Starting /dee2/code/volunteer_pipeline.sh SRR6958389 current disk space = 1548904701952 free memory = 1603634488 SRR6958389 SRAfilesize 08f3d406334a298aa5a9c6a4b932407f SRR6958389.sra SRR6958389.sra file validated SRR6958389 is paired end SRR6958389 is conventional basespace SRR6958389 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958389_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.14575 25.0 18.0 32.0 18.0 33.0 2 29.17675 30.0 27.0 33.0 25.0 33.0 3 28.77325 31.0 27.0 33.0 18.0 33.0 4 29.90475 31.0 29.0 33.0 25.0 33.0 5 31.6395 33.0 32.0 33.0 30.0 33.0 6 35.92325 38.0 36.0 38.0 33.0 38.0 7 36.6145 38.0 37.0 38.0 34.0 38.0 8 36.97475 38.0 38.0 38.0 35.0 38.0 9 37.205 38.0 38.0 38.0 36.0 38.0 10-14 37.23725 38.0 38.0 38.0 36.4 38.0 15-19 37.309650000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.3592 38.0 38.0 38.0 37.0 38.0 25-29 37.239250000000006 38.0 38.0 38.0 36.6 38.0 30-34 37.115700000000004 38.0 38.0 38.0 36.4 38.0 35-39 37.00365000000001 38.0 38.0 38.0 35.8 38.0 40-44 36.893449999999994 38.0 38.0 38.0 35.4 38.0 45-49 37.02205 38.0 38.0 38.0 35.8 38.0 50-54 36.987849999999995 38.0 38.0 38.0 35.8 38.0 55-59 36.636 38.0 38.0 38.0 34.4 38.0 60-64 36.775099999999995 38.0 38.0 38.0 34.8 38.0 65-69 36.80970000000001 38.0 38.0 38.0 35.2 38.0 70-74 36.77700000000001 38.0 38.0 38.0 34.8 38.0 75-79 36.55694999999999 38.0 38.0 38.0 34.0 38.0 80-84 36.194399999999995 38.0 37.2 38.0 33.4 38.0 85-89 36.0778 38.0 37.0 38.0 32.6 38.0 90-94 36.1993 38.0 37.2 38.0 33.2 38.0 95-99 36.1504 38.0 37.0 38.0 33.4 38.0 100-104 36.12134999999999 38.0 37.0 38.0 33.0 38.0 105-109 35.723749999999995 38.0 36.4 38.0 31.4 38.0 110-114 35.376900000000006 38.0 35.8 38.0 29.2 38.0 115-119 35.2736 38.0 35.6 38.0 28.8 38.0 120-124 35.049949999999995 38.0 35.0 38.0 27.8 38.0 125-129 34.78425 38.0 35.0 38.0 27.4 38.0 130-134 34.49665 38.0 34.4 38.0 25.6 38.0 135-139 34.46060000000001 38.0 35.0 38.0 26.0 38.0 140-144 33.6684 38.0 33.8 38.0 21.0 38.0 145-149 32.09375000000001 36.8 32.8 38.0 11.6 38.0 150-151 27.789375 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 3.0 16 1.0 17 0.0 18 1.0 19 4.0 20 0.0 21 1.0 22 1.0 23 7.0 24 6.0 25 13.0 26 16.0 27 42.0 28 50.0 29 51.0 30 74.0 31 79.0 32 103.0 33 186.0 34 268.0 35 435.0 36 1002.0 37 1652.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.033578174186776 10.099685204616998 14.428121720881427 44.438614900314796 2 22.8 11.25 35.675000000000004 30.275000000000002 3 19.85 14.224999999999998 26.525 39.4 4 24.4 19.7 25.05 30.85 5 26.244683512634477 25.268951713785338 24.26820115086315 24.218163622717036 6 24.375 30.049999999999997 22.825 22.75 7 19.25 25.575 35.825 19.35 8 20.825 24.5 29.45 25.224999999999998 9 20.225 22.0 33.15 24.625 10-14 22.650000000000002 25.569999999999997 26.38 25.4 15-19 22.825 24.87 26.21 26.095000000000002 20-24 23.044999999999998 25.635 26.085 25.235000000000003 25-29 22.625 25.41 25.97 25.995 30-34 22.220000000000002 25.805 25.790000000000003 26.185000000000002 35-39 23.125 25.06 26.08 25.735000000000003 40-44 23.105 25.185000000000002 25.695 26.015 45-49 23.080000000000002 25.395 25.564999999999998 25.96 50-54 23.03 25.295 25.590000000000003 26.085 55-59 23.674999999999997 25.25 25.39 25.685000000000002 60-64 22.665 24.765 25.595000000000002 