Starting /dee2/code/volunteer_pipeline.sh SRR6958393 current disk space = 1548944412672 free memory = 1603012996 SRR6958393 SRAfilesize d2ffe7dc88769d4bad3991c8fe93552e SRR6958393.sra SRR6958393.sra file validated SRR6958393 is paired end SRR6958393 is conventional basespace SRR6958393 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958393_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.33825 33.0 32.0 33.0 2.0 34.0 2 32.0995 33.0 33.0 34.0 27.0 34.0 3 32.16525 33.0 33.0 34.0 27.0 34.0 4 32.779 33.0 33.0 34.0 31.0 34.0 5 32.688 33.0 33.0 34.0 31.0 34.0 6 37.029 38.0 37.0 38.0 36.0 38.0 7 37.50975 38.0 38.0 38.0 37.0 38.0 8 37.59 38.0 38.0 38.0 38.0 38.0 9 37.6175 38.0 38.0 38.0 38.0 38.0 10-14 37.4844 38.0 38.0 38.0 37.6 38.0 15-19 37.4752 38.0 38.0 38.0 37.6 38.0 20-24 37.525000000000006 38.0 38.0 38.0 37.8 38.0 25-29 37.1777 38.0 38.0 38.0 36.6 38.0 30-34 37.37395 38.0 38.0 38.0 37.2 38.0 35-39 36.957750000000004 38.0 38.0 38.0 35.6 38.0 40-44 37.566500000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.347300000000004 38.0 38.0 38.0 36.8 38.0 50-54 37.17155 38.0 38.0 38.0 36.6 38.0 55-59 37.150549999999996 38.0 38.0 38.0 36.6 38.0 60-64 37.33945 38.0 38.0 38.0 37.0 38.0 65-69 37.3903 38.0 38.0 38.0 37.0 38.0 70-74 37.231849999999994 38.0 38.0 38.0 36.4 38.0 75-79 37.2552 38.0 38.0 38.0 36.4 38.0 80-84 37.170849999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.71175 38.0 38.0 38.0 35.0 38.0 90-94 35.99550000000001 38.0 37.4 38.0 32.0 38.0 95-99 34.29305 37.8 33.4 38.0 25.2 38.0 100-104 35.75855 38.0 37.0 38.0 30.6 38.0 105-109 35.60575 38.0 36.8 38.0 30.2 38.0 110-114 35.28025 38.0 36.0 38.0 28.6 38.0 115-119 35.642199999999995 38.0 36.8 38.0 31.0 38.0 120-124 35.5071 38.0 36.4 38.0 29.8 38.0 125-129 35.33505 38.0 36.0 38.0 29.8 38.0 130-134 35.029 38.0 35.8 38.0 28.2 38.0 135-139 34.2546 38.0 34.2 38.0 26.0 38.0 140-144 32.9254 38.0 32.2 38.0 19.2 38.0 145-149 32.067449999999994 38.0 32.6 38.0 10.6 38.0 150-151 25.984499999999997 33.0 17.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 5.0 18 2.0 19 0.0 20 6.0 21 4.0 22 2.0 23 7.0 24 13.0 25 11.0 26 15.0 27 28.0 28 38.0 29 46.0 30 57.0 31 68.0 32 95.0 33 166.0 34 219.0 35 352.0 36 887.0 37 1976.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.26950557302086 10.74592740783081 9.517004858531008 36.46756216061732 2 26.075 12.875 32.05 28.999999999999996 3 22.75 18.075 24.85 34.325 4 26.400000000000002 24.45 22.7 26.450000000000003 5 24.45 28.799999999999997 23.575 23.175 6 23.325000000000003 31.624999999999996 23.200000000000003 21.85 7 18.125 22.0 40.2 19.675 8 21.525 23.599999999999998 27.875 27.0 9 19.875 22.575 31.474999999999998 26.075 10-14 23.225 25.869999999999997 25.779999999999998 25.124999999999996 15-19 23.445 24.635 26.235000000000003 25.685000000000002 20-24 23.26 25.545 25.995 25.2 25-29 23.535 24.8 25.855 25.81 30-34 23.51 24.685000000000002 25.825 25.979999999999997 35-39 23.565 25.275 25.290000000000003 25.869999999999997 40-44 23.265 24.98 25.95 25.805 45-49 22.869999999999997 25.34 25.929999999999996 25.86 50-54 23.275000000000002 24.485 25.480000000000004 26.76 55-59 23.205000000000002 25.180000000000003 25.509999999999998 26.105 60-64 