Starting /dee2/code/volunteer_pipeline.sh SRR6958388 current disk space = 1548920922112 free memory = 1600255332 SRR6958388 SRAfilesize 3a16ddfedd1bf5c0ed979389c572f5ab SRR6958388.sra SRR6958388.sra file validated SRR6958388 is paired end SRR6958388 is conventional basespace SRR6958388 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958388_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.9 33.0 28.0 33.0 18.0 34.0 2 30.83275 33.0 30.0 33.0 27.0 34.0 3 31.615 33.0 31.0 33.0 27.0 34.0 4 31.2365 33.0 32.0 33.0 28.0 34.0 5 32.17825 33.0 32.0 33.0 31.0 34.0 6 36.41275 38.0 37.0 38.0 34.0 38.0 7 36.85225 38.0 37.0 38.0 35.0 38.0 8 36.937 38.0 38.0 38.0 35.0 38.0 9 37.12225 38.0 38.0 38.0 36.0 38.0 10-14 37.1669 38.0 38.0 38.0 35.8 38.0 15-19 37.17155 38.0 38.0 38.0 36.2 38.0 20-24 37.288650000000004 38.0 38.0 38.0 36.6 38.0 25-29 37.15405 38.0 38.0 38.0 36.0 38.0 30-34 37.0529 38.0 38.0 38.0 36.0 38.0 35-39 36.8995 38.0 38.0 38.0 35.6 38.0 40-44 36.79945 38.0 38.0 38.0 34.8 38.0 45-49 36.983650000000004 38.0 38.0 38.0 35.6 38.0 50-54 36.854 38.0 38.0 38.0 35.0 38.0 55-59 36.6061 38.0 38.0 38.0 34.2 38.0 60-64 36.68835 38.0 38.0 38.0 34.6 38.0 65-69 36.7431 38.0 38.0 38.0 34.2 38.0 70-74 36.79255 38.0 38.0 38.0 34.6 38.0 75-79 36.54855 38.0 37.8 38.0 33.8 38.0 80-84 36.1533 38.0 37.0 38.0 32.6 38.0 85-89 35.9679 38.0 37.0 38.0 31.6 38.0 90-94 36.143100000000004 38.0 37.0 38.0 32.8 38.0 95-99 36.21275 38.0 37.0 38.0 33.0 38.0 100-104 35.9762 38.0 37.0 38.0 32.0 38.0 105-109 35.61625 38.0 36.0 38.0 30.2 38.0 110-114 35.52225 38.0 36.0 38.0 30.2 38.0 115-119 35.5303 38.0 36.0 38.0 30.6 38.0 120-124 35.2328 38.0 35.4 38.0 29.2 38.0 125-129 34.723499999999994 38.0 35.0 38.0 26.4 38.0 130-134 34.59665 38.0 35.0 38.0 26.6 38.0 135-139 34.21345 38.0 34.4 38.0 23.6 38.0 140-144 33.88119999999999 38.0 34.0 38.0 22.4 38.0 145-149 32.69154999999999 38.0 33.6 38.0 16.8 38.0 150-151 28.236875 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 0.0 20 1.0 21 1.0 22 5.0 23 8.0 24 11.0 25 14.0 26 22.0 27 25.0 28 43.0 29 54.0 30 74.0 31 94.0 32 130.0 33 168.0 34 241.0 35 442.0 36 849.0 37 1812.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.715179968701094 10.093896713615024 7.250912884715702 44.94001043296818 2 21.099999999999998 11.774999999999999 38.975 28.15 3 20.275000000000002 15.35 27.575 36.8 4 25.724999999999998 21.3 23.25 29.725 5 25.35633908477119 27.431857964491122 24.981245311327832 22.230557639409852 6 22.425 32.225 24.224999999999998 21.125 7 17.25 25.35 38.75 18.65 8 19.45 24.575 30.975 25.0 9 19.05 21.875 34.725 24.349999999999998 10-14 21.42 26.97 26.825 24.785 15-19 21.69 25.545 27.16 25.605 20-24 22.03 26.005 26.905 25.06 25-29 21.765 26.085 27.255000000000003 24.895 30-34 21.545 25.985000000000003 26.77 25.7 35-39 22.675 25.924999999999997 26.490000000000002 24.91 40-44 22.009999999999998 25.715 27.139999999999997 25.135 45-49 21.78 25.77 27.235 25.215 50-54 22.33 25.585 26.790000000000003 25.295 55-59 22.37 26.685 26.135 24.81 60-64 22.28 26.31 26.245 25.165 65-69 21.815 25.695 26.875 25.615 70-74 21.97 25.895000000000003 26.950000000000003 25.185000000000002 75-79 23.080000000000002 26.26 26.16 24.5 80-84 