Starting /dee2/code/volunteer_pipeline.sh SRR6958392 current disk space = 1548933443584 free memory = 1597982836 SRR6958392 SRAfilesize f1d137b81cc9d4b427e9160b1c9f274e SRR6958392.sra SRR6958392.sra file validated SRR6958392 is paired end SRR6958392 is conventional basespace SRR6958392 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958392_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.08075 33.0 33.0 34.0 31.0 34.0 2 32.453 33.0 33.0 34.0 31.0 34.0 3 32.7525 33.0 33.0 34.0 31.0 34.0 4 32.96175 33.0 33.0 34.0 32.0 34.0 5 33.19125 34.0 33.0 34.0 33.0 34.0 6 36.49975 38.0 37.0 38.0 34.0 38.0 7 37.35575 38.0 38.0 38.0 37.0 38.0 8 37.506 38.0 38.0 38.0 37.0 38.0 9 37.21325 38.0 38.0 38.0 37.0 38.0 10-14 37.44575 38.0 38.0 38.0 37.4 38.0 15-19 37.46965 38.0 38.0 38.0 37.6 38.0 20-24 37.25685 38.0 38.0 38.0 36.6 38.0 25-29 36.858999999999995 38.0 38.0 38.0 35.6 38.0 30-34 36.9965 38.0 37.8 38.0 35.2 38.0 35-39 37.262800000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.517250000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.585750000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.55165 38.0 38.0 38.0 37.8 38.0 55-59 37.134249999999994 38.0 38.0 38.0 36.2 38.0 60-64 36.9947 38.0 37.8 38.0 35.4 38.0 65-69 37.48855 38.0 38.0 38.0 37.4 38.0 70-74 37.42745 38.0 38.0 38.0 37.2 38.0 75-79 36.31675 38.0 37.4 38.0 32.6 38.0 80-84 36.73205 38.0 37.6 38.0 34.2 38.0 85-89 37.28475 38.0 38.0 38.0 36.8 38.0 90-94 37.34685 38.0 38.0 38.0 37.0 38.0 95-99 37.2444 38.0 38.0 38.0 36.6 38.0 100-104 37.142050000000005 38.0 38.0 38.0 36.0 38.0 105-109 37.01625 38.0 38.0 38.0 35.8 38.0 110-114 37.063700000000004 38.0 38.0 38.0 36.0 38.0 115-119 36.911 38.0 38.0 38.0 35.2 38.0 120-124 36.6648 38.0 38.0 38.0 34.6 38.0 125-129 36.6065 38.0 38.0 38.0 34.2 38.0 130-134 35.837149999999994 38.0 36.8 38.0 30.6 38.0 135-139 34.976 38.0 35.4 38.0 26.4 38.0 140-144 35.68365 38.0 36.6 38.0 30.6 38.0 145-149 35.8805 38.0 37.0 38.0 33.0 38.0 150-151 32.552375 36.5 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 1.0 18 0.0 19 0.0 20 2.0 21 0.0 22 1.0 23 3.0 24 3.0 25 6.0 26 6.0 27 12.0 28 19.0 29 16.0 30 34.0 31 46.0 32 50.0 33 93.0 34 130.0 35 231.0 36 582.0 37 2763.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.66022380467955 10.172939979654121 6.4598168870803665 35.70701932858596 2 25.900000000000002 11.725 33.25 29.125 3 21.2 17.8 24.474999999999998 36.525 4 26.200000000000003 25.624999999999996 21.65 26.525 5 27.0 29.625 22.275 21.099999999999998 6 22.6 33.45 23.0 20.95 7 17.575 23.724999999999998 40.125 18.575 8 21.25 22.575 28.575 27.6 9 20.025000000000002 21.349999999999998 32.800000000000004 25.825 10-14 23.5 26.424999999999997 24.995 25.080000000000002 15-19 23.79 24.845 25.96 25.405 20-24 23.195 24.884999999999998 26.265 25.655 25-29 23.785 24.990000000000002 25.81 25.415 30-34 23.595 25.064999999999998 25.45 25.89 35-39 23.66 25.005 26.055 25.28 40-44 23.805 24.98 25.505 25.71 45-49 23.885 25.25 24.895 25.97 50-54 23.265 25.124999999999996 25.590000000000003 26.02 55-59 24.43 24.965 24.95 25.655 60-64 23.515 24.67 26.040000000000003 25.775 65-69 24.065 24.315 25.85 25.77 70-74 23.835 24.945 25.705 25.515 75-79 23.91 25.064999999999998 25.169999999999998 25.855 