Starting /dee2/code/volunteer_pipeline.sh SRR6958390 current disk space = 1548915351552 free memory = 1603301972 SRR6958390 SRAfilesize 9e1ccad905f8a2bc9e86b362771068c3 SRR6958390.sra SRR6958390.sra file validated SRR6958390 is paired end SRR6958390 is conventional basespace SRR6958390 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958390_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.68 18.0 18.0 25.0 18.0 32.0 2 27.66825 29.0 27.0 31.0 18.0 33.0 3 30.97875 31.0 30.0 33.0 27.0 33.0 4 32.3195 33.0 32.0 33.0 32.0 33.0 5 32.73275 33.0 33.0 33.0 32.0 34.0 6 37.18 38.0 38.0 38.0 36.0 38.0 7 37.28425 38.0 38.0 38.0 36.0 38.0 8 37.534 38.0 38.0 38.0 37.0 38.0 9 37.6715 38.0 38.0 38.0 38.0 38.0 10-14 37.6244 38.0 38.0 38.0 38.0 38.0 15-19 37.5594 38.0 38.0 38.0 38.0 38.0 20-24 37.6755 38.0 38.0 38.0 38.0 38.0 25-29 37.66664999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.59475 38.0 38.0 38.0 38.0 38.0 35-39 37.5755 38.0 38.0 38.0 38.0 38.0 40-44 37.53605 38.0 38.0 38.0 38.0 38.0 45-49 37.5458 38.0 38.0 38.0 38.0 38.0 50-54 37.5409 38.0 38.0 38.0 38.0 38.0 55-59 37.4527 38.0 38.0 38.0 38.0 38.0 60-64 37.2373 38.0 38.0 38.0 36.8 38.0 65-69 37.44565 38.0 38.0 38.0 37.6 38.0 70-74 37.4353 38.0 38.0 38.0 37.8 38.0 75-79 37.34845 38.0 38.0 38.0 37.0 38.0 80-84 37.38135 38.0 38.0 38.0 37.0 38.0 85-89 36.2487 38.0 37.0 38.0 31.2 38.0 90-94 37.14110000000001 38.0 38.0 38.0 36.2 38.0 95-99 37.1482 38.0 38.0 38.0 36.2 38.0 100-104 37.0807 38.0 38.0 38.0 36.0 38.0 105-109 36.92595 38.0 38.0 38.0 35.4 38.0 110-114 36.514050000000005 38.0 37.8 38.0 33.8 38.0 115-119 36.825149999999994 38.0 38.0 38.0 35.0 38.0 120-124 36.74825 38.0 38.0 38.0 34.8 38.0 125-129 36.557500000000005 38.0 38.0 38.0 34.6 38.0 130-134 36.42530000000001 38.0 38.0 38.0 34.0 38.0 135-139 36.31195 38.0 38.0 38.0 33.4 38.0 140-144 35.623599999999996 38.0 37.2 38.0 30.6 38.0 145-149 34.182 38.0 34.2 38.0 24.8 38.0 150-151 31.647875 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 2.0 22 2.0 23 4.0 24 3.0 25 3.0 26 10.0 27 4.0 28 17.0 29 23.0 30 29.0 31 37.0 32 57.0 33 65.0 34 120.0 35 206.0 36 643.0 37 2768.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 50.10598834128246 14.705882352941178 5.0344462109168 30.153683094859566 2 24.825 12.4 31.15 31.624999999999996 3 20.775 19.175 27.025 33.025 4 25.8 25.7 23.275000000000002 25.224999999999998 5 25.5 30.625000000000004 22.8 21.075 6 21.025 33.35 23.7 21.925 7 17.625 22.975 40.8 18.6 8 18.775 22.525000000000002 29.75 28.95 9 19.675 21.224999999999998 33.1 26.0 10-14 22.845 27.02 25.56 24.575 15-19 22.98 25.840000000000003 25.765 25.415 20-24 22.759999999999998 26.02 25.895000000000003 25.324999999999996 25-29 22.975 25.91 25.605 25.509999999999998 30-34 22.67 25.590000000000003 26.169999999999998 25.569999999999997 35-39 22.400000000000002 26.445 25.419999999999998 25.735000000000003 40-44 23.105 25.525 25.77 25.6 45-49 22.732273227322732 25.687568756875688 25.66756675667567 25.91259125912591 50-54 23.415 25.669999999999998 25.905 25.009999999999998 55-59 23.03 25.235000000000003 26.07 25.665 60-64 23.849999999999998 25.180000000000003 25.679999999999996 25.290000000000003 65-69 23.2161608080404 25.91629581479074 25.426271313565678 25.441272063603183 70-74 23.91 25.319999999999997 25.89 24.88 75-79 23.400000000000002 25.855 25.235000000000003 25.509999999999998 80-84 23.145 25.82 25.845000000000002 25.19 85-89 23.185 25.355 25.729999999999997 25.729999999999997 