Starting /dee2/code/volunteer_pipeline.sh SRR6958394 current disk space = 1548899074048 free memory = 1600372492 SRR6958394 SRAfilesize 0c908d95277d2a3cf12b62c1d150cf0f SRR6958394.sra SRR6958394.sra file validated SRR6958394 is paired end SRR6958394 is conventional basespace SRR6958394 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958394_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.297 28.0 18.0 33.0 18.0 33.0 2 30.6465 32.0 28.0 33.0 27.0 34.0 3 31.87475 33.0 32.0 33.0 27.0 34.0 4 32.0805 33.0 31.0 33.0 29.0 34.0 5 32.3515 33.0 32.0 33.0 31.0 34.0 6 36.16325 38.0 36.0 38.0 33.0 38.0 7 36.33675 38.0 37.0 38.0 33.0 38.0 8 37.02775 38.0 38.0 38.0 35.0 38.0 9 37.2895 38.0 38.0 38.0 36.0 38.0 10-14 37.30455 38.0 38.0 38.0 36.6 38.0 15-19 37.385400000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.2632 38.0 38.0 38.0 36.8 38.0 25-29 37.1173 38.0 38.0 38.0 36.0 38.0 30-34 36.862449999999995 38.0 38.0 38.0 35.4 38.0 35-39 36.85845 38.0 38.0 38.0 35.4 38.0 40-44 36.8947 38.0 38.0 38.0 35.2 38.0 45-49 36.85545 38.0 38.0 38.0 35.4 38.0 50-54 36.60360000000001 38.0 38.0 38.0 34.4 38.0 55-59 36.4239 38.0 38.0 38.0 33.6 38.0 60-64 36.80535 38.0 38.0 38.0 34.8 38.0 65-69 36.44115 38.0 37.8 38.0 33.4 38.0 70-74 36.2677 38.0 37.4 38.0 32.8 38.0 75-79 36.0767 38.0 37.0 38.0 32.2 38.0 80-84 36.0835 38.0 37.0 38.0 32.6 38.0 85-89 36.037 38.0 37.0 38.0 32.4 38.0 90-94 36.0395 38.0 37.0 38.0 32.6 38.0 95-99 35.47725 38.0 36.2 38.0 30.0 38.0 100-104 35.061099999999996 38.0 35.4 38.0 28.0 38.0 105-109 34.96255 38.0 35.2 38.0 27.4 38.0 110-114 34.691449999999996 38.0 35.0 38.0 26.6 38.0 115-119 34.21325 38.0 34.0 38.0 23.4 38.0 120-124 34.051750000000006 38.0 34.2 38.0 22.4 38.0 125-129 34.159400000000005 38.0 34.2 38.0 24.0 38.0 130-134 34.091249999999995 38.0 34.4 38.0 23.4 38.0 135-139 32.24025 36.8 31.0 38.0 15.6 38.0 140-144 31.688800000000004 36.0 30.6 38.0 13.4 38.0 145-149 30.315299999999997 35.8 29.2 38.0 8.6 38.0 150-151 25.226125 33.0 12.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 2.0 17 2.0 18 5.0 19 3.0 20 4.0 21 8.0 22 17.0 23 12.0 24 20.0 25 30.0 26 34.0 27 39.0 28 51.0 29 58.0 30 86.0 31 105.0 32 147.0 33 195.0 34 302.0 35 552.0 36 1009.0 37 1314.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.468144044321335 12.520775623268698 7.091412742382272 38.9196675900277 2 21.825 11.05 31.1 36.025 3 20.525 15.5 25.75 38.224999999999994 4 26.325 21.6 21.75 30.325000000000003 5 26.474999999999998 26.650000000000002 23.95 22.925 6 24.25 30.625000000000004 22.7 22.425 7 18.8 24.275 38.550000000000004 18.375 8 22.900000000000002 23.125 27.900000000000002 26.075 9 20.525 23.25 31.574999999999996 24.65 10-14 22.689999999999998 25.555 25.990000000000002 25.765 15-19 23.61 24.610000000000003 25.900000000000002 25.88 20-24 22.564999999999998 25.55 25.715 26.169999999999998 25-29 23.21 25.385 25.509999999999998 25.895000000000003 30-34 23.080000000000002 25.22 25.974999999999998 25.724999999999998 35-39 23.345 24.795 25.715 26.145000000000003 40-44 22.715 24.79 26.405 26.090000000000003 45-49 23.615 24.335 26.119999999999997 25.929999999999996 50-54 23.46 24.47 25.835 26.235000000000003 55-59 23.24 24.735 25.979999999999997 26.045 60-64 23.235 24.82 25.97 25.974999999999998 65-69 23.735 