Starting /dee2/code/volunteer_pipeline.sh SRR6958391 current disk space = 1548917092352 free memory = 1597957808 SRR6958391 SRAfilesize 5bda87f22fa03cee71220d5b82040bfb SRR6958391.sra SRR6958391.sra file validated SRR6958391 is paired end SRR6958391 is conventional basespace SRR6958391 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958391_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.6045 18.0 18.0 18.0 18.0 25.0 2 28.2495 28.0 27.0 30.0 27.0 31.0 3 30.4955 31.0 29.0 33.0 27.0 33.0 4 32.327 33.0 33.0 33.0 31.0 33.0 5 32.876 33.0 33.0 33.0 33.0 34.0 6 36.86775 38.0 37.0 38.0 35.0 38.0 7 37.24675 38.0 38.0 38.0 36.0 38.0 8 37.405 38.0 38.0 38.0 37.0 38.0 9 37.616 38.0 38.0 38.0 38.0 38.0 10-14 37.58385 38.0 38.0 38.0 37.8 38.0 15-19 37.5212 38.0 38.0 38.0 37.6 38.0 20-24 37.57235 38.0 38.0 38.0 37.8 38.0 25-29 37.59325 38.0 38.0 38.0 38.0 38.0 30-34 37.628750000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.330349999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.59355000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.474399999999996 38.0 38.0 38.0 37.6 38.0 50-54 37.41555 38.0 38.0 38.0 37.0 38.0 55-59 37.15865 38.0 38.0 38.0 36.2 38.0 60-64 37.418099999999995 38.0 38.0 38.0 37.2 38.0 65-69 36.920249999999996 38.0 37.8 38.0 35.0 38.0 70-74 37.0972 38.0 38.0 38.0 35.6 38.0 75-79 36.84955 38.0 37.8 38.0 34.8 38.0 80-84 37.21295 38.0 38.0 38.0 36.0 38.0 85-89 37.13675 38.0 38.0 38.0 36.0 38.0 90-94 37.0526 38.0 38.0 38.0 36.0 38.0 95-99 36.9345 38.0 38.0 38.0 35.4 38.0 100-104 36.805249999999994 38.0 38.0 38.0 35.0 38.0 105-109 36.611000000000004 38.0 38.0 38.0 34.2 38.0 110-114 36.55855 38.0 38.0 38.0 34.0 38.0 115-119 36.3914 38.0 38.0 38.0 34.0 38.0 120-124 36.16525 38.0 37.2 38.0 33.4 38.0 125-129 36.14999999999999 38.0 37.4 38.0 33.6 38.0 130-134 35.705499999999994 38.0 36.2 38.0 31.8 38.0 135-139 34.5861 38.0 34.4 38.0 25.4 38.0 140-144 30.867600000000003 34.4 25.2 38.0 19.6 38.0 145-149 33.812149999999995 38.0 33.0 38.0 24.4 38.0 150-151 29.18575 35.0 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 1.0 16 0.0 17 2.0 18 3.0 19 2.0 20 1.0 21 2.0 22 3.0 23 7.0 24 5.0 25 5.0 26 11.0 27 11.0 28 12.0 29 17.0 30 35.0 31 47.0 32 67.0 33 107.0 34 164.0 35 389.0 36 1262.0 37 1845.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.439618644067796 10.195974576271187 42.63771186440678 31.72669491525424 2 25.724999999999998 11.924999999999999 34.025 28.325 3 20.9 17.875 27.125 34.1 4 25.324999999999996 26.075 23.45 25.15 5 24.75 31.5 22.325 21.425 6 22.400000000000002 32.675 22.650000000000002 22.275 7 16.950000000000003 22.35 42.699999999999996 18.0 8 19.125 22.5 30.0 28.375 9 20.200000000000003 21.4 32.175 26.224999999999998 10-14 22.95 26.540000000000003 26.169999999999998 24.34 15-19 22.509999999999998 25.465 26.825 25.2 20-24 22.696134806740336 26.706335316765838 25.946297314865742 24.65123256162808 25-29 22.650000000000002 26.215 26.155 24.98 30-34 22.16 26.375 26.545 24.92 35-39 22.835 25.619999999999997 26.055 25.490000000000002 40-44 22.62 26.395000000000003 26.235000000000003 24.75 45-49 22.68 25.790000000000003 26.365 25.165 50-54 22.63 25.905 26.435 25.03 55-59 22.770000000000003 26.265 26.055 24.91 60-64 22.6 26.055 26.365 24.98 65-69 22.86 25.83 26.16 25.15 70-74 23.435 26.32 25.365 24.88 75-79 22.46 25.729999999999997 26.115 25.695 80-84 22.825 26.085 26.040000000000003 25.05 85-89 23.745 25.515 25.895000000000003 24.845 90-94 23.375 26.169999999999998 26.185000000000002 24.27 95-99 22.765 26.085 25.929999999999996 