90-94 23.625 25.064999999999998 25.785000000000004 25.525 95-99 23.189999999999998 25.525 25.39 25.895000000000003 100-104 22.985 26.119999999999997 25.629999999999995 25.264999999999997 105-109 23.71 25.36 25.705 25.224999999999998 110-114 23.525 25.775 24.985 25.715 115-119 23.580000000000002 26.295 24.605 25.52 120-124 23.26 25.7 25.230000000000004 25.81 125-129 23.845 25.790000000000003 24.9 25.465 130-134 23.75 25.669999999999998 25.035 25.545 135-139 23.215 26.064999999999998 24.695 26.025 140-144 22.84 25.685000000000002 25.180000000000003 26.295 145-149 23.419999999999998 26.11 24.615000000000002 25.855 150-151 23.97097460277743 26.11034655323408 24.634054797948206 25.284624046040282 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.0 27 2.5 28 6.0 29 7.0 30 10.5 31 14.5 32 18.5 33 24.0 34 31.5 35 44.0 36 63.0 37 68.0 38 77.0 39 105.0 40 138.5 41 165.0 42 176.5 43 194.0 44 214.5 45 211.5 46 188.5 47 194.5 48 203.0 49 182.0 50 168.0 51 151.0 52 126.5 53 105.0 54 99.0 55 97.0 56 85.5 57 85.5 58 82.0 59 61.5 60 49.0 61 55.5 62 58.0 63 49.0 64 42.5 65 41.5 66 38.5 67 38.5 68 37.0 69 36.0 70 32.0 71 28.0 72 25.5 73 19.5 74 15.0 75 9.0 76 6.5 77 6.0 78 4.5 79 2.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.4875 0.0 0.0 0.0 0.0 114-115 2.875 0.0 0.0 0.0 0.0 116-117 3.4 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.175000000000001 0.0 0.0 0.0 0.0 122-123 4.5375 0.0 0.0 0.0 0.0 124-125 5.0625 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 6.05 0.0 0.0 0.0 0.0 130-131 6.574999999999999 0.0 0.0 0.0 0.0 132-133 7.05 0.0 0.0 0.0 0.0 134-135 7.5875 0.0 0.0 0.0 0.0 136-137 8.149999999999999 0.0 0.0 0.0 0.0 138-139 8.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958390 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958390_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.59175 33.0 33.0 34.0 32.0 34.0 2 33.05125 34.0 33.0 34.0 32.0 34.0 3 33.04675 34.0 33.0 34.0 32.0 34.0 4 33.1195 34.0 33.0 34.0 33.0 34.0 5 32.84775 34.0 33.0 34.0 32.0 34.0 6 37.304 38.0 38.0 38.0 37.0 38.0 7 37.3975 38.0 38.0 38.0 38.0 38.0 8 37.3695 38.0 38.0 38.0 38.0 38.0 9 37.38175 38.0 38.0 38.0 38.0 38.0 10-14 37.142250000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.296800000000005 38.0 38.0 38.0 37.2 38.0 20-24 37.377300000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.07084999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.332899999999995 38.0 38.0 38.0 37.8 38.0 35-39 37.2144 38.0 38.0 38.0 37.8 38.0 40-44 36.974000000000004 38.0 38.0 38.0 36.2 38.0 45-49 36.9773 38.0 38.0 38.0 36.6 38.0 50-54 36.83135 38.0 38.0 38.0 35.4 38.0 55-59 37.220749999999995 38.0 38.0 38.0 37.2 38.0 60-64 37.22545 38.0 38.0 38.0 37.0 38.0 65-69 36.439800000000005 38.0 38.0 38.0 33.4 38.0 70-74 37.01215 38.0 38.0 38.0 36.6 38.0 75-79 37.102999999999994 38.0 38.0 38.0 37.0 38.0 80-84 36.98015 38.0 38.0 38.0 36.2 38.0 85-89 36.88355 38.0 38.0 38.0 36.0 38.0 90-94 36.7383 38.0 38.0 38.0 35.6 38.0 95-99 35.4596 38.0 36.6 38.0 27.8 38.0 100-104 36.58965 38.0 38.0 38.0 34.6 38.0 105-109 35.90505 38.0 37.2 38.0 31.4 38.0 110-114 36.4747 38.0 38.0 38.0 34.4 38.0 115-119 36.4236 38.0 38.0 38.0 34.2 38.0 120-124 35.171499999999995 38.0 36.2 38.0 28.2 38.0 125-129 35.7394 38.0 37.2 38.0 31.6 38.0 130-134 35.78975 38.0 38.0 38.0 32.0 38.0 135-139 34.2995 38.0 34.4 38.0 25.2 38.0 140-144 34.857299999999995 38.0 36.0 38.0 29.8 38.0 145-149 33.55329999999999 38.0 34.4 38.0 20.8 38.0 150-151 28.82875 34.5 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 2.0 5 2.0 6 0.0 7 0.0 8 2.0 9 1.0 10 0.0 11 2.0 12 1.0 13 2.0 14 0.0 15 3.0 16 0.0 17 2.0 18 3.0 19 3.0 20 4.0 21 3.0 22 8.0 23 11.0 24 10.0 25 11.0 26 12.0 27 10.0 28 28.0 29 32.0 30 39.0 31 49.0 32 68.0 33 98.0 34 142.0 35 248.0 36 657.0 37 2535.