24.654999999999998 25.674999999999997 25.935000000000002 70-74 23.635 24.485 25.485000000000003 26.395000000000003 75-79 23.865 24.23 25.650000000000002 26.255 80-84 23.765 24.39 25.53 26.314999999999998 85-89 23.880000000000003 24.55 25.419999999999998 26.150000000000002 90-94 24.005000000000003 24.315 25.669999999999998 26.009999999999998 95-99 23.705000000000002 24.25 25.44 26.605 100-104 23.965 24.83 25.715 25.490000000000002 105-109 23.835 24.6 25.785000000000004 25.779999999999998 110-114 23.76 24.98 25.335 25.924999999999997 115-119 23.915 24.91 25.22 25.955000000000002 120-124 24.13 25.335 24.654999999999998 25.88 125-129 23.61 24.775 25.040000000000003 26.575 130-134 24.11 24.425 25.869999999999997 25.595000000000002 135-139 24.295 24.7 24.875 26.13 140-144 24.099999999999998 24.59 25.3 26.009999999999998 145-149 24.33 24.175 25.629999999999995 25.865 150-151 23.7375 23.4125 25.7375 27.1125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.0 28 0.0 29 1.5 30 6.0 31 9.0 32 7.0 33 11.0 34 21.5 35 30.0 36 44.0 37 49.5 38 65.5 39 97.5 40 119.0 41 152.5 42 179.0 43 185.0 44 195.0 45 198.0 46 198.0 47 190.5 48 184.0 49 177.5 50 166.5 51 163.0 52 150.0 53 140.0 54 126.0 55 112.0 56 99.5 57 86.5 58 82.0 59 73.0 60 73.5 61 73.5 62 66.5 63 60.5 64 58.0 65 55.0 66 45.5 67 44.0 68 40.5 69 33.5 70 30.0 71 23.0 72 17.5 73 18.0 74 14.0 75 10.0 76 7.5 77 3.0 78 2.5 79 2.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 2.0250000000000004 0.0 0.0 0.0 0.0 116-117 2.275 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.9625000000000004 0.0 0.0 0.0 0.0 122-123 3.2750000000000004 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.9250000000000003 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.775 0.0 0.0 0.0 0.0 132-133 5.15 0.0 0.0 0.0 0.0 134-135 5.6625 0.0 0.0 0.0 0.0 136-137 6.387499999999999 0.0 0.0 0.0 0.0 138-139 7.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTTGC 10 0.0068449317 144.90001 6 >>END_MODULE SRR6958394 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958394_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.579 33.0 33.0 34.0 32.0 34.0 2 32.4475 33.0 33.0 34.0 31.0 34.0 3 32.3735 33.0 33.0 34.0 31.0 34.0 4 32.44125 33.0 33.0 34.0 31.0 34.0 5 32.22475 33.0 33.0 34.0 31.0 34.0 6 36.2835 38.0 38.0 38.0 33.0 38.0 7 36.40225 38.0 38.0 38.0 34.0 38.0 8 36.4125 38.0 38.0 38.0 34.0 38.0 9 36.62 38.0 38.0 38.0 35.0 38.0 10-14 36.50664999999999 38.0 38.0 38.0 34.4 38.0 15-19 36.66665 38.0 38.0 38.0 34.8 38.0 20-24 36.75395 38.0 38.0 38.0 35.4 38.0 25-29 36.7643 38.0 38.0 38.0 35.0 38.0 30-34 36.531099999999995 38.0 38.0 38.0 34.6 38.0 35-39 36.46124999999999 38.0 38.0 38.0 34.4 38.0 40-44 36.4206 38.0 38.0 38.0 34.2 38.0 45-49 36.4682 38.0 38.0 38.0 34.0 38.0 50-54 36.407349999999994 38.0 38.0 38.0 34.0 38.0 55-59 36.419149999999995 38.0 38.0 38.0 34.4 38.0 60-64 36.18634999999999 38.0 38.0 38.0 33.4 38.0 65-69 35.905899999999995 38.0 37.2 38.0 32.0 38.0 70-74 35.80855 38.0 37.0 38.0 31.6 38.0 75-79 35.905449999999995 38.0 37.0 38.0 32.6 38.0 80-84 35.78635 38.0 37.0 38.0 31.6 38.0 85-89 35.7264 38.0 37.0 38.0 31.2 38.0 90-94 35.51125 38.0 36.6 38.0 30.2 38.0 95-99 35.356399999999994 38.0 36.0 38.0 29.4 38.0 100-104 35.00555000000001 38.0 35.8 38.0 28.4 38.0 105-109 