25.22 100-104 22.996149807490372 26.071303565178262 25.85129256462823 25.081254062703135 105-109 23.715 26.165 25.585 24.535 110-114 22.675 26.075 26.365 24.884999999999998 115-119 23.284313725490197 25.970388155262103 25.545218087234893 25.200080032012806 120-124 23.195 26.035000000000004 25.75 25.019999999999996 125-129 23.332499374530897 26.564923692769575 25.02877157868401 25.073805354015512 130-134 23.375 26.875 24.95 24.8 135-139 22.645 27.284999999999997 24.605 25.465 140-144 22.725 26.419999999999998 24.83 26.025 145-149 22.685 26.740000000000002 24.735 25.840000000000003 150-151 23.0625 26.150000000000002 25.15 25.637500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 2.5 27 4.0 28 4.0 29 7.0 30 11.0 31 14.5 32 18.5 33 22.0 34 34.5 35 48.5 36 59.5 37 76.5 38 90.5 39 115.0 40 148.0 41 163.0 42 181.5 43 203.5 44 215.0 45 223.5 46 224.0 47 233.5 48 221.0 49 181.5 50 160.0 51 144.0 52 124.0 53 119.0 54 109.5 55 91.5 56 85.0 57 77.0 58 72.5 59 68.0 60 58.5 61 52.5 62 53.5 63 45.5 64 39.0 65 37.5 66 31.5 67 24.5 68 18.0 69 15.5 70 14.5 71 12.5 72 7.0 73 8.0 74 8.5 75 6.5 76 5.5 77 3.0 78 1.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.6000000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.04 120-124 0.0 125-129 0.075 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.4779874213836478 0.95 3 0.07547169811320754 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.6375000000000002 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.1624999999999996 0.0 0.0 0.0 0.0 110-111 2.4625000000000004 0.0 0.0 0.0 0.0 112-113 2.825 0.0 0.0 0.0 0.0 114-115 3.25 0.0 0.0 0.0 0.0 116-117 3.6875 0.0 0.0 0.0 0.0 118-119 4.199999999999999 0.0 0.0 0.0 0.0 120-121 4.7 0.0 0.0 0.0 0.0 122-123 5.2 0.0 0.0 0.0 0.0 124-125 5.9 0.0 0.0 0.0 0.0 126-127 6.4125 0.0 0.0 0.0 0.0 128-129 7.0625 0.0 0.0 0.0 0.0 130-131 7.7125 0.0 0.0 0.0 0.0 132-133 8.325 0.0 0.0 0.0 0.0 134-135 8.75 0.0 0.0 0.0 0.0 136-137 9.524999999999999 0.0 0.0 0.0 0.0 138-139 10.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958391 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958391_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.194 33.0 33.0 34.0 33.0 34.0 2 33.292 34.0 33.0 34.0 33.0 34.0 3 33.343 34.0 33.0 34.0 33.0 34.0 4 33.34225 34.0 33.0 34.0 33.0 34.0 5 33.36775 34.0 33.0 34.0 33.0 34.0 6 37.56375 38.0 38.0 38.0 38.0 38.0 7 37.60275 38.0 38.0 38.0 38.0 38.0 8 37.553 38.0 38.0 38.0 38.0 38.0 9 37.56375 38.0 38.0 38.0 38.0 38.0 10-14 37.48495 38.0 38.0 38.0 38.0 38.0 15-19 37.022450000000006 38.0 38.0 38.0 35.6 38.0 20-24 37.429950000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.53165 38.0 38.0 38.0 38.0 38.0 30-34 37.5237 38.0 38.0 38.0 38.0 38.0 35-39 36.63665 38.0 37.4 38.0 32.4 38.0 40-44 37.481350000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.38074999999999 38.0 38.0 38.0 37.8 38.0 50-54 37.418000000000006 38.0 38.0 38.0 37.8 38.0 55-59 37.370400000000004 38.0 38.0 38.0 38.0 38.0 60-64 37.306850000000004 38.0 38.0 38.0 37.4 38.0 65-69 37.26635 38.0 38.0 38.0 37.0 38.0 70-74 37.23145 38.0 38.0 38.0 37.0 38.0 75-79 37.2383 38.0 38.0 38.0 37.0 38.0 80-84 36.213499999999996 38.0 36.2 38.0 32.6 38.0 85-89 36.61149999999999 38.0 37.4 38.0 34.0 38.0 90-94 35.581849999999996 38.0 36.0 38.0 30.0 38.0 95-99 34.571 38.0 33.6 38.0 26.6 38.0 100-104 34.90145 38.0 34.2 38.0 27.8 38.0 105-109 36.5087 38.0 38.0 38.0 34.4 38.0 110-114 36.65265 38.0 38.0 38.0 34.4 38.0 115-119 36.41289999999999 38.0 38.0 38.0 33.0 38.0 120-124 36.33815 38.0 38.0 38.0 33.0 38.0 125-129 