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.811952988247064 20.330082520630157 7.851962990747687 24.006001500375092 2 30.65 20.9 27.950000000000003 20.5 3 22.775000000000002 25.2 30.225 21.8 4 29.375 30.0 20.3 20.325 5 27.925 33.925 17.575 20.575 6 23.425 36.975 19.1 20.5 7 22.900000000000002 18.725 35.875 22.5 8 22.650000000000002 23.7 24.125 29.525000000000002 9 24.281070267566893 21.680420105026258 28.432108027006752 25.6064016004001 10-14 25.215 26.715 23.474999999999998 24.595 15-19 25.65128256412821 24.956247812390618 25.34126706335317 24.051202560128008 20-24 25.605 25.365 25.06 23.97 25-29 25.631281564078208 25.476273813690685 24.696234811740585 24.196209810490522 30-34 25.025 25.585 25.069999999999997 24.32 35-39 25.227522752275227 25.532553255325535 25.06250625062506 24.17741774177418 40-44 25.04625231261563 25.206260313015648 25.12625631281564 24.62123106155308 45-49 25.76128806440322 25.631281564078208 24.956247812390618 23.651182559127957 50-54 25.047504750475046 25.432543254325434 25.347534753475347 24.172417241724172 55-59 25.333800070010504 25.328799319897982 25.183777566634998 24.15362304345652 60-64 25.85 25.055 25.185000000000002 23.91 65-69 26.06 25.474999999999998 24.51 23.955000000000002 70-74 26.035000000000004 25.069999999999997 24.805 24.09 75-79 26.312631263126313 25.12251225122512 25.032503250325032 23.532353235323534 80-84 25.75628781439072 25.636281814090705 25.101255062753136 23.50617530876544 85-89 25.946297314865742 25.18125906295315 25.501275063753187 23.37116855842792 90-94 25.92629631481574 25.206260313015648 25.12625631281564 23.741187059352967 95-99 25.595000000000002 25.545 24.945 23.915 100-104 25.259999999999998 25.66 25.055 24.025 105-109 26.26131306565328 25.386269313465675 25.116255812790637 23.236161808090404 110-114 26.5976597659766 26.007600760076006 24.892489248924893 22.5022502250225 115-119 26.064999999999998 25.75 24.955 23.23 120-124 26.540000000000003 25.285000000000004 25.069999999999997 23.105 125-129 26.540000000000003 26.015 24.855 22.59 130-134 26.6 25.77 25.1 22.53 135-139 27.11 25.895000000000003 24.505 22.49 140-144 26.945000000000004 26.369999999999997 24.485 22.2 145-149 27.68638431921596 25.806290314515728 24.366218310915546 22.14110705535277 150-151 27.806951737934483 25.78144536134033 24.518629657414355 21.892973243310827 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.5 24 1.0 25 0.5 26 1.5 27 4.0 28 5.5 29 6.5 30 9.0 31 12.0 32 15.5 33 17.5 34 26.0 35 34.5 36 50.5 37 69.0 38 86.0 39 97.0 40 116.5 41 148.5 42 168.0 43 189.5 44 204.5 45 197.0 46 185.0 47 182.5 48 187.0 49 178.0 50 143.5 51 126.5 52 120.0 53 118.0 54 107.5 55 89.5 56 88.0 57 85.0 58 84.0 59 73.0 60 66.5 61 71.5 62 70.5 63 64.5 64 63.0 65 59.0 66 57.5 67 57.0 68 47.5 69 42.0 70 36.5 71 32.0 72 27.0 73 25.5 74 18.5 75 7.0 76 5.0 77 6.0 78 4.0 79 1.5 80 1.