34.7385 38.0 35.2 38.0 26.8 38.0 110-114 34.441649999999996 38.0 34.6 38.0 25.0 38.0 115-119 34.320299999999996 38.0 34.8 38.0 24.6 38.0 120-124 33.7176 38.0 34.0 38.0 22.2 38.0 125-129 33.6131 38.0 33.8 38.0 21.8 38.0 130-134 32.8396 38.0 32.2 38.0 15.8 38.0 135-139 32.37655 38.0 31.0 38.0 13.4 38.0 140-144 31.7226 36.2 31.0 38.0 13.0 38.0 145-149 29.52635 35.8 27.8 38.0 6.0 38.0 150-151 23.221125 29.5 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 6.0 4 2.0 5 2.0 6 1.0 7 3.0 8 1.0 9 2.0 10 1.0 11 2.0 12 0.0 13 4.0 14 5.0 15 4.0 16 3.0 17 7.0 18 11.0 19 3.0 20 11.0 21 15.0 22 11.0 23 11.0 24 15.0 25 28.0 26 32.0 27 33.0 28 58.0 29 60.0 30 99.0 31 111.0 32 146.0 33 179.0 34 283.0 35 438.0 36 904.0 37 1494.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.775 18.2 12.3 29.725 2 31.474999999999998 23.05 25.025 20.45 3 23.075000000000003 26.25 27.275 23.400000000000002 4 26.6 30.15 20.5 22.75 5 26.424999999999997 31.8 20.05 21.725 6 23.875 33.6 21.425 21.099999999999998 7 24.825 19.375 32.25 23.549999999999997 8 24.525 22.95 22.25 30.275000000000002 9 22.8 23.599999999999998 28.050000000000004 25.55 10-14 26.61 25.72 22.415 25.255 15-19 25.82 25.85 23.7 24.63 20-24 26.119999999999997 25.39 23.400000000000002 25.09 25-29 26.474999999999998 25.119999999999997 23.669999999999998 24.735 30-34 25.97 25.624999999999996 24.07 24.335 35-39 25.795 25.255 24.095 24.855 40-44 25.86 25.145 23.87 25.124999999999996 45-49 26.38 25.235000000000003 23.93 24.455 50-54 25.86 25.650000000000002 24.13 24.36 55-59 26.855 24.695 24.04 24.41 60-64 26.05 25.130000000000003 24.715 24.104999999999997 65-69 26.075 25.130000000000003 23.645 25.15 70-74 25.77 25.0 23.965 25.264999999999997 75-79 26.145000000000003 24.85 24.560000000000002 24.445 80-84 26.479999999999997 25.069999999999997 24.175 24.275 85-89 26.174999999999997 24.89 24.37 24.565 90-94 25.785000000000004 25.3 24.565 24.349999999999998 95-99 26.0 25.674999999999997 24.16 24.165 100-104 26.529999999999998 25.035 23.91 24.525 105-109 26.795 25.445 24.205 23.555 110-114 26.58 25.77 24.15 23.5 115-119 26.884999999999998 25.285000000000004 24.135 23.695 120-124 27.27 25.95 23.325000000000003 23.455000000000002 125-129 26.775 25.695 24.529999999999998 23.0 130-134 27.595 25.490000000000002 23.685000000000002 23.23 135-139 27.41 25.655 24.38 22.555 140-144 26.695 26.255 23.89 23.16 145-149 27.275 26.14 23.9 22.685 150-151 28.425 26.2125 23.375 21.987499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.0 28 2.0 29 3.5 30 4.5 31 6.5 32 9.5 33 12.0 34 16.0 35 19.0 36 27.5 37 42.5 38 59.5 39 84.5 40 116.0 41 140.5 42 152.0 43 172.0 44 186.0 45 185.5 46 180.5 47 183.0 48 196.0 49 184.0 50 168.0 51 156.0 52 136.0 53 115.5 54 107.5 55 97.5 56 86.5 57 102.0 58 96.0 59 84.5 60 90.5 61 91.0 62 78.5 63 73.0 64 70.5 65 69.0 66 66.0 67 55.0 68 55.5 69 50.5 70 43.5 71 33.5 72 22.5 73 20.0 74 17.5 75 11.0 76 5.5 77 4.5 78 3.0 79 1.5 80 2.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29399899142713 98.45 2 0.6051437216338881 1.2 3 0.05042864346949068 0.15 4 0.05042864346949068 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.7625 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.2875 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.9625000000000004 0.0 0.0 0.0 0.0 122-123 3.2750000000000004 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.9 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.775 0.0 0.0 0.0 0.0 132-133 5.15 0.0 0.0 0.0 0.0 134-135 5.675 0.0 0.0 0.0 0.0 136-137 6.425 0.0 0.0 0.0 0.0 138-139 7.