Starting /dee2/code/volunteer_pipeline.sh SRR6958395 current disk space = 1548899065856 free memory = 1600025876 SRR6958395 SRAfilesize 04d443f9bc23d84d137d25699c519e83 SRR6958395.sra SRR6958395.sra file validated SRR6958395 is paired end SRR6958395 is conventional basespace SRR6958395 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958395_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.8995 27.0 18.0 33.0 18.0 33.0 2 30.16 32.0 27.0 33.0 25.0 33.0 3 31.52475 33.0 32.0 33.0 27.0 34.0 4 31.85525 33.0 31.0 33.0 29.0 34.0 5 31.7955 33.0 32.0 33.0 30.0 34.0 6 36.18975 38.0 36.0 38.0 33.0 38.0 7 36.65475 38.0 37.0 38.0 34.0 38.0 8 36.97425 38.0 38.0 38.0 35.0 38.0 9 37.25275 38.0 38.0 38.0 37.0 38.0 10-14 37.26035 38.0 38.0 38.0 36.4 38.0 15-19 37.391749999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.2731 38.0 38.0 38.0 36.8 38.0 25-29 37.1061 38.0 38.0 38.0 36.0 38.0 30-34 36.810950000000005 38.0 38.0 38.0 35.2 38.0 35-39 36.81395 38.0 38.0 38.0 35.0 38.0 40-44 36.8817 38.0 38.0 38.0 35.4 38.0 45-49 36.75215000000001 38.0 38.0 38.0 34.8 38.0 50-54 36.56314999999999 38.0 38.0 38.0 33.8 38.0 55-59 36.3594 38.0 37.8 38.0 33.4 38.0 60-64 36.82685 38.0 38.0 38.0 35.0 38.0 65-69 36.50235 38.0 37.8 38.0 33.6 38.0 70-74 36.256 38.0 37.4 38.0 33.4 38.0 75-79 36.0775 38.0 37.0 38.0 32.4 38.0 80-84 35.9943 38.0 37.0 38.0 32.0 38.0 85-89 36.0878 38.0 37.0 38.0 32.4 38.0 90-94 36.0182 38.0 37.0 38.0 32.8 38.0 95-99 35.44109999999999 38.0 36.2 38.0 29.8 38.0 100-104 35.14575 38.0 35.8 38.0 28.2 38.0 105-109 34.9553 38.0 35.0 38.0 27.2 38.0 110-114 34.74315 38.0 35.0 38.0 26.4 38.0 115-119 34.23215 38.0 34.0 38.0 23.6 38.0 120-124 34.04684999999999 38.0 34.0 38.0 22.2 38.0 125-129 34.01255 38.0 34.0 38.0 22.0 38.0 130-134 34.03335 38.0 34.2 38.0 23.2 38.0 135-139 32.28195 37.0 31.2 38.0 15.2 38.0 140-144 31.772450000000003 36.0 30.6 38.0 13.4 38.0 145-149 30.437099999999997 35.8 29.8 38.0 8.6 38.0 150-151 25.18625 33.0 11.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 2.0 15 1.0 16 1.0 17 1.0 18 2.0 19 4.0 20 5.0 21 10.0 22 10.0 23 17.0 24 20.0 25 25.0 26 36.0 27 48.0 28 58.0 29 62.0 30 84.0 31 124.0 32 140.0 33 190.0 34 312.0 35 484.0 36 1026.0 37 1335.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.368910782703885 12.862616310892172 7.170224411603722 41.59824849480022 2 20.549999999999997 11.5 29.925 38.025 3 18.75 16.7 25.025 39.525 4 25.424999999999997 22.225 21.65 30.7 5 26.375 25.575 23.150000000000002 24.9 6 25.95 29.9 22.05 22.1 7 19.675 23.525 37.15 19.650000000000002 8 20.5 24.125 27.625 27.750000000000004 9 20.724999999999998 20.724999999999998 33.175 25.374999999999996 10-14 23.494999999999997 25.624999999999996 25.224999999999998 25.655 15-19 23.26 24.88 25.83 26.029999999999998 20-24 23.21 25.34 25.405 26.045 25-29 23.29 24.94 25.56 26.21 30-34 23.535 24.83 25.615 26.02 35-39 24.19 24.59 25.685000000000002 25.535000000000004 40-44 23.355 24.615000000000002 25.5 26.529999999999998 45-49 24.05 24.38 25.240000000000002 26.33 50-54 23.785 24.58 25.19 26.445 55-59 23.09 24.98 25.790000000000003 26.14 60-64 24.03 23.9 25.495 26.575 65-69 23.875 24.575 25.405 26.145000000000003 70-74 23.715 24.185000000000002 25.355 26.745 75-79 23.825 24.665 