80-84 23.535 24.875 25.319999999999997 26.27 85-89 23.485 24.895 25.629999999999995 25.990000000000002 90-94 24.279999999999998 24.3 25.455 25.965 95-99 24.115000000000002 25.085 25.31 25.490000000000002 100-104 23.815 25.105 25.805 25.275 105-109 24.240000000000002 24.975 25.230000000000004 25.555 110-114 24.015 24.87 24.92 26.195 115-119 24.765 24.29 25.130000000000003 25.814999999999998 120-124 23.294999999999998 25.064999999999998 25.185000000000002 26.455000000000002 125-129 24.224999999999998 25.05 25.105 25.619999999999997 130-134 24.62 25.014999999999997 24.875 25.490000000000002 135-139 23.775 24.404999999999998 25.735000000000003 26.085 140-144 24.62 24.575 24.585 26.22 145-149 23.549999999999997 25.380000000000003 24.88 26.19 150-151 24.337500000000002 23.9125 25.900000000000002 25.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 0.5 27 1.0 28 3.5 29 3.5 30 6.0 31 10.0 32 10.5 33 21.0 34 27.0 35 32.0 36 48.0 37 59.0 38 77.5 39 91.0 40 115.0 41 152.5 42 179.0 43 193.0 44 190.5 45 197.0 46 199.5 47 187.0 48 170.0 49 162.0 50 156.5 51 148.5 52 134.0 53 123.5 54 121.0 55 107.0 56 95.5 57 82.5 58 83.0 59 79.5 60 82.5 61 86.5 62 68.0 63 61.0 64 70.5 65 61.0 66 45.0 67 47.5 68 41.5 69 30.5 70 27.0 71 24.5 72 17.0 73 17.0 74 14.5 75 8.0 76 8.0 77 9.0 78 6.0 79 1.5 80 1.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16750756811302 98.275 2 0.7820383451059535 1.55 3 0.025227043390514632 0.075 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.9750000000000001 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.7750000000000004 0.0 0.0 0.0 0.0 122-123 3.075 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.7375 0.0 0.0 0.0 0.0 128-129 3.9375 0.0 0.0 0.0 0.0 130-131 4.112500000000001 0.0 0.0 0.0 0.0 132-133 4.675000000000001 0.0 0.0 0.0 0.0 134-135 4.95 0.0 0.0 0.0 0.0 136-137 5.475 0.0 0.0 0.0 0.0 138-139 5.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCATGA 10 0.006577216 146.82278 1 >>END_MODULE SRR6958392 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958392_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0705 33.0 33.0 34.0 32.0 34.0 2 33.18575 34.0 33.0 34.0 33.0 34.0 3 33.2575 34.0 33.0 34.0 33.0 34.0 4 33.197 34.0 33.0 34.0 33.0 34.0 5 33.07175 34.0 33.0 34.0 33.0 34.0 6 37.3455 38.0 38.0 38.0 37.0 38.0 7 37.42175 38.0 38.0 38.0 38.0 38.0 8 37.39575 38.0 38.0 38.0 38.0 38.0 9 37.3285 38.0 38.0 38.0 38.0 38.0 10-14 37.35865 38.0 38.0 38.0 38.0 38.0 15-19 37.3906 38.0 38.0 38.0 38.0 38.0 20-24 37.35825 38.0 38.0 38.0 38.0 38.0 25-29 37.3369 38.0 38.0 38.0 37.8 38.0 30-34 37.3898 38.0 38.0 38.0 38.0 38.0 35-39 37.28645 38.0 38.0 38.0 37.4 38.0 40-44 36.92985 38.0 38.0 38.0 36.2 38.0 45-49 36.97365 38.0 38.0 38.0 36.4 38.0 50-54 37.08995 38.0 38.0 38.0 36.8 38.0 55-59 37.2805 38.0 38.0 38.0 37.0 38.0 60-64 37.23845 38.0 38.0 38.0 37.0 38.0 65-69 37.1519 38.0 38.0 38.0 37.0 38.0 70-74 37.18105 38.0 38.0 38.0 37.0 38.0 75-79 37.179649999999995 38.0 38.0 38.0 37.0 38.0 80-84 37.053 38.0 38.0 38.0 36.6 38.0 85-89 36.893150000000006 38.0 38.0 38.0 36.0 38.0 90-94 36.8463 38.0 38.0 38.0 35.8 38.0 95-99 36.74314999999999 38.0 38.0 38.0 35.2 38.0 100-104 36.70654999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.75945 38.0 38.0 38.0 35.0 38.0 110-114 36.5626 38.0 38.0 38.0 34.6 38.0 115-119 36.47955 38.0 38.0 38.0 34.2 38.0 120-124 36.3881 38.0 38.0 38.0 34.2 38.0 125-129 36.28335 38.0 38.0 38.0 34.0 38.0 130-134 36.152 38.0 38.0 38.0 33.6 38.0 135-139 35.8692 38.0 37.6 38.0 33.0 38.0 140-144 35.553999999999995 38.0 37.4 38.0 31.0 38.0 145-149 35.13860000000001 38.0 36.0 38.0 31.0 38.0 150-151 30.78425 35.5 29.0 38.0 16.