Starting /dee2/code/volunteer_pipeline.sh SRR6958396 current disk space = 1548899065856 free memory = 1601268472 SRR6958396 SRAfilesize 4362ab80c58533da8b49caf31fd4b361 SRR6958396.sra SRR6958396.sra file validated SRR6958396 is paired end SRR6958396 is conventional basespace SRR6958396 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958396_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.03175 25.0 18.0 32.0 18.0 33.0 2 30.03825 31.0 28.0 33.0 27.0 33.0 3 30.95425 33.0 30.0 33.0 27.0 33.0 4 29.4365 31.0 29.0 33.0 15.0 33.0 5 31.658 33.0 32.0 33.0 30.0 33.0 6 36.3875 38.0 37.0 38.0 34.0 38.0 7 37.1225 38.0 38.0 38.0 36.0 38.0 8 37.28925 38.0 38.0 38.0 37.0 38.0 9 37.316 38.0 38.0 38.0 37.0 38.0 10-14 37.3883 38.0 38.0 38.0 37.0 38.0 15-19 37.432 38.0 38.0 38.0 37.0 38.0 20-24 37.45459999999999 38.0 38.0 38.0 37.2 38.0 25-29 37.3604 38.0 38.0 38.0 37.0 38.0 30-34 37.31835000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.236599999999996 38.0 38.0 38.0 36.6 38.0 40-44 37.155150000000006 38.0 38.0 38.0 36.4 38.0 45-49 37.10505 38.0 38.0 38.0 36.0 38.0 50-54 37.11995 38.0 38.0 38.0 36.0 38.0 55-59 37.010749999999994 38.0 38.0 38.0 35.6 38.0 60-64 36.91275 38.0 38.0 38.0 35.4 38.0 65-69 37.026900000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.98655 38.0 38.0 38.0 35.8 38.0 75-79 36.8814 38.0 38.0 38.0 35.2 38.0 80-84 36.5575 38.0 38.0 38.0 34.0 38.0 85-89 36.5178 38.0 38.0 38.0 34.0 38.0 90-94 36.4759 38.0 38.0 38.0 33.8 38.0 95-99 36.3921 38.0 37.8 38.0 34.0 38.0 100-104 36.215799999999994 38.0 37.2 38.0 33.2 38.0 105-109 36.116749999999996 38.0 37.0 38.0 33.0 38.0 110-114 35.8622 38.0 36.6 38.0 31.6 38.0 115-119 35.7601 38.0 36.0 38.0 31.4 38.0 120-124 35.5416 38.0 36.0 38.0 30.6 38.0 125-129 35.2941 38.0 35.2 38.0 29.2 38.0 130-134 35.11875 38.0 35.0 38.0 28.4 38.0 135-139 34.740750000000006 38.0 35.0 38.0 27.6 38.0 140-144 34.33325000000001 38.0 34.8 38.0 25.0 38.0 145-149 33.42485 38.0 34.2 38.0 20.8 38.0 150-151 28.962 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 3.0 17 1.0 18 2.0 19 1.0 20 1.0 21 3.0 22 2.0 23 5.0 24 9.0 25 10.0 26 18.0 27 32.0 28 33.0 29 28.0 30 50.0 31 64.0 32 80.0 33 141.0 34 221.0 35 372.0 36 963.0 37 1959.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.49260316636387 13.418115753957954 6.670127173630937 45.419153906047235 2 19.178768152228344 13.244867300951427 36.73009514271407 30.84626940410616 3 21.2 15.9 24.8 38.1 4 25.05 22.125 22.95 29.875 5 26.09457092819615 26.845133850387793 25.8443832874656 21.215911933950462 6 22.625 31.724999999999998 23.05 22.6 7 17.974999999999998 25.55 37.45 19.025 8 20.05 24.4 30.925000000000004 24.625 9 19.175 21.25 34.525 25.05 10-14 22.505 26.615 26.21 24.67 15-19 22.21 25.419999999999998 26.745 25.624999999999996 20-24 23.13 25.509999999999998 25.974999999999998 25.385 25-29 22.07 25.46 26.619999999999997 25.85 30-34 22.57 25.415 26.424999999999997 25.590000000000003 35-39 22.605 26.005 25.81 25.580000000000002 40-44 22.95 25.669999999999998 26.119999999999997 25.259999999999998 45-49 23.119999999999997 25.435000000000002 26.040000000000003 25.405 50-54 22.865 25.509999999999998 26.205000000000002 25.419999999999998 55-59 22.765 25.89 26.105 25.240000000000002 60-64 22.82 25.155 26.035000000000004 25.990000000000002 65-69 23.21 25.195 26.095000000000002 25.5 70-74 23.044999999999998 25.31 26.095000000000002 25.55 75-79 23.22 24.86 26.305 25.615 80-84 23.105 25.64 25.979999999999997 25.275 85-89 23.595 24.959999999999997 26.07 25.374999999999996 90-94 23.13 25.53 25.605 25.735000000000003 95-99 23.285 25.0 26.14 25.575 100-104 23.315 25.295 26.029999999999998 25.36 105-109 22.925 25.305 26.495 25.275 110-114 23.715 25.105 25.655 25.525 115-119 