22.314999999999998 26.35 26.43 24.905 85-89 22.53 25.330000000000002 27.02 25.119999999999997 90-94 22.61 25.765 26.305 25.319999999999997 95-99 22.39 26.450000000000003 26.484999999999996 24.675 100-104 22.900000000000002 25.91 26.474999999999998 24.715 105-109 22.884999999999998 25.61 26.695 24.81 110-114 22.335 26.13 26.375 25.16 115-119 22.759999999999998 25.775 26.795 24.67 120-124 22.525000000000002 25.96 26.445 25.069999999999997 125-129 22.485 25.85 26.895000000000003 24.77 130-134 22.73 25.495 26.450000000000003 25.324999999999996 135-139 22.735 25.840000000000003 26.415 25.009999999999998 140-144 22.45 25.979999999999997 26.119999999999997 25.45 145-149 22.900000000000002 26.06 25.91 25.130000000000003 150-151 23.17118919594848 25.559584844316618 25.934725522070778 25.334500437664126 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 5.0 28 5.0 29 3.0 30 7.0 31 11.0 32 13.0 33 22.0 34 35.0 35 38.0 36 52.5 37 75.5 38 92.0 39 122.0 40 147.5 41 162.0 42 196.0 43 234.5 44 238.0 45 238.0 46 223.5 47 207.5 48 202.5 49 197.5 50 180.0 51 151.5 52 145.0 53 124.5 54 103.5 55 95.0 56 80.5 57 67.0 58 61.5 59 55.0 60 56.0 61 52.5 62 39.0 63 37.0 64 39.0 65 33.0 66 27.5 67 25.0 68 21.0 69 17.5 70 15.5 71 14.0 72 10.5 73 8.5 74 4.5 75 0.5 76 1.0 77 1.5 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.8999999999999999 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.4875 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.3125 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 3.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTCCG 10 0.006836113 144.9625 6 CGGGACT 10 0.006836113 144.9625 3 GGGACTG 10 0.006836113 144.9625 4 >>END_MODULE SRR6958388 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958388_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79075 33.0 33.0 34.0 32.0 34.0 2 32.70725 33.0 33.0 34.0 32.0 34.0 3 32.7005 33.0 33.0 34.0 32.0 34.0 4 32.63425 33.0 33.0 34.0 32.0 34.0 5 32.59025 33.0 33.0 34.0 32.0 34.0 6 36.829 38.0 38.0 38.0 35.0 38.0 7 36.66175 38.0 38.0 38.0 35.0 38.0 8 36.79575 38.0 38.0 38.0 35.0 38.0 9 36.54025 38.0 38.0 38.0 34.0 38.0 10-14 36.4791 38.0 38.0 38.0 34.2 38.0 15-19 36.406150000000004 38.0 38.0 38.0 33.6 38.0 20-24 36.67265 38.0 38.0 38.0 34.8 38.0 25-29 36.86505 38.0 38.0 38.0 35.0 38.0 30-34 36.81445000000001 38.0 38.0 38.0 35.0 38.0 35-39 36.7719 38.0 38.0 38.0 35.0 38.0 40-44 36.619600000000005 38.0 38.0 38.0 34.4 38.0 45-49 36.495549999999994 38.0 38.0 38.0 34.0 38.0 50-54 36.52715 38.0 38.0 38.0 34.0 38.0 55-59 36.55225 38.0 38.0 38.0 34.0 38.0 60-64 36.497699999999995 38.0 38.0 38.0 34.0 38.0 65-69 36.2928 38.0 37.8 38.0 33.6 38.0 70-74 36.1751 38.0 37.4 38.0 33.2 38.0 75-79 36.119949999999996 38.0 37.2 38.0 33.0 38.0 80-84 36.006049999999995 38.0 37.0 38.0 32.4 38.0 85-89 35.775650000000006 38.0 37.0 38.0 31.4 38.0 90-94 35.7 38.0 36.8 38.0 30.4 38.0 95-99 35.665699999999994 38.0 37.0 38.0 31.0 38.0 100-104 35.53294999999999 38.0 36.4 38.0 30.0 38.0 105-109 35.25865 38.0 36.0 38.0 28.8 38.0 110-114 34.78059999999999 38.0 35.2 38.0 26.6 38.0 115-119 34.7202 38.0 35.0 38.0 26.8 38.0 120-124 34.56585 38.0 35.0 38.0 26.2 38.0 125-129 34.346349999999994 38.0 34.8 38.0 24.8 38.0 130-134 33.89365 38.0 34.2 38.0 22.2 38.0 135-139 33.4656 38.0 34.0 38.0 21.0 38.0 140-144 32.989250000000006 38.0 33.2 38.0 18.2 38.0 145-149 32.06605 37.6 32.2 38.0 11.2 38.0 150-151 27.17175 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 0.0 11 2.0 12 1.0 13 0.0 14 1.0 15 3.0 16 5.0 17 4.0 18 5.0 19 5.0 20 11.0 21 5.0 22 11.0 23 14.0 24 20.0 25 19.0 26 30.0 27 42.0 28 47.0 29 68.0 30 84.0 31 96.0 32 126.0 33 170.0 34 243.0 35 375.0 36 787.0 37 1815.