23.200000000000003 24.560000000000002 25.795 26.445 65-69 23.775 24.745 25.445 26.035000000000004 70-74 24.32 24.785 25.430000000000003 25.465 75-79 23.810000000000002 24.275 25.740000000000002 26.174999999999997 80-84 24.545 24.875 24.89 25.69 85-89 23.865 24.595 25.455 26.085 90-94 23.915 24.68 25.564999999999998 25.840000000000003 95-99 23.474999999999998 24.29 25.825 26.41 100-104 24.01 24.759999999999998 25.52 25.71 105-109 23.955000000000002 23.95 25.88 26.215 110-114 23.880000000000003 24.88 25.46 25.779999999999998 115-119 24.295 24.59 25.525 25.590000000000003 120-124 24.175 25.21 24.69 25.924999999999997 125-129 24.465 24.474999999999998 25.06 26.0 130-134 24.27 24.8 25.305 25.624999999999996 135-139 24.9 24.89 24.685000000000002 25.525 140-144 24.27 25.1 25.39 25.240000000000002 145-149 24.05 24.925 24.915000000000003 26.11 150-151 24.875 23.974999999999998 25.2125 25.937500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 0.5 29 2.5 30 5.0 31 6.5 32 8.5 33 10.5 34 19.0 35 33.0 36 42.5 37 55.0 38 79.0 39 93.5 40 105.0 41 133.5 42 176.0 43 203.5 44 217.5 45 216.0 46 199.0 47 202.0 48 194.5 49 184.0 50 168.5 51 144.5 52 137.5 53 136.5 54 127.5 55 109.0 56 94.5 57 87.0 58 73.5 59 71.0 60 77.0 61 65.0 62 52.5 63 56.5 64 60.5 65 56.0 66 50.5 67 43.0 68 37.0 69 31.0 70 29.5 71 25.0 72 20.5 73 16.5 74 10.5 75 10.5 76 9.0 77 6.0 78 3.5 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.3875 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.925 0.0 0.0 0.0 0.0 124-125 2.2249999999999996 0.0 0.0 0.0 0.0 126-127 2.4625 0.0 0.0 0.0 0.0 128-129 2.75 0.0 0.0 0.0 0.0 130-131 3.0999999999999996 0.0 0.0 0.0 0.0 132-133 3.3499999999999996 0.0 0.0 0.0 0.0 134-135 3.925 0.0 0.0 0.0 0.0 136-137 4.2875 0.0 0.0 0.0 0.0 138-139 4.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTGA 10 0.00456877 165.57143 1 TTGATGT 10 0.0068484643 144.875 7 >>END_MODULE SRR6958393 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958393_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.977 33.0 33.0 34.0 32.0 34.0 2 33.0745 34.0 33.0 34.0 32.0 34.0 3 32.991 34.0 33.0 34.0 32.0 34.0 4 32.9865 34.0 33.0 34.0 32.0 34.0 5 32.8405 34.0 33.0 34.0 32.0 34.0 6 37.10375 38.0 38.0 38.0 37.0 38.0 7 37.05825 38.0 38.0 38.0 37.0 38.0 8 36.731 38.0 38.0 38.0 36.0 38.0 9 36.91325 38.0 38.0 38.0 36.0 38.0 10-14 36.7825 38.0 38.0 38.0 35.6 38.0 15-19 36.75315 38.0 38.0 38.0 35.8 38.0 20-24 36.828950000000006 38.0 38.0 38.0 35.8 38.0 25-29 36.9178 38.0 38.0 38.0 36.6 38.0 30-34 37.0928 38.0 38.0 38.0 37.0 38.0 35-39 37.09739999999999 38.0 38.0 38.0 37.0 38.0 40-44 34.90220000000001 37.8 34.6 38.0 28.0 38.0 45-49 35.0706 37.8 35.2 38.0 28.6 38.0 50-54 34.515750000000004 37.8 34.0 38.0 26.4 38.0 55-59 34.936600000000006 37.8 34.8 38.0 28.8 38.0 60-64 36.3351 38.0 37.8 38.0 34.2 38.0 65-69 35.9771 38.0 37.4 38.0 32.0 38.0 70-74 35.903800000000004 38.0 37.4 38.0 32.0 38.0 75-79 35.971199999999996 38.0 37.8 38.0 32.2 38.0 80-84 35.93655 38.0 38.0 38.0 33.0 38.0 85-89 35.6386 38.0 37.2 38.0 31.0 38.0 90-94 35.601600000000005 38.0 37.2 38.0 31.4 38.0 95-99 35.9075 38.0 37.6 38.0 33.0 38.0 100-104 33.93579999999999 37.4 33.0 38.0 25.0 38.0 105-109 35.544050000000006 38.0 37.0 38.0 31.4 38.0 110-114 35.154700000000005 38.0 36.4 38.0 30.6 38.0 115-119 34.4861 38.0 36.0 38.0 25.8 38.0 120-124 30.22865 34.2 25.8 38.0 15.2 38.0 125-129 28.731099999999998 33.2 20.2 38.0 12.2 38.0 130-134 29.18645 34.0 22.4 38.0 12.2 38.0 135-139 31.893649999999997 37.6 31.6 38.0 13.0 38.0 140-144 30.821799999999996 37.0 28.6 38.0 11.4 38.0 145-149 29.47715 36.6 25.0 38.0 2.0 38.0 150-151 23.481 28.5 15.