25.41 26.1 80-84 23.915 24.154999999999998 25.569999999999997 26.36 85-89 24.01 24.175 25.779999999999998 26.035000000000004 90-94 23.400000000000002 24.21 25.03 27.36 95-99 24.08 23.990000000000002 25.580000000000002 26.35 100-104 24.26 24.08 25.790000000000003 25.869999999999997 105-109 24.0 24.22 25.180000000000003 26.6 110-114 24.23 23.75 25.405 26.615 115-119 23.73 24.955 25.46 25.855 120-124 24.735 24.060000000000002 24.905 26.3 125-129 24.435000000000002 25.064999999999998 24.34 26.16 130-134 24.275 24.545 24.925 26.255 135-139 24.834999999999997 24.085 25.224999999999998 25.855 140-144 24.33 24.795 24.95 25.924999999999997 145-149 24.365000000000002 24.815 25.095 25.724999999999998 150-151 24.425 24.587500000000002 24.5 26.487500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.5 28 2.0 29 4.0 30 5.0 31 6.5 32 9.5 33 13.5 34 23.0 35 30.0 36 40.0 37 56.0 38 64.0 39 86.0 40 113.0 41 131.0 42 161.0 43 180.0 44 184.0 45 199.0 46 199.5 47 189.5 48 185.0 49 175.5 50 178.0 51 161.5 52 136.5 53 136.0 54 118.0 55 102.0 56 91.0 57 77.5 58 80.5 59 81.0 60 78.5 61 75.0 62 71.5 63 70.0 64 70.0 65 67.0 66 61.5 67 50.0 68 38.0 69 29.5 70 33.5 71 37.0 72 28.0 73 20.0 74 15.5 75 13.0 76 8.5 77 4.5 78 2.0 79 1.5 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.649999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5249999999999999 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.3375 0.0 0.0 0.0 0.0 116-117 1.5499999999999998 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.525 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.75 0.0 0.0 0.0 0.0 130-131 4.4 0.0 0.0 0.0 0.0 132-133 4.949999999999999 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 5.85 0.0 0.0 0.0 0.0 138-139 6.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAACTG 10 0.0068449317 144.90001 3 >>END_MODULE SRR6958395 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958395_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5025 33.0 33.0 34.0 32.0 34.0 2 32.4705 33.0 33.0 34.0 31.0 34.0 3 32.34875 33.0 33.0 34.0 31.0 34.0 4 32.4255 33.0 33.0 34.0 31.0 34.0 5 32.24 33.0 33.0 34.0 31.0 34.0 6 36.22675 38.0 38.0 38.0 33.0 38.0 7 36.495 38.0 38.0 38.0 34.0 38.0 8 36.44075 38.0 38.0 38.0 34.0 38.0 9 36.56325 38.0 38.0 38.0 34.0 38.0 10-14 36.477599999999995 38.0 38.0 38.0 34.2 38.0 15-19 36.5938 38.0 38.0 38.0 34.4 38.0 20-24 36.6724 38.0 38.0 38.0 34.8 38.0 25-29 36.6464 38.0 38.0 38.0 35.2 38.0 30-34 36.540099999999995 38.0 38.0 38.0 34.8 38.0 35-39 36.38945 38.0 38.0 38.0 34.2 38.0 40-44 36.347950000000004 38.0 38.0 38.0 33.8 38.0 45-49 36.29025 38.0 38.0 38.0 34.0 38.0 50-54 36.2185 38.0 38.0 38.0 33.6 38.0 55-59 36.245799999999996 38.0 38.0 38.0 33.8 38.0 60-64 36.0416 38.0 38.0 38.0 32.8 38.0 65-69 35.757549999999995 38.0 37.2 38.0 31.4 38.0 70-74 35.60935 38.0 37.0 38.0 30.6 38.0 75-79 35.73525 38.0 37.0 38.0 31.2 38.0 80-84 35.60675 38.0 37.0 38.0 31.0 38.0 85-89 35.580949999999994 38.0 37.0 38.0 31.0 38.0 90-94 35.32165 38.0 36.6 38.0 29.4 38.0 95-99 35.09165 38.0 36.0 38.0 28.2 38.0 100-104 34.8125 38.0 35.6 38.0 26.6 38.0 105-109 34.62925 38.0 35.2 38.0 26.2 38.0 110-114 34.366150000000005 38.0 34.8 38.0 24.4 38.0 115-119 34.29565 38.0 34.8 38.0 24.4 38.0 120-124 33.69325 38.0 34.2 38.0 21.0 38.0 125-129 33.5105 38.0 33.8 38.0 19.0 38.0 130-134 32.74185 38.0 32.2 38.0 15.8 38.0 135-139 32.24285 38.0 31.0 38.0 13.0 38.0 140-144 31.629900000000003 36.6 31.0 38.0 13.0 38.0 145-149 29.198900000000002 35.8 26.4 38.0 3.8 38.0 150-151 22.88475 28.