35.584500000000006 38.0 37.0 38.0 30.6 38.0 130-134 35.780899999999995 38.0 37.8 38.0 32.2 38.0 135-139 35.1202 38.0 36.2 38.0 29.0 38.0 140-144 32.455650000000006 36.6 30.6 38.0 21.8 38.0 145-149 29.722649999999998 35.4 27.0 38.0 6.2 38.0 150-151 21.747875 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 2.0 10 0.0 11 2.0 12 2.0 13 1.0 14 1.0 15 1.0 16 2.0 17 0.0 18 0.0 19 3.0 20 7.0 21 4.0 22 7.0 23 8.0 24 9.0 25 13.0 26 16.0 27 11.0 28 28.0 29 24.0 30 34.0 31 47.0 32 82.0 33 102.0 34 193.0 35 445.0 36 1230.0 37 1719.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.4 22.475 7.3999999999999995 24.725 2 29.45 24.625 27.375 18.55 3 23.35 26.400000000000002 28.925 21.325 4 25.074999999999996 33.5 20.825 20.599999999999998 5 25.374999999999996 35.35 19.35 19.925 6 23.674999999999997 36.85 19.825 19.650000000000002 7 22.675 20.150000000000002 34.925 22.25 8 21.85 24.75 25.650000000000002 27.750000000000004 9 23.400000000000002 22.95 28.325 25.324999999999996 10-14 25.09 27.32 23.885 23.705000000000002 15-19 25.055 26.16 24.87 23.915 20-24 25.195 26.57 25.105 23.13 25-29 24.54 26.395000000000003 25.39 23.674999999999997 30-34 25.165 26.47 25.05 23.315 35-39 24.785 26.325 25.3 23.59 40-44 24.9 26.46 24.785 23.855 45-49 25.53 26.015 25.72 22.735 50-54 25.133823602981643 25.84421431787483 25.8392115663615 23.18275051278203 55-59 25.580116023204642 25.66013202640528 24.95999199839968 23.7997599519904 60-64 25.556500425191338 26.341853834225404 25.461457655945175 22.640188084638087 65-69 24.992497749324798 26.212863859157746 25.637691307392217 23.15694708412524 70-74 25.17888416312234 26.274706029522143 25.53415061295972 23.012259194395796 75-79 25.0250150090054 25.660396237742646 25.77046227736642 23.544126475885534 80-84 24.93993993993994 26.566566566566568 25.125125125125123 23.36836836836837 85-89 25.32025620496397 26.21597277822258 25.14011208967174 23.323658927141715 90-94 25.176294073518378 25.936484121030258 25.4913728432108 23.39584896224056 95-99 25.224999999999998 26.450000000000003 25.19 23.135 100-104 25.49127456372819 26.296314815740786 25.10625531276564 23.106155307765388 105-109 25.63781890945473 26.773386693346673 24.947473736868435 22.641320660330166 110-114 25.1 26.575 25.605 22.720000000000002 115-119 26.287886365909774 26.41292387716315 24.852455736721016 22.446734020206062 120-124 26.333950092513874 26.193929089363404 25.363804570685605 22.108316247437116 125-129 26.76669167291823 26.12653163290823 24.951237809452362 22.155538884721178 130-134 26.340000000000003 26.5 25.1 22.06 135-139 26.514279997999303 27.004451558045318 24.543590256589805 21.937678187365577 140-144 26.712671267126716 26.37763776377638 25.072507250725074 21.837183718371836 145-149 26.80170042510628 27.33183295823956 24.456114028507127 21.410352588147035 150-151 27.360260097536575 27.31024134050269 24.334125296986368 20.995373264974365 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.0 24 0.0 25 0.0 26 1.0 27 4.0 28 4.5 29 2.5 30 5.0 31 12.5 32 17.5 33 19.5 34 29.0 35 38.5 36 44.0 37 54.0 38 77.5 39 111.5 40 140.0 41 166.5 42 175.5 43 186.0 44 208.5 45 223.0 46 204.0 47 189.0 48 195.0 49 191.5 50 184.5 51 165.0 52 142.0 53 128.0 54 122.0 55 104.5 56 89.0 57 92.0 58 89.5 59 68.5 60 69.0 61 65.5 62 51.0 63 50.0 64 44.5 65 41.5 66 36.0 67 29.0 68 26.5 69 27.0 70 24.0 71 17.0 72 10.5 73 5.5 74 5.0 75 5.0 76 2.5 77 1.