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.433108277069266 18.204551137784446 12.653163290822706 36.70917729432358 2 26.5081351689612 24.63078848560701 30.538172715894866 18.32290362953692 3 20.90112640801001 26.23279098873592 29.511889862327912 23.35419274092616 4 25.53191489361702 30.58823529411765 21.226533166458072 22.65331664580726 5 27.384230287859822 32.841051314142675 21.101376720901126 18.67334167709637 6 22.3 36.775000000000006 21.15 19.775000000000002 7 22.6 20.325 35.525 21.55 8 24.25 23.5 26.075 26.174999999999997 9 22.900000000000002 23.325000000000003 28.525 25.25 10-14 25.019999999999996 27.755000000000003 23.86 23.365 15-19 25.36 25.745 25.52 23.375 20-24 25.415 26.700000000000003 25.055 22.830000000000002 25-29 25.556277813890695 26.466323316165806 25.05125256262813 22.926146307315364 30-34 25.040000000000003 26.825 25.09 23.044999999999998 35-39 24.905 27.185 25.014999999999997 22.895 40-44 25.305 26.395000000000003 25.35 22.95 45-49 24.990000000000002 26.75 25.174999999999997 23.085 50-54 25.169999999999998 26.384999999999998 25.805 22.64 55-59 25.525 26.13 25.435000000000002 22.91 60-64 24.759999999999998 26.325 26.035000000000004 22.88 65-69 25.324999999999996 26.745 25.130000000000003 22.8 70-74 24.85 26.8 25.71 22.64 75-79 25.165 26.465 25.624999999999996 22.745 80-84 25.635 26.07 25.35 22.945 85-89 25.455 26.555 25.31 22.68 90-94 25.0 26.27 25.865 22.865 95-99 25.34 26.39 26.155 22.115000000000002 100-104 25.45 26.365 25.285000000000004 22.900000000000002 105-109 25.085 26.8 25.735000000000003 22.38 110-114 25.580000000000002 26.284999999999997 25.230000000000004 22.905 115-119 25.900000000000002 27.055 24.95 22.095000000000002 120-124 25.45 26.39 25.490000000000002 22.67 125-129 25.924999999999997 26.6 25.119999999999997 22.355 130-134 25.555 26.77 25.645 22.03 135-139 25.35 27.13 25.395 22.125 140-144 26.165 26.674999999999997 25.09 22.07 145-149 25.595000000000002 26.87 25.324999999999996 22.21 150-151 25.62210829060898 27.485306990121295 26.04726772539702 20.845316993872704 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 2.0 28 4.5 29 6.0 30 6.5 31 11.0 32 17.5 33 22.0 34 30.5 35 39.5 36 48.0 37 62.5 38 88.5 39 109.5 40 133.0 41 175.5 42 195.5 43 197.5 44 200.5 45 220.0 46 231.5 47 219.5 48 199.0 49 180.5 50 176.0 51 158.5 52 131.5 53 113.5 54 115.5 55 106.5 56 89.0 57 86.0 58 73.0 59 63.0 60 67.0 61 61.5 62 52.5 63 49.5 64 45.5 65 36.5 66 28.0 67 27.0 68 23.0 69 18.0 70 22.5 71 22.5 72 12.5 73 5.0 74 5.5 75 4.