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 5.0 4 6.0 5 1.0 6 1.0 7 3.0 8 1.0 9 2.0 10 4.0 11 2.0 12 3.0 13 3.0 14 2.0 15 2.0 16 10.0 17 6.0 18 2.0 19 8.0 20 14.0 21 10.0 22 15.0 23 27.0 24 25.0 25 31.0 26 43.0 27 53.0 28 50.0 29 64.0 30 79.0 31 112.0 32 108.0 33 186.0 34 266.0 35 442.0 36 861.0 37 1537.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.75 18.75 12.3 32.2 2 28.375 23.275000000000002 25.424999999999997 22.925 3 23.3 26.974999999999998 26.8 22.925 4 25.1 31.35 20.175 23.375 5 27.0 32.25 19.375 21.375 6 24.125 34.225 20.45 21.2 7 22.7 19.2 34.25 23.849999999999998 8 24.325 22.725 23.625 29.325000000000003 9 23.0 23.075000000000003 26.650000000000002 27.275 10-14 26.27 25.46 23.165 25.105 15-19 26.064999999999998 24.8 24.3 24.834999999999997 20-24 26.155 25.575 23.89 24.38 25-29 26.005 25.430000000000003 23.615 24.95 30-34 25.775 24.745 24.755 24.725 35-39 25.790000000000003 25.535000000000004 23.375 25.3 40-44 26.155 24.64 23.915 25.290000000000003 45-49 26.255 25.03 23.93 24.785 50-54 26.884999999999998 25.615 23.275000000000002 24.224999999999998 55-59 27.084999999999997 24.990000000000002 23.175 24.75 60-64 25.979999999999997 25.424999999999997 24.044999999999998 24.55 65-69 26.179999999999996 25.585 23.76 24.474999999999998 70-74 26.529999999999998 25.124999999999996 23.62 24.725 75-79 26.150000000000002 24.610000000000003 24.4 24.84 80-84 26.405 24.67 24.01 24.915000000000003 85-89 26.340000000000003 25.074999999999996 24.26 24.325 90-94 26.224999999999998 24.7 24.7 24.375 95-99 26.174999999999997 25.674999999999997 24.154999999999998 23.995 100-104 26.005 24.875 24.154999999999998 24.965 105-109 26.619999999999997 25.264999999999997 24.135 23.98 110-114 26.810000000000002 26.174999999999997 23.405 23.61 115-119 26.75 25.369999999999997 23.755000000000003 24.125 120-124 27.325 25.474999999999998 23.765 23.435 125-129 27.305 25.1 23.474999999999998 24.12 130-134 26.875 25.55 23.565 24.01 135-139 27.284999999999997 26.095000000000002 23.799999999999997 22.82 140-144 27.87 26.365 23.244999999999997 22.52 145-149 27.54 25.509999999999998 23.955000000000002 22.994999999999997 150-151 28.3375 26.325 22.475 22.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 2.5 29 2.5 30 4.5 31 7.5 32 8.5 33 10.5 34 13.5 35 21.5 36 35.5 37 44.0 38 54.0 39 75.0 40 99.5 41 140.5 42 168.0 43 157.0 44 168.0 45 200.5 46 214.0 47 197.0 48 182.5 49 166.5 50 142.0 51 139.5 52 136.5 53 117.0 54 121.0 55 114.5 56 94.5 57 102.5 58 96.0 59 93.5 60 96.5 61 84.5 62 76.5 63 69.5 64 66.0 65 74.0 66 63.0 67 53.0 68 56.0 69 51.5 70 42.0 71 34.5 72 29.5 73 22.0 74 18.5 75 12.0 76 6.5 77 4.0 78 2.0 79 1.5 80 2.0 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19171507956554 98.175 2 0.7072493053801465 1.4000000000000001 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.025258903763576663 0.125 6 0.025258903763576663 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.1375000000000002 0.0 0.0 0.0 0.0 114-115 1.3875 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.8625 0.0 0.0 0.0 0.0 120-121 2.1625 0.0 0.0 0.0 0.0 122-123 2.5625 0.0 0.0 0.0 0.0 124-125 2.8875 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.775 0.0 0.0 0.0 0.0 130-131 4.425000000000001 0.0 0.0 0.0 0.0 132-133 4.9625 0.0 0.0 0.0 0.0 134-135 5.45 0.0 0.0 0.0 0.0 136-137 5.8625 0.0 0.0 0.0 0.0 138-139 6.