26.974999999999998 65-69 23.855 24.7 25.775 25.669999999999998 70-74 23.150000000000002 24.7 25.88 26.27 75-79 23.485 24.915000000000003 25.56 26.040000000000003 80-84 22.650000000000002 25.105 26.125 26.119999999999997 85-89 23.97 24.965 25.069999999999997 25.995 90-94 23.705000000000002 24.959999999999997 25.64 25.695 95-99 23.580000000000002 24.474999999999998 25.874999999999996 26.07 100-104 24.025 24.415 25.72 25.840000000000003 105-109 23.165 24.37 25.935000000000002 26.529999999999998 110-114 23.59 24.69 26.345000000000002 25.374999999999996 115-119 23.244999999999997 24.45 26.229999999999997 26.075 120-124 23.595 24.665 25.495 26.245 125-129 23.265 24.79 25.629999999999995 26.314999999999998 130-134 23.474999999999998 24.83 25.264999999999997 26.43 135-139 23.865 24.915000000000003 25.61 25.61 140-144 23.44 24.69 25.21 26.66 145-149 23.635 24.57 25.974999999999998 25.82 150-151 23.74577755536094 24.233704491430004 25.910171399974978 26.11034655323408 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.5 28 2.5 29 3.5 30 4.5 31 7.0 32 16.0 33 19.0 34 16.5 35 24.0 36 40.0 37 61.5 38 79.5 39 88.0 40 112.0 41 145.0 42 179.0 43 202.0 44 197.5 45 188.5 46 198.0 47 211.0 48 200.0 49 197.0 50 191.0 51 164.5 52 141.0 53 126.5 54 118.5 55 102.5 56 92.5 57 86.5 58 78.5 59 78.5 60 70.0 61 59.5 62 51.0 63 51.0 64 58.0 65 57.5 66 52.5 67 40.0 68 33.5 69 32.0 70 30.5 71 26.0 72 18.0 73 15.0 74 9.0 75 5.0 76 4.5 77 2.5 78 1.5 79 1.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.7 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.7374999999999998 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.8875 0.0 0.0 0.0 0.0 132-133 3.15 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 3.9000000000000004 0.0 0.0 0.0 0.0 138-139 4.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCTTG 10 0.006590799 146.72151 5 GGCTTCA 10 0.006590799 146.72151 2 >>END_MODULE SRR6958389 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958389_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87675 33.0 33.0 34.0 32.0 34.0 2 32.846 33.0 33.0 34.0 32.0 34.0 3 32.745 33.0 33.0 34.0 32.0 34.0 4 32.744 33.0 33.0 34.0 32.0 34.0 5 32.86675 34.0 33.0 34.0 32.0 34.0 6 36.95125 38.0 38.0 38.0 36.0 38.0 7 36.75975 38.0 38.0 38.0 35.0 38.0 8 36.851 38.0 38.0 38.0 35.0 38.0 9 36.83 38.0 38.0 38.0 35.0 38.0 10-14 36.68925 38.0 38.0 38.0 34.8 38.0 15-19 36.6133 38.0 38.0 38.0 34.4 38.0 20-24 36.7758 38.0 38.0 38.0 35.2 38.0 25-29 36.863 38.0 38.0 38.0 35.6 38.0 30-34 36.9564 38.0 38.0 38.0 35.6 38.0 35-39 36.7496 38.0 38.0 38.0 34.8 38.0 40-44 36.700900000000004 38.0 38.0 38.0 34.8 38.0 45-49 36.6628 38.0 38.0 38.0 34.8 38.0 50-54 36.659949999999995 38.0 38.0 38.0 34.0 38.0 55-59 36.61505 38.0 38.0 38.0 34.6 38.0 60-64 36.6641 38.0 38.0 38.0 34.8 38.0 65-69 36.3736 38.0 38.0 38.0 33.8 38.0 70-74 36.267 38.0 38.0 38.0 33.2 38.0 75-79 36.062400000000004 38.0 37.6 38.0 32.2 38.0 80-84 35.9822 38.0 37.4 38.0 32.8 38.0 85-89 35.82815000000001 38.0 37.0 38.0 31.8 38.0 90-94 35.696349999999995 38.0 37.0 38.0 30.8 38.0 95-99 35.6361 38.0 37.0 38.0 31.0 38.0 100-104 35.49205 38.0 36.2 38.0 30.2 38.0 105-109 35.1937 38.0 35.8 38.0 28.4 38.0 110-114 34.972500000000004 38.0 35.6 38.0 27.4 38.0 115-119 34.772800000000004 38.0 35.0 38.0 26.6 38.0 