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.055 55-59 0.02 60-64 0.045 65-69 0.03 70-74 0.075 75-79 0.06 80-84 0.1 85-89 0.08 90-94 0.025 95-99 0.0 100-104 0.005 105-109 0.05 110-114 0.0 115-119 0.03 120-124 0.015 125-129 0.025 130-134 0.0 135-139 0.034999999999999996 140-144 0.01 145-149 0.025 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16519099418163 98.0 2 0.6324310650139134 1.25 3 0.10118897040222614 0.3 4 0.05059448520111307 0.2 5 0.05059448520111307 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 5 0.125 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.6375 0.0 0.0 0.0 0.0 114-115 3.05 0.0 0.0 0.0 0.0 116-117 3.5250000000000004 0.0 0.0 0.0 0.0 118-119 4.05 0.0 0.0 0.0 0.0 120-121 4.55 0.0 0.0 0.0 0.0 122-123 5.05 0.0 0.0 0.0 0.0 124-125 5.7875 0.0 0.0 0.0 0.0 126-127 6.262499999999999 0.0 0.0 0.0 0.0 128-129 6.975 0.0 0.0 0.0 0.0 130-131 7.8375 0.0 0.0 0.0 0.0 132-133 8.625 0.0 0.0 0.0 0.0 134-135 9.1 0.0 0.0 0.0 0.0 136-137 9.9375 0.0 0.0 0.0 0.0 138-139 10.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTTGT 10 0.0069827023 143.9375 8 CATCTTG 10 0.0069827023 143.9375 7 CATCATC 10 0.0069827023 143.9375 4 TTGCGCC 10 0.0069827023 143.9375 8 TCATCTT 10 0.0069827023 143.9375 6 TCATCAT 10 0.0069827023 143.9375 3 >>END_MODULE Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762528 spots for SRR6958391.sra Written 762528 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra Read 762510 spots for SRR6958391.sra Written 762510 spots for SRR6958391.sra SRR ids: ['SRR6958391.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6u32m8ll SRR6958391.sra spots: 15250218 blocks: [[1, 762510], [762511, 1525020], [1525021, 2287530], [2287531, 3050040], [3050041, 3812550], [3812551, 4575060], [4575061, 5337570], [5337571, 6100080], [6100081, 6862590], [6862591, 7625100], [7625101, 8387610], [8387611, 9150120], [9150121, 9912630], [9912631, 10675140], [10675141, 11437650], [11437651, 12200160], [12200161, 12962670], [12962671, 13725180], [13725181, 14487690], [14487691, 15250218]] SRR6958391 file size 5146098 SRR6958391 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958391 SRR6958391_1.fastq SRR6958391_2.fastq Input file: SRR6958391_1.fastq Paired file: SRR6958391_2.fastq trimmed: SRR6958391-trimmed-pair1.fastq, SRR6958391-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:52:47 2024 >> started Fri Dec 6 21:53:03 2024 >> done (15.782s) 15250218 read pairs processed; of these: 9931 ( 0.07%) short read pairs filtered out after trimming by size control 10349 ( 0.07%) empty read pairs filtered out after trimming by size control 15229938 (99.87%) read pairs available; of these: 7230297 (47.47%) trimmed read pairs available after processing 7999641 (52.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 5 0.00% 20 14 0.00% 21 8 0.00% 22 13 0.00% 23 14 0.00% 24 23 0.00% 25 17 0.00% 26 17 0.00% 27 18 0.00% 28 24 0.00% 29 26 0.00% 30 19 0.00% 31 17 0.00% 32 22 0.00% 33 20 0.00% 34 23 0.00% 35 17 0.00% 36 23 0.00% 37 37 0.00% 38 34 0.00% 39 40 0.00% 40 32 0.00% 41 57 0.00% 42 35 0.00% 43 37 0.00% 44 47 0.00% 45 46 0.00% 46 68 0.00% 47 73 0.00% 48 76 0.00% 49 92 0.00% 50 117 0.00% 51 130 0.00% 52 110 0.00% 53 114 0.00% 54 163 0.00% 55 147 0.00% 56 163 0.00% 57 168 0.00% 58 229 0.00% 59 256 0.00% 60 314 0.00% 61 345 0.00% 62 388 0.00% 63 464 0.00% 64 502 0.00% 65 496 0.00% 66 594 0.00% 67 662 0.00% 68 690 0.00% 69 888 0.01% 70 1011 0.01% 71 1142 0.01% 72 1314 0.01% 73 1529 0.01% 74 1724 0.01% 75 1774 0.01% 76 2044 0.01% 77 2313 0.02% 78 2531 0.02% 79 3007 0.02% 80 3299 0.02% 81 3686 0.02% 82 4227 0.03% 83 4700 0.03% 84 5851 0.04% 85 6189 0.04% 86 6667 0.04% 87 7166 0.05% 88 7764 0.05% 89 