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 8.0 4 3.0 5 3.0 6 0.0 7 1.0 8 2.0 9 2.0 10 1.0 11 4.0 12 3.0 13 3.0 14 1.0 15 2.0 16 9.0 17 9.0 18 18.0 19 12.0 20 14.0 21 11.0 22 19.0 23 16.0 24 27.0 25 35.0 26 38.0 27 39.0 28 47.0 29 77.0 30 89.0 31 115.0 32 165.0 33 208.0 34 338.0 35 609.0 36 1234.0 37 827.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.025000000000006 18.45 12.5 32.025 2 29.825000000000003 23.849999999999998 24.875 21.45 3 23.974999999999998 27.55 25.624999999999996 22.85 4 26.674999999999997 30.85 20.150000000000002 22.325 5 28.050000000000004 31.424999999999997 19.0 21.525 6 22.85 35.449999999999996 19.525000000000002 22.175 7 22.1 20.125 34.65 23.125 8 23.825 23.599999999999998 23.075000000000003 29.5 9 24.15 23.549999999999997 26.674999999999997 25.624999999999996 10-14 26.229999999999997 25.53 22.814999999999998 25.424999999999997 15-19 25.735000000000003 25.21 23.84 25.215 20-24 25.96 25.619999999999997 23.84 24.58 25-29 26.115 24.945 24.01 24.93 30-34 26.155 25.35 24.11 24.385 35-39 25.72 25.319999999999997 24.135 24.825 40-44 26.05 24.990000000000002 24.13 24.83 45-49 26.025 25.174999999999997 23.995 24.805 50-54 26.229999999999997 25.05 24.165 24.555 55-59 26.525 25.46 23.84 24.175 60-64 25.805 25.330000000000002 24.34 24.525 65-69 25.97 25.224999999999998 23.674999999999997 25.130000000000003 70-74 26.51 24.610000000000003 24.035 24.845 75-79 26.365 24.865000000000002 24.54 24.23 80-84 26.035000000000004 25.419999999999998 24.060000000000002 24.485 85-89 25.895000000000003 25.285000000000004 24.25 24.57 90-94 26.085 25.2 24.305 24.41 95-99 26.169999999999998 25.174999999999997 24.165 24.490000000000002 100-104 25.814999999999998 24.7 24.735 24.75 105-109 25.91 25.635 24.63 23.825 110-114 26.700000000000003 26.06 23.830000000000002 23.41 115-119 26.479999999999997 25.990000000000002 23.985 23.544999999999998 120-124 26.08 25.855 24.055 24.01 125-129 26.284999999999997 26.27 23.87 23.575 130-134 27.215 25.465 23.735 23.585 135-139 26.295 25.319999999999997 24.775 23.61 140-144 26.83 26.284999999999997 23.835 23.05 145-149 26.979999999999997 26.19 23.724999999999998 23.105 150-151 26.987499999999997 25.974999999999998 23.325000000000003 23.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.5 27 3.5 28 2.0 29 1.0 30 3.0 31 6.0 32 8.5 33 9.5 34 12.0 35 21.0 36 26.5 37 41.0 38 68.0 39 83.0 40 105.5 41 134.5 42 154.5 43 154.0 44 183.5 45 204.5 46 187.0 47 191.5 48 204.0 49 195.0 50 170.0 51 152.5 52 133.0 53 118.5 54 109.0 55 108.0 56 104.0 57 99.0 58 103.0 59 95.5 60 81.0 61 71.5 62 62.0 63 61.5 64 65.0 65 67.0 66 57.0 67 48.0 68 52.0 69 51.0 70 47.0 71 36.0 72 26.0 73 21.5 74 20.0 75 12.5 76 6.0 77 7.0 78 5.0 79 2.5 80 1.0 81 2.0 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.4781077000503271 