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 0.0 5 3.0 6 0.0 7 1.0 8 0.0 9 1.0 10 2.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 1.0 18 5.0 19 3.0 20 1.0 21 4.0 22 4.0 23 4.0 24 5.0 25 10.0 26 13.0 27 13.0 28 23.0 29 18.0 30 34.0 31 38.0 32 65.0 33 65.0 34 118.0 35 172.0 36 411.0 37 2973.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.275 19.275000000000002 8.450000000000001 30.0 2 29.9 24.0 26.674999999999997 19.425 3 23.275000000000002 24.825 28.65 23.25 4 26.6 30.475 20.1 22.825 5 28.65 33.5 18.025 19.825 6 21.9 36.625 19.650000000000002 21.825 7 23.3 19.7 34.050000000000004 22.95 8 23.05 23.474999999999998 23.65 29.825000000000003 9 24.55 23.599999999999998 25.3 26.55 10-14 25.6 25.905 22.99 25.505 15-19 25.095 25.580000000000002 24.25 25.074999999999996 20-24 25.740000000000002 25.224999999999998 24.355 24.68 25-29 25.679999999999996 25.66 23.775 24.884999999999998 30-34 25.7 25.929999999999996 23.305 25.064999999999998 35-39 25.35 25.385 24.265 25.0 40-44 25.88 25.240000000000002 23.825 25.055 45-49 25.380000000000003 25.115 24.315 25.19 50-54 26.040000000000003 25.509999999999998 23.849999999999998 24.6 55-59 26.21 24.935 24.22 24.635 60-64 25.705 25.55 24.27 24.474999999999998 65-69 26.025 25.674999999999997 24.23 24.07 70-74 25.81 25.019999999999996 24.46 24.709999999999997 75-79 26.035000000000004 24.535 24.425 25.005 80-84 26.090000000000003 25.64 24.145 24.125 85-89 25.724999999999998 25.36 24.275 24.64 90-94 25.974999999999998 24.88 24.404999999999998 24.740000000000002 95-99 26.005 25.575 24.205 24.215 100-104 26.55 24.88 24.555 24.015 105-109 25.355 24.88 25.290000000000003 24.474999999999998 110-114 26.43 25.165 24.345 24.060000000000002 115-119 26.505000000000003 25.895000000000003 23.990000000000002 23.61 120-124 26.779999999999998 25.77 24.285 23.165 125-129 26.150000000000002 25.314999999999998 24.560000000000002 23.974999999999998 130-134 27.29 26.41 23.665 22.634999999999998 135-139 26.815 25.91 23.615 23.66 140-144 26.950000000000003 25.790000000000003 23.935000000000002 23.325000000000003 145-149 27.395000000000003 26.32 23.175 23.11 150-151 26.700000000000003 25.025 24.3 23.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 0.5 25 1.0 26 1.5 27 1.5 28 2.5 29 7.5 30 9.5 31 10.5 32 14.5 33 16.5 34 25.0 35 36.5 36 38.5 37 43.0 38 63.0 39 83.0 40 101.0 41 139.5 42 159.0 43 155.5 44 179.0 45 189.0 46 176.5 47 162.0 48 154.5 49 170.5 50 167.5 51 148.5 52 151.0 53 132.5 54 113.0 55 126.5 56 118.5 57 100.0 58 90.5 59 75.5 60 70.0 61 71.0 62 76.0 63 80.5 64 81.5 65 74.0 66 67.0 67 62.5 68 50.5 69 43.5 70 35.0 71 26.0 72 21.5 73 18.0 74 16.5 75 13.5 76 8.0 77 6.5 78 5.0 79 1.