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290785 spots for SRR6958394.sra Written 1290785 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra Read 1290766 spots for SRR6958394.sra Written 1290766 spots for SRR6958394.sra SRR ids: ['SRR6958394.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uzobjcm9 SRR6958394.sra spots: 25815339 blocks: [[1, 1290766], [1290767, 2581532], [2581533, 3872298], [3872299, 5163064], [5163065, 6453830], [6453831, 7744596], [7744597, 9035362], [9035363, 10326128], [10326129, 11616894], [11616895, 12907660], [12907661, 14198426], [14198427, 15489192], [15489193, 16779958], [16779959, 18070724], [18070725, 19361490], [19361491, 20652256], [20652257, 21943022], [21943023, 23233788], [23233789, 24524554], [24524555, 25815339]] SRR6958394 file size 8726270 SRR6958394 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958394 SRR6958394_1.fastq SRR6958394_2.fastq Input file: SRR6958394_1.fastq Paired file: SRR6958394_2.fastq trimmed: SRR6958394-trimmed-pair1.fastq, SRR6958394-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:59:27 2024 >> started Fri Dec 6 21:59:57 2024 >> done (29.134s) 25815339 read pairs processed; of these: 40025 ( 0.16%) short read pairs filtered out after trimming by size control 37029 ( 0.14%) empty read pairs filtered out after trimming by size control 25738285 (99.70%) read pairs available; of these: 12506658 (48.59%) trimmed read pairs available after processing 13231627 (51.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 5 0.00% 23 6 0.00% 24 4 0.00% 25 5 0.00% 26 13 0.00% 27 4 0.00% 28 10 0.00% 29 7 0.00% 30 10 0.00% 31 9 0.00% 32 8 0.00% 33 20 0.00% 34 11 0.00% 35 12 0.00% 36 15 0.00% 37 17 0.00% 38 21 0.00% 39 22 0.00% 40 16 0.00% 41 21 0.00% 42 25 0.00% 43 26 0.00% 44 26 0.00% 45 22 0.00% 46 29 0.00% 47 48 0.00% 48 43 0.00% 49 52 0.00% 50 68 0.00% 51 68 0.00% 52 71 0.00% 53 91 0.00% 54 93 0.00% 55 110 0.00% 56 122 0.00% 57 162 0.00% 58 173 0.00% 59 172 0.00% 60 167 0.00% 61 237 0.00% 62 292 0.00% 63 303 0.00% 64 352 0.00% 65 355 0.00% 66 410 0.00% 67 420 0.00% 68 485 0.00% 69 517 0.00% 70 683 0.00% 71 747 0.00% 72 856 0.00% 73 917 0.00% 74 1139 0.00% 75 1274 0.00% 76 1371 0.01% 77 1588 0.01% 78 1767 0.01% 79 2039 0.01% 80 2311 0.01% 81 2675 0.01% 82 3082 0.01% 83 3539 0.01% 84 5405 0.02% 85 6621 0.03% 86 7157 0.03% 87 7297 0.03% 88 7775 0.03% 89 8092 0.03% 90 8791 0.03% 91 9400 0.04% 92 10266 0.04% 93 11091 0.04% 94 12381 0.05% 95 13169 0.05% 96 14268 0.06% 97 15075 0.06% 98 16219 0.06% 99 17354 0.07% 100 18563 0.07% 101 19657 0.08% 102 21288 0.08% 103 23458 0.09% 104 24895 0.10% 105 26252 0.10% 106 28176 0.11% 107 29874 0.12% 108 31219 0.12% 109 32702 0.13% 110 34422 0.13% 111 36531 0.14% 112 39172 0.15% 113 40935 0.16% 114 43712 0.17% 115 46283 0.18% 116 48178 0.19% 117 50137 0.19% 118 52201 0.20% 119 54016 0.21% 120 55589 0.22% 121 57884 0.22% 122 60853 0.24% 123 64193 0.25% 124 67330 0.26% 125 71207 0.28% 126 73681 0.29% 127 77044 0.30% 128 79370 