0.95 3 0.050327126321087066 0.15 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.11249999999999999 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.3875000000000002 0.0 0.0 0.0 0.0 122-123 1.6 0.0 0.0 0.0 0.0 124-125 1.7375 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.1625 0.0 0.0 0.0 0.0 130-131 2.45 0.0 0.0 0.0 0.0 132-133 2.625 0.0 0.0 0.0 0.0 134-135 3.1375 0.0 0.0 0.0 0.0 136-137 3.45 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACCGGA 10 0.006830828 145.0 1 >>END_MODULE Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080533 spots for SRR6958393.sra Written 1080533 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra Read 1080518 spots for SRR6958393.sra Written 1080518 spots for SRR6958393.sra SRR ids: ['SRR6958393.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5zxxuqfs SRR6958393.sra spots: 21610375 blocks: [[1, 1080518], [1080519, 2161036], [2161037, 3241554], [3241555, 4322072], [4322073, 5402590], [5402591, 6483108], [6483109, 7563626], [7563627, 8644144], [8644145, 9724662], [9724663, 10805180], [10805181, 11885698], [11885699, 12966216], [12966217, 14046734], [14046735, 15127252], [15127253, 16207770], [16207771, 17288288], [17288289, 18368806], [18368807, 19449324], [19449325, 20529842], [20529843, 21610375]] SRR6958393 file size 7301346 SRR6958393 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958393 SRR6958393_1.fastq SRR6958393_2.fastq Input file: SRR6958393_1.fastq Paired file: SRR6958393_2.fastq trimmed: SRR6958393-trimmed-pair1.fastq, SRR6958393-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:56:46 2024 >> started Fri Dec 6 21:57:24 2024 >> done (37.891s) 21610375 read pairs processed; of these: 27784 ( 0.13%) short read pairs filtered out after trimming by size control 21888 ( 0.10%) empty read pairs filtered out after trimming by size control 21560703 (99.77%) read pairs available; of these: 9867518 (45.77%) trimmed read pairs available after processing 11693185 (54.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 7 0.00% 21 5 0.00% 22 11 0.00% 23 3 0.00% 24 2 0.00% 25 3 0.00% 26 2 0.00% 27 3 0.00% 28 4 0.00% 29 7 0.00% 30 4 0.00% 31 10 0.00% 32 5 0.00% 33 11 0.00% 34 9 0.00% 35 12 0.00% 36 6 0.00% 37 8 0.00% 38 8 0.00% 39 7 0.00% 40 11 0.00% 41 8 0.00% 42 13 0.00% 43 14 0.00% 44 16 0.00% 45 16 0.00% 46 10 0.00% 47 17 0.00% 48 32 0.00% 49 31 0.00% 50 22 0.00% 51 30 0.00% 52 30 0.00% 53 35 0.00% 54 50 0.00% 55 48 0.00% 56 48 0.00% 57 47 0.00% 58 64 0.00% 59 73 0.00% 60 82 0.00% 61 98 0.00% 62 109 0.00% 63 129 0.00% 64 146 0.00% 65 148 0.00% 66 198 0.00% 67 191 0.00% 68 216 0.00% 69 236 0.00% 70 300 0.00% 71 361 0.00% 72 440 0.00% 73 471 0.00% 74 523 0.00% 75 617 0.00% 76 668 0.00% 77 769 0.00% 78 838 0.00% 79 998 0.00% 80 1161 0.01% 81 1240 0.01% 82 1575 0.01% 83 1830 0.01% 84 3032 0.01% 85 3718 0.02% 86 3844 0.02% 87 4167 0.02% 88 4160 0.02% 89 4472 0.02% 90 4667 0.02% 91 4954 0.02% 92 5470 0.03% 93 5879 0.03% 94 6240 0.03% 95 6634 0.03% 96 7084 0.03% 97 7632 0.04% 98 8037 0.04% 99 8877 0.04% 100 9364 0.04% 101 10218 0.05% 102 11004 0.05% 103 12123 0.06% 104 12862 0.06% 105 14058 0.07% 106 14675 0.07% 107 15310 0.07% 108 15809 0.07% 109 17184 0.08% 110 17807 