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.01 40-44 0.005 45-49 0.005 50-54 0.01 55-59 0.015 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.005 85-89 0.005 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.5032712632108707 1.0 3 0.0 0.0 4 0.050327126321087066 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.2375 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 1.9875 0.0 0.0 0.0 0.0 110-111 2.2375 0.0 0.0 0.0 0.0 112-113 2.4875 0.0 0.0 0.0 0.0 114-115 2.85 0.0 0.0 0.0 0.0 116-117 3.3625 0.0 0.0 0.0 0.0 118-119 3.725 0.0 0.0 0.0 0.0 120-121 4.15 0.0 0.0 0.0 0.0 122-123 4.5125 0.0 0.0 0.0 0.0 124-125 5.0625 0.0 0.0 0.0 0.0 126-127 5.55 0.0 0.0 0.0 0.0 128-129 6.025 0.0 0.0 0.0 0.0 130-131 6.5375 0.0 0.0 0.0 0.0 132-133 6.9875 0.0 0.0 0.0 0.0 134-135 7.525 0.0 0.0 0.0 0.0 136-137 8.1125 0.0 0.0 0.0 0.0 138-139 8.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076550315 18.125 135-139 >>END_MODULE Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977251 spots for SRR6958390.sra Written 977251 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra Read 977249 spots for SRR6958390.sra Written 977249 spots for SRR6958390.sra SRR ids: ['SRR6958390.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8yeu979w SRR6958390.sra spots: 19544982 blocks: [[1, 977249], [977250, 1954498], [1954499, 2931747], [2931748, 3908996], [3908997, 4886245], [4886246, 5863494], [5863495, 6840743], [6840744, 7817992], [7817993, 8795241], [8795242, 9772490], [9772491, 10749739], [10749740, 11726988], [11726989, 12704237], [12704238, 13681486], [13681487, 14658735], [14658736, 15635984], [15635985, 16613233], [16613234, 17590482], [17590483, 18567731], [18567732, 19544982]] SRR6958390 file size 6601452 SRR6958390 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958390 SRR6958390_1.fastq SRR6958390_2.fastq Input file: SRR6958390_1.fastq Paired file: SRR6958390_2.fastq trimmed: SRR6958390-trimmed-pair1.fastq, SRR6958390-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:54:20 2024 >> started Fri Dec 6 21:54:44 2024 >> done (23.205s) 19544982 read pairs processed; of these: 20709 ( 0.11%) short read pairs filtered out after trimming by size control 19422 ( 0.10%) empty read pairs filtered out after trimming by size control 19504851 (99.79%) read pairs available; of these: 7510656 (38.51%) trimmed read pairs available after processing 11994195 (61.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 17 0.00% 20 9 0.00% 21 11 0.00% 22 12 0.00% 23 11 0.00% 24 11 0.00% 25 17 0.00% 26 16 0.00% 27 12 0.00% 28 26 0.00% 29 22 0.00% 30 11 0.00% 31 21 0.00% 32 16 0.00% 33 26 0.00% 34 22 0.00% 35 18 0.00% 36 25 0.00% 37 23 0.00% 38 16 0.00% 39 32 0.00% 40 43 0.00% 41 39 0.00% 42 42 0.00% 43 35 0.00% 44 42 0.00% 45 58 0.00% 46 64 0.00% 47 64 0.00% 48 68 0.00% 49 88 0.00% 50 99 0.00% 51 98 0.00% 52 124 0.00% 53 115 0.00% 54 130 0.00% 55 142 0.00% 56 182 0.00% 57 170 0.00% 58 210 0.00% 59 240 0.00% 60 298 0.00% 61 388 0.00% 62 410 0.00% 63 424 0.00% 64 482 0.00% 65 531 0.00% 66 554 0.00% 67 613 0.00% 68 736 0.00% 69 859 0.00% 70 1003 0.01% 71 1134 0.01% 72 1323 0.01% 73 1451 0.01% 74 1664 0.01% 75 1800 0.01% 76 2049 0.01% 77 2222 0.01% 78 2579 0.01% 79 2887 0.01% 80 3349 0.02% 81 3723 0.02% 82 4161 0.02% 83 4822 0.02% 84 6230 0.03% 85 7210 0.04% 86 7617 0.04% 87 8420 0.04% 88 8847 0.05% 89 9479 0.05% 90 10172 0.05% 91 11177 0.06% 92 12039 0.06% 93 12793 0.07% 94 13574 0.07% 95 14284 0.07% 96 14947 0.08% 97 15817 0.08% 98 16575 0.08% 99 17770 0.09% 100 18814 0.10% 101 20351 0.10% 102 22051 0.11% 103 23148 0.12% 104 24593 0.13% 105 25423 0.13% 106 26518 0.14% 107 27177 0.14% 108 28626 0.15% 109 29553 0.15% 110 30916 0.16% 111 32804 0.17% 112 34821 