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.125 3 0.125 4 0.125 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7060010085728694 1.4000000000000001 3 0.07564296520423601 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.8999999999999999 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.4875 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.3125 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 2.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380865 spots for SRR6958388.sra Written 1380865 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra Read 1380862 spots for SRR6958388.sra Written 1380862 spots for SRR6958388.sra SRR ids: ['SRR6958388.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3mn37l36 SRR6958388.sra spots: 27617243 blocks: [[1, 1380862], [1380863, 2761724], [2761725, 4142586], [4142587, 5523448], [5523449, 6904310], [6904311, 8285172], [8285173, 9666034], [9666035, 11046896], [11046897, 12427758], [12427759, 13808620], [13808621, 15189482], [15189483, 16570344], [16570345, 17951206], [17951207, 19332068], [19332069, 20712930], [20712931, 22093792], [22093793, 23474654], [23474655, 24855516], [24855517, 26236378], [26236379, 27617243]] SRR6958388 file size 9336877 SRR6958388 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958388 SRR6958388_1.fastq SRR6958388_2.fastq Input file: SRR6958388_1.fastq Paired file: SRR6958388_2.fastq trimmed: SRR6958388-trimmed-pair1.fastq, SRR6958388-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:43:23 2024 >> started Fri Dec 6 21:43:54 2024 >> done (31.046s) 27617243 read pairs processed; of these: 13412 ( 0.05%) short read pairs filtered out after trimming by size control 9008 ( 0.03%) empty read pairs filtered out after trimming by size control 27594823 (99.92%) read pairs available; of these: 10298870 (37.32%) trimmed read pairs available after processing 17295953 (62.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 4 0.00% 21 7 0.00% 22 6 0.00% 23 10 0.00% 24 6 0.00% 25 13 0.00% 26 7 0.00% 27 15 0.00% 28 6 0.00% 29 9 0.00% 30 9 0.00% 31 7 0.00% 32 12 0.00% 33 6 0.00% 34 8 0.00% 35 9 0.00% 36 15 0.00% 37 23 0.00% 38 15 0.00% 39 22 0.00% 40 19 0.00% 41 25 0.00% 42 19 0.00% 43 28 0.00% 44 25 0.00% 45 27 0.00% 46 20 0.00% 47 35 0.00% 48 40 0.00% 49 37 0.00% 50 33 0.00% 51 35 0.00% 52 61 0.00% 53 61 0.00% 54 68 0.00% 55 71 0.00% 56 85 0.00% 57 89 0.00% 58 85 0.00% 59 109 0.00% 60 139 0.00% 61 151 0.00% 62 169 0.00% 63 198 0.00% 64 199 0.00% 65 225 0.00% 66 255 0.00% 67 290 0.00% 68 334 0.00% 69 364 0.00% 70 411 0.00% 71 440 0.00% 72 516 0.00% 73 597 0.00% 74 651 0.00% 75 713 0.00% 76 863 0.00% 77 931 0.00% 78 1050 0.00% 79 1139 0.00% 80 1350 0.00% 81 1450 0.01% 82 1748 0.01% 83 1973 0.01% 84 2889 0.01% 85 3387 0.01% 86 3613 0.01% 87 3913 0.01% 88 4170 0.02% 89 4496 0.02% 90 4494 0.02% 91 4812 0.02% 92 5117 0.02% 93 5534 0.02% 94 6135 0.02% 95 7077 0.03% 96 6514 0.02% 97 7386 0.03% 98 7884 0.03% 99 8382 0.03% 100 8782 0.03% 101 9477 0.03% 102 9944 0.04% 103 10591 0.04% 104 11302 0.04% 105 11891 0.04% 106 12766 0.05% 107 13696 0.05% 108 14898 0.05% 109 15337 0.06% 110 16352 0.06% 111 17192 0.06% 112 18197 0.07% 113 19562 0.07% 114 20177 0.07% 115 21755 0.08% 116 23160 0.08% 117 24380 0.09% 118 26094 0.09% 119 26845 0.10% 120 28119 0.10% 121 29217 0.11% 122 30949 0.11% 123 32661 0.12% 124 34481 0.12% 125 36625 0.13% 126 38129 0.14% 