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119356 spots for SRR6958395.sra Written 1119356 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra Read 1119342 spots for SRR6958395.sra Written 1119342 spots for SRR6958395.sra SRR ids: ['SRR6958395.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jdwz45n4 SRR6958395.sra spots: 22386854 blocks: [[1, 1119342], [1119343, 2238684], [2238685, 3358026], [3358027, 4477368], [4477369, 5596710], [5596711, 6716052], [6716053, 7835394], [7835395, 8954736], [8954737, 10074078], [10074079, 11193420], [11193421, 12312762], [12312763, 13432104], [13432105, 14551446], [14551447, 15670788], [15670789, 16790130], [16790131, 17909472], [17909473, 19028814], [19028815, 20148156], [20148157, 21267498], [21267499, 22386854]] SRR6958395 file size 7564469 SRR6958395 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958395 SRR6958395_1.fastq SRR6958395_2.fastq Input file: SRR6958395_1.fastq Paired file: SRR6958395_2.fastq trimmed: SRR6958395-trimmed-pair1.fastq, SRR6958395-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:58:11 2024 >> started Fri Dec 6 21:58:34 2024 >> done (23.149s) 22386854 read pairs processed; of these: 39219 ( 0.18%) short read pairs filtered out after trimming by size control 35754 ( 0.16%) empty read pairs filtered out after trimming by size control 22311881 (99.67%) read pairs available; of these: 10949453 (49.07%) trimmed read pairs available after processing 11362428 (50.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 2 0.00% 21 3 0.00% 22 0 0.00% 23 3 0.00% 24 4 0.00% 25 8 0.00% 26 4 0.00% 27 7 0.00% 28 8 0.00% 29 11 0.00% 30 6 0.00% 31 5 0.00% 32 14 0.00% 33 4 0.00% 34 10 0.00% 35 12 0.00% 36 7 0.00% 37 15 0.00% 38 16 0.00% 39 22 0.00% 40 18 0.00% 41 27 0.00% 42 19 0.00% 43 22 0.00% 44 32 0.00% 45 36 0.00% 46 36 0.00% 47 40 0.00% 48 40 0.00% 49 53 0.00% 50 47 0.00% 51 55 0.00% 52 72 0.00% 53 89 0.00% 54 88 0.00% 55 108 0.00% 56 132 0.00% 57 110 0.00% 58 152 0.00% 59 159 0.00% 60 213 0.00% 61 219 0.00% 62 202 0.00% 63 260 0.00% 64 298 0.00% 65 320 0.00% 66 311 0.00% 67 399 0.00% 68 426 0.00% 69 501 0.00% 70 598 0.00% 71 658 0.00% 72 702 0.00% 73 830 0.00% 74 910 0.00% 75 1056 0.00% 76 1165 0.01% 77 1326 0.01% 78 1473 0.01% 79 1809 0.01% 80 1947 0.01% 81 2094 0.01% 82 2525 0.01% 83 3072 0.01% 84 4678 0.02% 85 5839 0.03% 86 6100 0.03% 87 6232 0.03% 88 6558 0.03% 89 6987 0.03% 90 7546 0.03% 91 7881 0.04% 92 8682 0.04% 93 9463 0.04% 94 10342 0.05% 95 11081 0.05% 96 11606 0.05% 97 12754 0.06% 98 13743 0.06% 99 14628 0.07% 100 15706 0.07% 101 16693 0.07% 102 18254 0.08% 103 19554 0.09% 104 21111 0.09% 105 22769 0.10% 106 24323 0.11% 107 25436 0.11% 108 26940 0.12% 109 29048 0.13% 110 30111 0.13% 111 32001 0.14% 112 33874 0.15% 113 36159 0.16% 114 38626 0.17% 115 41016 0.18% 116 42939 0.19% 117 44898 