0.31% 129 82792 0.32% 130 85528 0.33% 131 89091 0.35% 132 93757 0.36% 133 98598 0.38% 134 103089 0.40% 135 109003 0.42% 136 113868 0.44% 137 119220 0.46% 138 125697 0.49% 139 133122 0.52% 140 140719 0.55% 141 150690 0.59% 142 166500 0.65% 143 185608 0.72% 144 212369 0.83% 145 251138 0.98% 146 309913 1.20% 147 415031 1.61% 148 629017 2.44% 149 1231587 4.79% 150 6151967 23.90% 151 13231627 51.41% 25738285 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=16 prefix-density=0.75 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=68.52 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.1 sequence=TGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=35 prefix-density=0.50 prefix-fanout=2.0 sequence=AGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCACGCAGGTGCT criterion=fanout-score sequence-density=0.13 sequence-density-rank=24 fanout-score=74.07 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=13.5 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGAGCTTGAGAGGGCACTGTAGCCAGTGTGTCAGTCGTTGTTAAATTACAGGTTGAGATCATCAGCGTACTCCGATGGGAGATGGACATCAGAAAGTATACTGTGTTTTACCA SRR6958394 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:00:40 Started mapping on | Dec 06 22:00:41 Finished on | Dec 06 22:02:42 Mapping speed, Million of reads per hour | 765.77 Number of input reads | 25738285 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 24830895 Uniquely mapped reads % | 96.47% Average mapped length | 294.16 Number of splices: Total | 28310506 Number of splices: Annotated (sjdb) | 26707508 Number of splices: GT/AG | 27937079 Number of splices: GC/AG | 337272 Number of splices: AT/AC | 12773 Number of splices: Non-canonical | 23382 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262272 % of reads mapped to multiple loci | 1.02% Number of reads mapped to too many loci | 31816 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.58% % of reads unmapped: other | 0.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 668746 668746 668746 N_multimapping 262272 262272 262272 N_noFeature 752412 24209730 918921 N_ambiguous 542704 3364 89799 UnstrandedReadsAssigned:23535779 PositiveStrandReadsAssigned:617801 NegativeStrandReadsAssigned:23822175 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958394 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958394-trimmed-pair1.fastq SRR6958394-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,738,285 reads, 23,943,508 reads pseudoaligned [quant] estimated average fragment length: 238.863 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR6958394.ke.tsv 35125 SRR6958394.se.tsv 88098 total ==> SRR6958394.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.402 7.47438e-07 6.42388e-08 PNS24247 1044 806.137 81.9074 6.09877 PNS24249 1928 1690.14 75.9716 2.69809 PNS24246 1044 806.137 81.9074 6.09877 PNS24248 1044 806.137 81.9074 6.09877 PNS24244 1471 1233.14 45.3061 2.20533 PNS24243 293 93.7247 0 0 KQK14069 1603 1365.14 2667.9 117.306 KQK14071 474 244.493 29.7858 7.31256 ==> SRR6958394.se.tsv <== BRADI_1g14170v3 2889 BRADI_1g53295v3 199 BRADI_1g59795v3 392 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 594 BRADI_1g74790v3 257 BRADI_1g09890v3 0 BRADI_1g77505v3 388 BRADI_1g48960v3 0 SRR6958394 completed mapping pipeline successfully