127 41228 0.15% 128 43120 0.16% 129 45284 0.16% 130 48162 0.17% 131 50722 0.18% 132 54351 0.20% 133 58096 0.21% 134 61810 0.22% 135 65937 0.24% 136 71156 0.26% 137 76295 0.28% 138 81958 0.30% 139 89329 0.32% 140 98375 0.36% 141 106640 0.39% 142 121329 0.44% 143 137381 0.50% 144 162034 0.59% 145 196458 0.71% 146 250458 0.91% 147 344529 1.25% 148 534213 1.94% 149 1080765 3.92% 150 5813503 21.07% 151 17295953 62.68% 27594823 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=23 prefix-density=0.41 prefix-fanout=2.8 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=72.99 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.7 sequence=TGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=21 prefix-density=0.35 prefix-fanout=3.1 sequence=CTTCGACAACACCATGGGAGGCTTTTACATCGCCCCGGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGCGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACCGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=88.00 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.3 sequence=TGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGA SRR6958388 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:44:44 Started mapping on | Dec 06 21:44:44 Finished on | Dec 06 21:48:14 Mapping speed, Million of reads per hour | 473.05 Number of input reads | 27594823 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 26797991 Uniquely mapped reads % | 97.11% Average mapped length | 297.43 Number of splices: Total | 32555840 Number of splices: Annotated (sjdb) | 30689466 Number of splices: GT/AG | 32124204 Number of splices: GC/AG | 379184 Number of splices: AT/AC | 14177 Number of splices: Non-canonical | 38275 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 293522 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 28804 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.05% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 512279 512279 512279 N_multimapping 293522 293522 293522 N_noFeature 1087013 26074069 1314023 N_ambiguous 602211 3444 107779 UnstrandedReadsAssigned:25108767 PositiveStrandReadsAssigned:720478 NegativeStrandReadsAssigned:25376189 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958388 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958388-trimmed-pair1.fastq SRR6958388-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,594,823 reads, 25,418,753 reads pseudoaligned [quant] estimated average fragment length: 272.561 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,249 rounds 52973 SRR6958388.ke.tsv 35125 SRR6958388.se.tsv 88098 total ==> SRR6958388.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.037 0 0 PNS24247 1044 772.439 75.5104 6.0106 PNS24249 1928 1656.44 41.9212 1.55609 PNS24246 1044 772.439 75.5104 6.0106 PNS24248 1044 772.439 75.5104 6.0106 PNS24244 1471 1199.44 46.5475 2.38613 PNS24243 293 78.8445 0 0 KQK14069 1603 1331.44 4161.43 192.175 KQK14071 474 218.432 64.1923 18.0694 ==> SRR6958388.se.tsv <== BRADI_1g14170v3 4909 BRADI_1g53295v3 454 BRADI_1g59795v3 440 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 466 BRADI_1g74790v3 131 BRADI_1g09890v3 0 BRADI_1g77505v3 378 BRADI_1g48960v3 0 SRR6958388 completed mapping pipeline successfully