23.65 25.055 25.96 25.335 120-124 23.674999999999997 25.290000000000003 25.465 25.569999999999997 125-129 23.49 25.629999999999995 25.740000000000002 25.14 130-134 23.425 24.8 25.6 26.174999999999997 135-139 23.01 25.669999999999998 26.05 25.27 140-144 23.665 24.515 25.855 25.965 145-149 23.34 25.52 25.695 25.445 150-151 23.805354015511636 24.718538904178132 25.894420815611706 25.581686264698522 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.5 28 4.5 29 5.5 30 5.0 31 7.5 32 10.5 33 11.5 34 24.0 35 41.5 36 52.0 37 68.0 38 87.5 39 114.5 40 137.5 41 142.5 42 171.5 43 202.0 44 209.5 45 203.5 46 210.0 47 224.0 48 208.5 49 189.0 50 169.0 51 143.0 52 136.0 53 132.5 54 115.0 55 105.5 56 90.5 57 74.5 58 76.5 59 80.0 60 82.0 61 73.5 62 58.0 63 51.0 64 42.5 65 41.0 66 39.5 67 32.0 68 20.5 69 17.5 70 17.5 71 16.0 72 16.0 73 11.5 74 8.0 75 6.5 76 6.0 77 3.0 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.675 2 0.15 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 0.9375 0.0 0.0 0.0 0.0 124-125 1.075 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.3375 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.6 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138-139 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTGAT 10 0.0063298983 148.6923 1 ATGACCA 10 0.0068343505 144.975 8 GATGACC 10 0.0068343505 144.975 7 >>END_MODULE SRR6958396 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958396_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98525 33.0 33.0 34.0 32.0 34.0 2 32.8795 33.0 33.0 34.0 32.0 34.0 3 33.07425 34.0 33.0 34.0 32.0 34.0 4 33.02425 34.0 33.0 34.0 32.0 34.0 5 33.029 34.0 33.0 34.0 32.0 34.0 6 37.08925 38.0 38.0 38.0 36.0 38.0 7 37.02525 38.0 38.0 38.0 36.0 38.0 8 37.149 38.0 38.0 38.0 36.0 38.0 9 37.14275 38.0 38.0 38.0 36.0 38.0 10-14 37.0301 38.0 38.0 38.0 36.2 38.0 15-19 36.85 38.0 38.0 38.0 35.6 38.0 20-24 36.9376 38.0 38.0 38.0 35.6 38.0 25-29 37.09935 38.0 38.0 38.0 36.0 38.0 30-34 37.0505 38.0 38.0 38.0 36.0 38.0 35-39 37.0881 38.0 38.0 38.0 36.0 38.0 40-44 37.045249999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.917550000000006 38.0 38.0 38.0 35.8 38.0 50-54 36.840799999999994 38.0 38.0 38.0 35.4 38.0 55-59 36.9846 38.0 38.0 38.0 36.0 38.0 60-64 36.84045 38.0 38.0 38.0 35.4 38.0 65-69 36.6664 38.0 38.0 38.0 34.4 38.0 70-74 36.594100000000005 38.0 38.0 38.0 34.2 38.0 75-79 36.38485 38.0 38.0 38.0 34.0 38.0 80-84 36.30065 38.0 38.0 38.0 33.8 38.0 85-89 36.299 38.0 38.0 38.0 33.4 38.0 90-94 36.19435 38.0 38.0 38.0 33.4 38.0 95-99 36.0961 38.0 37.6 38.0 33.2 38.0 100-104 35.90705 38.0 37.0 38.0 32.8 38.0 105-109 35.7681 38.0 36.8 38.0 31.8 38.0 110-114 35.55395 38.0 36.0 38.0 30.6 38.0 115-119 35.39985 38.0 36.0 38.0 30.4 38.0 120-124 35.197500000000005 38.0 36.0 38.0 28.8 38.0 125-129 35.195499999999996 38.0 36.0 38.0 29.2 38.0 130-134 34.71555 38.0 35.0 38.0 27.0 38.0 135-139 34.34995 38.0 35.0 38.0 24.8 38.0 140-144 34.0334 38.0 34.6 38.0 23.0 38.0 145-149 33.3589 38.0 33.8 38.0 20.6 38.0 150-151 27.903875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 2.0 15 5.0 16 1.0 17 3.0 18 5.0 19 10.0 20 4.0 21 10.0 22 9.0 23 9.0 24 12.0 25 19.0 26 16.0 27 34.0 28 37.0 29 32.0 30 61.0 31 68.0 32 99.0 33 128.0 34 184.0 35 298.0 36 744.0 37 2202.