0.20% 118 46388 0.21% 119 48086 0.22% 120 50227 0.23% 121 52121 0.23% 122 55354 0.25% 123 57632 0.26% 124 61424 0.28% 125 64224 0.29% 126 67058 0.30% 127 70483 0.32% 128 72313 0.32% 129 75194 0.34% 130 78441 0.35% 131 82155 0.37% 132 85363 0.38% 133 90420 0.41% 134 94049 0.42% 135 99008 0.44% 136 103713 0.46% 137 108828 0.49% 138 114317 0.51% 139 120924 0.54% 140 127797 0.57% 141 136843 0.61% 142 149477 0.67% 143 166808 0.75% 144 189876 0.85% 145 222210 1.00% 146 272418 1.22% 147 360469 1.62% 148 543321 2.44% 149 1063547 4.77% 150 5330570 23.89% 151 11362428 50.93% 22311881 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=19 prefix-density=0.63 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=100.67 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.3 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=17 prefix-density=0.41 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=59.94 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.5 sequence=GTGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTT SRR6958395 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:59:28 Started mapping on | Dec 06 21:59:28 Finished on | Dec 06 22:01:35 Mapping speed, Million of reads per hour | 632.46 Number of input reads | 22311881 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 21673686 Uniquely mapped reads % | 97.14% Average mapped length | 293.86 Number of splices: Total | 24354313 Number of splices: Annotated (sjdb) | 22820515 Number of splices: GT/AG | 24019719 Number of splices: GC/AG | 294498 Number of splices: AT/AC | 9116 Number of splices: Non-canonical | 30980 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.53 Insertion rate per base | 0.01% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 191952 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 20593 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.39% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 468374 468374 468374 N_multimapping 191952 191952 191952 N_noFeature 610341 21086471 771880 N_ambiguous 510628 2617 85703 UnstrandedReadsAssigned:20552717 PositiveStrandReadsAssigned:584598 NegativeStrandReadsAssigned:20816103 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958395 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958395-trimmed-pair1.fastq SRR6958395-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,311,881 reads, 20,832,265 reads pseudoaligned [quant] estimated average fragment length: 235.153 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52973 SRR6958395.ke.tsv 35125 SRR6958395.se.tsv 88098 total ==> SRR6958395.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 702.167 11.6629 1.17572 PNS24247 1044 809.847 85.8806 7.50636 PNS24249 1928 1693.85 67.0154 2.80052 PNS24246 1044 809.847 85.8806 7.50636 PNS24248 1044 809.847 85.8806 7.50636 PNS24244 1471 1236.85 19.6798 1.12627 PNS24243 293 95.6347 0 0 KQK14069 1603 1368.85 11246 581.541 KQK14071 474 247.938 165.558 47.2656 ==> SRR6958395.se.tsv <== BRADI_1g14170v3 12072 BRADI_1g53295v3 242 BRADI_1g59795v3 293 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 192 BRADI_1g74790v3 112 BRADI_1g09890v3 0 BRADI_1g77505v3 266 BRADI_1g48960v3 1 SRR6958395 completed mapping pipeline successfully