0.08% 111 19325 0.09% 112 20528 0.10% 113 22048 0.10% 114 23561 0.11% 115 24892 0.12% 116 26636 0.12% 117 27399 0.13% 118 28520 0.13% 119 29429 0.14% 120 31342 0.15% 121 32707 0.15% 122 34298 0.16% 123 36978 0.17% 124 39131 0.18% 125 41475 0.19% 126 43761 0.20% 127 44886 0.21% 128 47099 0.22% 129 49368 0.23% 130 52028 0.24% 131 54367 0.25% 132 58292 0.27% 133 61450 0.29% 134 65416 0.30% 135 70026 0.32% 136 73928 0.34% 137 78045 0.36% 138 82427 0.38% 139 87719 0.41% 140 93470 0.43% 141 102029 0.47% 142 113161 0.52% 143 127530 0.59% 144 146019 0.68% 145 173417 0.80% 146 215853 1.00% 147 293426 1.36% 148 447110 2.07% 149 915254 4.25% 150 5679795 26.34% 151 11693185 54.23% 21560703 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=20 prefix-density=0.76 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=196.68 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.1 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=23 prefix-density=0.58 prefix-fanout=2.6 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=102.13 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=7.8 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958393 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:58:12 Started mapping on | Dec 06 21:58:12 Finished on | Dec 06 22:00:30 Mapping speed, Million of reads per hour | 562.45 Number of input reads | 21560703 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20823813 Uniquely mapped reads % | 96.58% Average mapped length | 295.88 Number of splices: Total | 24283992 Number of splices: Annotated (sjdb) | 22856920 Number of splices: GT/AG | 23945494 Number of splices: GC/AG | 287698 Number of splices: AT/AC | 8872 Number of splices: Non-canonical | 41928 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 235781 % of reads mapped to multiple loci | 1.09% Number of reads mapped to too many loci | 10926 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 518731 518731 518731 N_multimapping 235781 235781 235781 N_noFeature 585378 20210432 734032 N_ambiguous 542916 2853 79115 UnstrandedReadsAssigned:19695519 PositiveStrandReadsAssigned:610528 NegativeStrandReadsAssigned:20010666 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958393 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958393-trimmed-pair1.fastq SRR6958393-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,560,703 reads, 19,994,818 reads pseudoaligned [quant] estimated average fragment length: 260.375 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR6958393.ke.tsv 35125 SRR6958393.se.tsv 88098 total ==> SRR6958393.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 677.135 0 0 PNS24247 1044 784.625 50.8119 4.74667 PNS24249 1928 1668.62 67.8263 2.97938 PNS24246 1044 784.625 50.8119 4.74667 PNS24248 1044 784.625 50.8119 4.74667 PNS24244 1471 1211.62 28.738 1.7385 PNS24243 293 86.7736 0 0 KQK14069 1603 1343.62 6746.57 368.036 KQK14071 474 229.501 99.1164 31.6553 ==> SRR6958393.se.tsv <== BRADI_1g14170v3 7438 BRADI_1g53295v3 959 BRADI_1g59795v3 88 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 467 BRADI_1g74790v3 103 BRADI_1g09890v3 0 BRADI_1g77505v3 284 BRADI_1g48960v3 0 SRR6958393 completed mapping pipeline successfully