0.18% 113 36327 0.19% 114 38170 0.20% 115 39231 0.20% 116 40553 0.21% 117 41551 0.21% 118 41994 0.22% 119 43057 0.22% 120 44358 0.23% 121 46171 0.24% 122 47963 0.25% 123 50483 0.26% 124 52947 0.27% 125 54485 0.28% 126 56141 0.29% 127 56601 0.29% 128 57392 0.29% 129 57976 0.30% 130 60278 0.31% 131 60882 0.31% 132 64095 0.33% 133 66291 0.34% 134 69026 0.35% 135 72350 0.37% 136 73864 0.38% 137 75726 0.39% 138 77403 0.40% 139 80531 0.41% 140 83225 0.43% 141 88241 0.45% 142 94346 0.48% 143 101459 0.52% 144 112704 0.58% 145 127216 0.65% 146 148217 0.76% 147 184991 0.95% 148 261855 1.34% 149 540589 2.77% 150 3688322 18.91% 151 11994195 61.49% 19504851 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=6.44 fanout-score-rank=9 prefix-density=0.59 prefix-fanout=4.3 sequence=CCGCACTTGCAGCCTCCGTTCTCGGCTCCGGCGGCGGCG criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=18.99 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=7.0 sequence=GGCGCCGGCGAAGGAGCTCGTGGTGGACA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=27 prefix-density=0.65 prefix-fanout=1.6 sequence=CAAGTGCGGCAACGGCTGCGGAGGGTGCAAGATGTACCCAGAGATGATGGCCGAGGAGGCGACTTCTTCCCAGACACTCGTCATGGGCGTCGCGCCGCCGGCGACCAAGTCAGGCTTCGAGGCCGCCGCCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=125.36 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=6.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958390 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:55:26 Started mapping on | Dec 06 21:55:26 Finished on | Dec 06 21:57:18 Mapping speed, Million of reads per hour | 626.94 Number of input reads | 19504851 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18772718 Uniquely mapped reads % | 96.25% Average mapped length | 293.31 Number of splices: Total | 20300487 Number of splices: Annotated (sjdb) | 18994659 Number of splices: GT/AG | 19996185 Number of splices: GC/AG | 241765 Number of splices: AT/AC | 10815 Number of splices: Non-canonical | 51722 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234472 % of reads mapped to multiple loci | 1.20% Number of reads mapped to too many loci | 7001 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 515500 515500 515500 N_multimapping 234472 234472 234472 N_noFeature 916902 18240204 1099127 N_ambiguous 418371 2901 68224 UnstrandedReadsAssigned:17437445 PositiveStrandReadsAssigned:529613 NegativeStrandReadsAssigned:17605367 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958390 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958390-trimmed-pair1.fastq SRR6958390-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,504,851 reads, 17,595,972 reads pseudoaligned [quant] estimated average fragment length: 254.884 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR6958390.ke.tsv 35125 SRR6958390.se.tsv 88098 total ==> SRR6958390.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.899 5.4362e-07 6.75794e-08 PNS24247 1044 790.116 61.165 6.57184 PNS24249 1928 1674.12 83.7294 4.24588 PNS24246 1044 790.116 61.165 6.57184 PNS24248 1044 790.116 61.165 6.57184 PNS24244 1471 1217.12 32.7757 2.2861 PNS24243 293 98.598 0 0 KQK14069 1603 1349.12 2484.96 156.367 KQK14071 474 241.28 95.8288 33.7172 ==> SRR6958390.se.tsv <== BRADI_1g14170v3 2997 BRADI_1g53295v3 1872 BRADI_1g59795v3 150 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 612 BRADI_1g74790v3 179 BRADI_1g09890v3 0 BRADI_1g77505v3 353 BRADI_1g48960v3 0 SRR6958390 completed mapping pipeline successfully