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0126582278481 97.775 2 0.8101265822784811 1.6 3 0.10126582278481014 0.3 4 0.05063291139240507 0.2 5 0.025316455696202535 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.9750000000000001 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.7625 0.0 0.0 0.0 0.0 128-129 3.9749999999999996 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.800000000000001 0.0 0.0 0.0 0.0 134-135 5.1 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138-139 6.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTCGT 10 0.006830828 145.0 6 TACTTCA 10 0.006830828 145.0 6 >>END_MODULE Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040709 spots for SRR6958392.sra Written 1040709 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra Read 1040695 spots for SRR6958392.sra Written 1040695 spots for SRR6958392.sra SRR ids: ['SRR6958392.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n1f3kqvw SRR6958392.sra spots: 20813914 blocks: [[1, 1040695], [1040696, 2081390], [2081391, 3122085], [3122086, 4162780], [4162781, 5203475], [5203476, 6244170], [6244171, 7284865], [7284866, 8325560], [8325561, 9366255], [9366256, 10406950], [10406951, 11447645], [11447646, 12488340], [12488341, 13529035], [13529036, 14569730], [14569731, 15610425], [15610426, 16651120], [16651121, 17691815], [17691816, 18732510], [18732511, 19773205], [19773206, 20813914]] SRR6958392 file size 7031452 SRR6958392 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958392 SRR6958392_1.fastq SRR6958392_2.fastq Input file: SRR6958392_1.fastq Paired file: SRR6958392_2.fastq trimmed: SRR6958392-trimmed-pair1.fastq, SRR6958392-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:56:14 2024 >> started Fri Dec 6 21:56:37 2024 >> done (23.050s) 20813914 read pairs processed; of these: 20342 ( 0.10%) short read pairs filtered out after trimming by size control 16269 ( 0.08%) empty read pairs filtered out after trimming by size control 20777303 (99.82%) read pairs available; of these: 7389343 (35.56%) trimmed read pairs available after processing 13387960 (64.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 19 0.00% 20 8 0.00% 21 16 0.00% 22 11 0.00% 23 10 0.00% 24 11 0.00% 25 14 0.00% 26 10 0.00% 27 16 0.00% 28 17 0.00% 29 25 0.00% 30 12 0.00% 31 20 0.00% 32 19 0.00% 33 23 0.00% 34 16 0.00% 35 17 0.00% 36 25 0.00% 37 23 0.00% 38 27 0.00% 39 31 0.00% 40 26 0.00% 41 26 0.00% 42 35 0.00% 43 34 0.00% 44 31 0.00% 45 52 0.00% 46 36 0.00% 47 52 0.00% 48 63 0.00% 49 75 0.00% 50 80 0.00% 51 90 0.00% 52 82 0.00% 53 95 0.00% 54 99 0.00% 55 119 0.00% 56 140 0.00% 57 145 0.00% 58 165 0.00% 59 192 0.00% 60 237 0.00% 61 245 0.00% 62 282 0.00% 63 278 0.00% 64 304 0.00% 65 381 0.00% 66 419 0.00% 67 478 0.00% 68 518 0.00% 69 558 0.00% 70 655 0.00% 71 808 0.00% 72 845 0.00% 73 947 0.00% 74 1129 0.01% 75 1254 0.01% 76 1385 0.01% 77 1522 0.01% 78 1807 0.01% 79 2084 0.01% 80 2166 0.01% 81 2477 0.01% 82 2729 0.01% 83 3233 0.02% 84 4452 0.02% 85 5369 0.03% 86 5442 0.03% 87 5698 0.03% 88 6410 0.03% 89 6734 0.03% 90 7242 0.03% 91 7753 0.04% 92 8276 0.04% 93 8929 0.04% 94 9747 0.05% 95 10491 0.05% 96 10775 0.05% 97 11683 0.06% 98 12247 0.06% 99 13100 0.06% 100 14273 0.07% 101 15098 0.07% 102 16231 0.08% 103 16996 0.08% 104 18215 0.09% 105 19214 0.09% 106 20178 0.10% 107 21083 0.10% 108 21941 0.11% 109 23296 0.11% 110 23991 0.12% 111 25463 0.12% 112 27103 0.13% 113 