8354 0.05% 90 9207 0.06% 91 10209 0.07% 92 11319 0.07% 93 12392 0.08% 94 13461 0.09% 95 14115 0.09% 96 15041 0.10% 97 15947 0.10% 98 16890 0.11% 99 19033 0.12% 100 22004 0.14% 101 24282 0.16% 102 21534 0.14% 103 22910 0.15% 104 24330 0.16% 105 25503 0.17% 106 26616 0.17% 107 27569 0.18% 108 28339 0.19% 109 29442 0.19% 110 31209 0.20% 111 32503 0.21% 112 34652 0.23% 113 36303 0.24% 114 38216 0.25% 115 39736 0.26% 116 40164 0.26% 117 41609 0.27% 118 42400 0.28% 119 43131 0.28% 120 44524 0.29% 121 46117 0.30% 122 47193 0.31% 123 49840 0.33% 124 52143 0.34% 125 53828 0.35% 126 54871 0.36% 127 56362 0.37% 128 56912 0.37% 129 58608 0.38% 130 60381 0.40% 131 61754 0.41% 132 64049 0.42% 133 66465 0.44% 134 68945 0.45% 135 72474 0.48% 136 73902 0.49% 137 74881 0.49% 138 77261 0.51% 139 80395 0.53% 140 84042 0.55% 141 89141 0.59% 142 95619 0.63% 143 103662 0.68% 144 116019 0.76% 145 133786 0.88% 146 158973 1.04% 147 205627 1.35% 148 296667 1.95% 149 584368 3.84% 150 3287187 21.58% 151 7999641 52.53% 15229938 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=23 prefix-density=0.74 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=63.52 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.90 fanout-score-rank=16 prefix-density=0.44 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=96.33 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.4 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCC SRR6958391 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:53:44 Started mapping on | Dec 06 21:53:44 Finished on | Dec 06 21:54:42 Mapping speed, Million of reads per hour | 945.31 Number of input reads | 15229938 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14982466 Uniquely mapped reads % | 98.38% Average mapped length | 291.65 Number of splices: Total | 16714024 Number of splices: Annotated (sjdb) | 15687837 Number of splices: GT/AG | 16497772 Number of splices: GC/AG | 194762 Number of splices: AT/AC | 6430 Number of splices: Non-canonical | 15060 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 101190 % of reads mapped to multiple loci | 0.66% Number of reads mapped to too many loci | 6655 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.71% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 153120 153120 153120 N_multimapping 101190 101190 101190 N_noFeature 574576 14552190 719132 N_ambiguous 336455 1908 51486 UnstrandedReadsAssigned:14071435 PositiveStrandReadsAssigned:428368 NegativeStrandReadsAssigned:14211848 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6958391 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958391-trimmed-pair1.fastq SRR6958391-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,229,938 reads, 14,239,915 reads pseudoaligned [quant] estimated average fragment length: 222.536 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR6958391.ke.tsv 35125 SRR6958391.se.tsv 88098 total ==> SRR6958391.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 714.9 0 0 PNS24247 1044 822.464 43.271 5.77688 PNS24249 1928 1706.46 24.1696 1.5552 PNS24246 1044 822.464 43.271 5.77688 PNS24248 1044 822.464 43.271 5.77688 PNS24244 1471 1249.46 32.0174 2.81368 PNS24243 293 103.602 0 0 KQK14069 1603 1381.46 1982.91 157.607 KQK14071 474 258.346 39.7032 16.8747 ==> SRR6958391.se.tsv <== BRADI_1g14170v3 2263 BRADI_1g53295v3 295 BRADI_1g59795v3 222 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 243 BRADI_1g74790v3 89 BRADI_1g09890v3 0 BRADI_1g77505v3 147 BRADI_1g48960v3 0 SRR6958391 completed mapping pipeline successfully