120-124 34.602000000000004 38.0 35.0 38.0 26.0 38.0 125-129 34.47325 38.0 35.0 38.0 24.6 38.0 130-134 34.13465 38.0 34.6 38.0 23.4 38.0 135-139 33.440549999999995 38.0 34.0 38.0 20.2 38.0 140-144 32.90885 38.0 33.2 38.0 16.8 38.0 145-149 31.84315 38.0 31.4 38.0 11.0 38.0 150-151 27.472875000000002 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 0.0 5 0.0 6 1.0 7 2.0 8 0.0 9 1.0 10 1.0 11 0.0 12 2.0 13 3.0 14 6.0 15 1.0 16 2.0 17 5.0 18 5.0 19 6.0 20 7.0 21 3.0 22 16.0 23 14.0 24 11.0 25 33.0 26 28.0 27 33.0 28 50.0 29 70.0 30 78.0 31 100.0 32 96.0 33 157.0 34 230.0 35 374.0 36 749.0 37 1909.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.3911955977989 17.133566783391696 13.306653326663332 37.16858429214607 2 29.257314328582147 23.280820205051263 26.581645411352838 20.880220055013755 3 23.13656828414207 25.68784392196098 27.538769384692348 23.6368184092046 4 24.356089022255563 29.9074768692173 21.005251312828207 24.731182795698924 5 29.089544772386194 31.49074537268634 19.734867433716857 19.684842421210604 6 23.225 36.65 20.9 19.225 7 23.549999999999997 20.674999999999997 32.800000000000004 22.975 8 23.474999999999998 23.3 25.4 27.825 9 24.125 22.325 28.449999999999996 25.1 10-14 26.075 26.015 23.11 24.8 15-19 25.695 25.580000000000002 24.42 24.305 20-24 25.395 25.685000000000002 24.465 24.455 25-29 25.81 25.41 23.84 24.94 30-34 26.1 26.040000000000003 24.11 23.75 35-39 26.240000000000002 25.77 23.575 24.415 40-44 26.090000000000003 25.775 23.990000000000002 24.145 45-49 25.86 25.605 24.18 24.355 50-54 26.290000000000003 26.115 23.91 23.685000000000002 55-59 26.41 25.259999999999998 24.095 24.235 60-64 25.635 25.490000000000002 24.5 24.375 65-69 25.985000000000003 25.095 25.03 23.89 70-74 26.700000000000003 25.080000000000002 24.525 23.695 75-79 26.35 25.590000000000003 24.25 23.810000000000002 80-84 25.990000000000002 25.985000000000003 24.51 23.515 85-89 26.515 24.945 24.88 23.66 90-94 26.185000000000002 26.295 23.91 23.61 95-99 26.5 25.865 24.13 23.505000000000003 100-104 26.955000000000002 25.419999999999998 24.205 23.419999999999998 105-109 26.275 25.995 24.044999999999998 23.685000000000002 110-114 25.82 26.275 24.490000000000002 23.415 115-119 26.6 25.5 24.135 23.765 120-124 27.165 25.380000000000003 24.295 23.16 125-129 26.58 25.615 24.310000000000002 23.494999999999997 130-134 26.729999999999997 25.705 24.37 23.195 135-139 26.895000000000003 25.64 24.48 22.985 140-144 26.950000000000003 25.685000000000002 24.34 23.025000000000002 145-149 26.815 25.47 24.395 23.32 150-151 27.086200425372205 26.98611284874265 23.595646190416613 22.332040535468533 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.5 26 2.0 27 1.0 28 2.5 29 3.5 30 3.0 31 5.0 32 10.5 33 11.0 34 14.5 35 20.0 36 33.0 37 55.0 38 75.0 39 94.5 40 116.5 41 143.5 42 165.5 43 173.0 44 185.0 45 201.0 46 190.0 47 184.5 48 183.0 49 181.5 50 184.5 51 171.0 52 136.0 53 113.5 54 110.5 55 100.0 56 95.5 57 94.0 58 85.0 59 87.0 60 92.5 61 75.5 62 67.5 63 74.5 64 70.0 65 57.0 66 56.0 67 53.0 68 47.5 69 47.0 70 36.0 71 24.5 72 18.0 73 12.5 74 10.5 75 9.0 76 6.0 77 4.5 78 3.