsAssigned:19391960 PositiveStrandReadsAssigned:556642 NegativeStrandReadsAssigned:19641696 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958387 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958387-trimmed-pair1.fastq SRR6958387-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,928,913 reads, 19,628,137 reads pseudoaligned [quant] estimated average fragment length: 265.919 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR6958387.ke.tsv 35125 SRR6958387.se.tsv 88098 total ==> SRR6958387.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.601 0.00135206 0.000152301 PNS24247 1044 779.081 57.8912 5.62148 PNS24249 1928 1663.08 55.8827 2.54205 PNS24246 1044 779.081 57.8912 5.62148 PNS24248 1044 779.081 57.8912 5.62148 PNS24244 1471 1206.08 23.4423 1.47043 PNS24243 293 78.1964 0 0 KQK14069 1603 1338.08 4672.16 264.153 KQK14071 474 220.558 88.8178 30.4647 ==> SRR6958387.se.tsv <== BRADI_1g14170v3 5406 BRADI_1g53295v3 169 BRADI_1g59795v3 194 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 255 BRADI_1g74790v3 101 BRADI_1g09890v3 1 BRADI_1g77505v3 232 BRADI_1g48960v3 0 SRR6958387 completed mapping pipeline successfully