28201 0.14% 114 29970 0.14% 115 31296 0.15% 116 32519 0.16% 117 33096 0.16% 118 34609 0.17% 119 35341 0.17% 120 36866 0.18% 121 37787 0.18% 122 39246 0.19% 123 41076 0.20% 124 42825 0.21% 125 45171 0.22% 126 45854 0.22% 127 48015 0.23% 128 48158 0.23% 129 49866 0.24% 130 51468 0.25% 131 53095 0.26% 132 55463 0.27% 133 58211 0.28% 134 59833 0.29% 135 63034 0.30% 136 64848 0.31% 137 66662 0.32% 138 69725 0.34% 139 73811 0.36% 140 77277 0.37% 141 80541 0.39% 142 90065 0.43% 143 105472 0.51% 144 105531 0.51% 145 123206 0.59% 146 149407 0.72% 147 199652 0.96% 148 294991 1.42% 149 543775 2.62% 150 3917194 18.85% 151 13387960 64.44% 20777303 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=23 prefix-density=0.73 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=41.52 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=21 prefix-density=0.54 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=97.05 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.6 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR6958392 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:57:25 Started mapping on | Dec 06 21:57:25 Finished on | Dec 06 21:59:27 Mapping speed, Million of reads per hour | 613.10 Number of input reads | 20777303 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20263440 Uniquely mapped reads % | 97.53% Average mapped length | 295.40 Number of splices: Total | 22981691 Number of splices: Annotated (sjdb) | 21560972 Number of splices: GT/AG | 22675310 Number of splices: GC/AG | 265758 Number of splices: AT/AC | 8631 Number of splices: Non-canonical | 31992 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.51 Insertion rate per base | 0.01% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 183099 % of reads mapped to multiple loci | 0.88% Number of reads mapped to too many loci | 8527 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.31% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 346523 346523 346523 N_multimapping 183099 183099 183099 N_noFeature 716893 19671995 910521 N_ambiguous 481320 2888 84934 UnstrandedReadsAssigned:19065227 PositiveStrandReadsAssigned:588557 NegativeStrandReadsAssigned:19267985 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958392 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958392-trimmed-pair1.fastq SRR6958392-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,777,303 reads, 19,282,597 reads pseudoaligned [quant] estimated average fragment length: 263.518 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52973 SRR6958392.ke.tsv 35125 SRR6958392.se.tsv 88098 total ==> SRR6958392.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 674.133 0 0 PNS24247 1044 781.482 57.4114 5.64168 PNS24249 1928 1665.48 65.0154 2.99782 PNS24246 1044 781.482 57.4114 5.64168 PNS24248 1044 781.482 57.4114 5.64168 PNS24244 1471 1208.48 25.7505 1.63635 PNS24243 293 91.9036 0 0 KQK14069 1603 1340.48 3280.12 187.913 KQK14071 474 231.909 76.9135 25.4691 ==> SRR6958392.se.tsv <== BRADI_1g14170v3 3810 BRADI_1g53295v3 242 BRADI_1g59795v3 323 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 247 BRADI_1g74790v3 92 BRADI_1g09890v3 0 BRADI_1g77505v3 240 BRADI_1g48960v3 0 SRR6958392 completed mapping pipeline successfully