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.05 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.41755997958141 96.39999999999999 2 1.3016845329249618 2.55 3 0.17866258295048493 0.525 4 0.025523226135783564 0.1 5 0.05104645227156713 0.25 6 0.0 0.0 7 0.025523226135783564 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 7 0.17500000000000002 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.7374999999999998 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.1500000000000004 0.0 0.0 0.0 0.0 128-129 2.5375 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.175 0.0 0.0 0.0 0.0 134-135 3.6375 0.0 0.0 0.0 0.0 136-137 3.925 0.0 0.0 0.0 0.0 138-139 4.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342306 spots for SRR6958389.sra Written 1342306 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra Read 1342303 spots for SRR6958389.sra Written 1342303 spots for SRR6958389.sra SRR ids: ['SRR6958389.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vfeliufs SRR6958389.sra spots: 26846063 blocks: [[1, 1342303], [1342304, 2684606], [2684607, 4026909], [4026910, 5369212], [5369213, 6711515], [6711516, 8053818], [8053819, 9396121], [9396122, 10738424], [10738425, 12080727], [12080728, 13423030], [13423031, 14765333], [14765334, 16107636], [16107637, 17449939], [17449940, 18792242], [18792243, 20134545], [20134546, 21476848], [21476849, 22819151], [22819152, 24161454], [24161455, 25503757], [25503758, 26846063]] SRR6958389 file size 9075549 SRR6958389 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958389 SRR6958389_1.fastq SRR6958389_2.fastq Input file: SRR6958389_1.fastq Paired file: SRR6958389_2.fastq trimmed: SRR6958389-trimmed-pair1.fastq, SRR6958389-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:51:06 2024 >> started Fri Dec 6 21:51:34 2024 >> done (27.985s) 26846063 read pairs processed; of these: 17130 ( 0.06%) short read pairs filtered out after trimming by size control 13413 ( 0.05%) empty read pairs filtered out after trimming by size control 26815520 (99.89%) read pairs available; of these: 9911675 (36.96%) trimmed read pairs available after processing 16903845 (63.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 4 0.00% 21 7 0.00% 22 8 0.00% 23 7 0.00% 24 7 0.00% 25 10 0.00% 26 6 0.00% 27 4 0.00% 28 7 0.00% 29 8 0.00% 30 11 0.00% 31 7 0.00% 32 16 0.00% 33 12 0.00% 34 12 0.00% 35 15 0.00% 36 14 0.00% 37 13 0.00% 38 11 0.00% 39 16 0.00% 40 18 0.00% 41 29 0.00% 42 20 0.00% 43 16 0.00% 44 29 0.00% 45 22 0.00% 46 28 0.00% 47 28 0.00% 48 35 0.00% 49 31 0.00% 50 42 0.00% 51 50 0.00% 52 64 0.00% 53 63 0.00% 54 57 0.00% 55 87 0.00% 56 72 0.00% 57 105 0.00% 58 117 0.00% 59 126 0.00% 60 99 0.00% 61 166 0.00% 62 192 0.00% 63 230 0.00% 64 281 0.00% 65 251 0.00% 66 258 0.00% 67 318 0.00% 68 301 0.00% 69 348 0.00% 70 474 0.00% 71 502 0.00% 72 495 0.00% 73 562 0.00% 74 653 0.00% 75 731 0.00% 76 841 0.00% 77 925 0.00% 78 1033 0.00% 79 1110 0.00% 80 1262 0.00% 81 1420 0.01% 82 1677 0.01% 83 1811 0.01% 84 2783 0.01% 85 3370 0.01% 86 3849 0.01% 87 4195 0.02% 88 4537 0.02% 89 4717 0.02% 90 5224 0.02% 91 5457 0.02% 92 5384 0.02% 93 5767 0.02% 94 6391 0.02% 95 6577 0.02% 96 7025 0.03% 97 7759 0.03% 98 8176 0.03% 99 8548 0.03% 100 9194 0.03% 101 9783 0.04% 102 10172 0.04% 103 11208 0.04% 104 11776 0.04% 105 12504 0.05% 106 13161 0.05% 107 14455 0.05% 108 15548 0.06% 109 16384 0.06% 110 17155 0.06% 111 18026 0.07% 112 19163 0.07% 113 20580 0.08% 114 21606 0.08% 115 23917 0.09% 116 24328 0.09% 117 25773 0.10% 118 27400 0.10% 119 28487 0.11% 120 30181 0.11% 121 30868 0.12% 122 32524 0.12% 123 34881 0.13% 124 36670 0.14% 125 38396 0.14% 126 40201 0.15% 127 42766 0.16% 128 44420 0.17% 129 47310 0.18% 130 49621 0.19% 131 52776 0.20% 132 55421 0.21% 133 59429 0.22% 134 62696 0.23% 135 66236 0.25% 136 70901 0.26% 137 75414 0.28% 138 80960 0.30% 139 87990 0.33% 140 95448 0.36% 141 103305 0.39% 142 115033 0.43% 143 131293 0.49% 144 152580 0.57% 145 186147 0.69% 146 238692 0.89% 147 313677 1.17% 148 487927 1.82% 149 1026576 3.83% 150 5563772 20.75% 151 16903845 63.04% 26815520 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=17 prefix-density=0.63 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=31.59 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.9 sequence=CACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTTG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=4.24 fanout-score-rank=21 prefix-density=0.42 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=34.98 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.3 sequence=GTGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAGA SRR6958389 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:52:22 Started mapping on | Dec 06 21:52:23 Finished on | Dec 06 21:55:24 Mapping speed, Million of reads per hour | 533.35 Number of input reads | 26815520 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 25672837 Uniquely mapped reads % | 95.74% Average mapped length | 297.28 Number of splices: Total | 30904532 Number of splices: Annotated (sjdb) | 29177545 Number of splices: GT/AG | 30501245 Number of splices: GC/AG | 358739 Number of splices: AT/AC | 12621 Number of splices: Non-canonical | 31927 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354220 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 51540 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.40% % of reads unmapped: other | 1.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 799367 799367 799367 N_multimapping 354220 354220 354220 N_noFeature 789450 24953051 995263 N_ambiguous 615559 3305 103130 UnstrandedReadsAssigned:24267828 PositiveStrandReadsAssigned:716481 NegativeStrandReadsAssigned:24574444 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958389 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958389-trimmed-pair1.fastq SRR6958389-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,815,520 reads, 24,616,054 reads pseudoaligned [quant] estimated average fragment length: 263.268 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR6958389.ke.tsv 35125 SRR6958389.se.tsv 88098 total ==> SRR6958389.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 674.112 0 0 PNS24247 1044 781.732 83.771 6.03628 PNS24249 1928 1665.73 67.7829 2.29218 PNS24246 1044 781.732 83.771 6.03628 PNS24248 1044 781.732 83.771 6.03628 PNS24244 1471 1208.73 23.9042 1.11398 PNS24243 293 81.7229 0 0 KQK14069 1603 1340.73 8203.16 344.646 KQK14071 474 225.217 98.3318 24.5939 ==> SRR6958389.se.tsv <== BRADI_1g14170v3 8926 BRADI_1g53295v3 234 BRADI_1g59795v3 246 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 318 BRADI_1g74790v3 167 BRADI_1g09890v3 0 BRADI_1g77505v3 379 BRADI_1g48960v3 0 SRR6958389 completed mapping pipeline successfully