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.73343335833959 17.75443860965241 10.72768192048012 37.78444611152788 2 28.075 23.375 29.125 19.425 3 21.75 25.5 29.075 23.674999999999997 4 25.374999999999996 30.7 21.275 22.650000000000002 5 27.825 30.65 21.9 19.625 6 22.825 36.525 20.25 20.4 7 22.875 20.599999999999998 34.150000000000006 22.375 8 24.275 23.45 25.15 27.125 9 24.65 22.625 27.474999999999998 25.25 10-14 25.740000000000002 26.565 22.88 24.815 15-19 25.3 25.685000000000002 24.6 24.415 20-24 25.724999999999998 25.655 24.535 24.085 25-29 25.805 25.259999999999998 24.575 24.36 30-34 25.25 25.569999999999997 24.474999999999998 24.705 35-39 25.46 25.790000000000003 24.279999999999998 24.47 40-44 25.09 25.39 24.47 25.05 45-49 25.85 25.5 24.52 24.13 50-54 25.655 25.805 24.57 23.97 55-59 25.235000000000003 25.074999999999996 24.695 24.995 60-64 25.779999999999998 25.509999999999998 24.455 24.255 65-69 25.77 25.569999999999997 24.68 23.98 70-74 26.200000000000003 25.230000000000004 24.72 23.849999999999998 75-79 25.91 25.52 24.955 23.615 80-84 25.91 25.564999999999998 24.615000000000002 23.91 85-89 25.75 25.174999999999997 24.915000000000003 24.16 90-94 26.07 25.790000000000003 24.735 23.405 95-99 25.81 26.040000000000003 24.685000000000002 23.465 100-104 26.355 25.39 24.34 23.915 105-109 26.135 26.3 24.645 22.919999999999998 110-114 25.974999999999998 25.71 24.855 23.46 115-119 25.990000000000002 25.679999999999996 24.905 23.425 120-124 25.91 26.25 24.4 23.44 125-129 25.97 26.575 24.925 22.53 130-134 26.055 25.735000000000003 24.685000000000002 23.525 135-139 26.21 25.555 25.31 22.925 140-144 25.94 25.825 25.335 22.900000000000002 145-149 26.605 25.805 24.8 22.79 150-151 26.729205753596 26.6541588492808 23.864915572232643 22.751719824890557 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 0.5 28 3.0 29 7.5 30 8.0 31 8.5 32 13.5 33 19.5 34 23.5 35 32.0 36 44.5 37 50.5 38 62.0 39 98.0 40 133.5 41 134.5 42 144.0 43 173.5 44 193.0 45 192.0 46 185.0 47 190.0 48 203.5 49 195.0 50 171.0 51 160.0 52 135.0 53 115.0 54 117.0 55 112.5 56 94.5 57 91.5 58 90.0 59 75.0 60 81.5 61 74.0 62 53.5 63 59.5 64 71.5 65 59.5 66 45.5 67 49.0 68 42.0 69 35.0 70 37.5 71 33.0 72 21.5 73 17.0 74 14.5 75 10.0 76 5.5 77 3.5 78 2.5 79 1.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7315842583249244 1.4500000000000002 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.8 0.0 0.0 0.0 0.0 122-123 0.9125 0.0 0.0 0.0 0.0 124-125 1.05 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.3875 0.0125 0.0 0.0 0.0 132-133 1.575 0.025 0.0 0.0 0.0 134-135 1.7875 0.025 0.0 0.0 0.0 136-137 1.9375 0.025 0.0 0.0 0.0 138-139 2.2249999999999996 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGGTG 10 0.006830828 145.0 145 >>END_MODULE Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874442 spots for SRR6958396.sra Written 874442 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra Read 874434 spots for SRR6958396.sra Written 874434 spots for SRR6958396.sra SRR ids: ['SRR6958396.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u1n4jcu2 SRR6958396.sra spots: 17488688 blocks: [[1, 874434], [874435, 1748868], [1748869, 2623302], [2623303, 3497736], [3497737, 4372170], [4372171, 5246604], [5246605, 6121038], [6121039, 6995472], [6995473, 7869906], [7869907, 8744340], [8744341, 9618774], [9618775, 10493208], [10493209, 11367642], [11367643, 12242076], [12242077, 13116510], [13116511, 13990944], [13990945, 14865378], [14865379, 15739812], [15739813, 16614246], [16614247, 17488688]] SRR6958396 file size 5904642 SRR6958396 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958396 SRR6958396_1.fastq SRR6958396_2.fastq Input file: SRR6958396_1.fastq Paired file: SRR6958396_2.fastq trimmed: SRR6958396-trimmed-pair1.fastq, SRR6958396-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:58:26 2024 >> started Fri Dec 6 21:58:46 2024 >> done (20.073s) 17488688 read pairs processed; of these: 10149 ( 0.06%) short read pairs filtered out after trimming by size control 7528 ( 0.04%) empty read pairs filtered out after trimming by size control 17471011 (99.90%) read pairs available; of these: 6085812 (34.83%) trimmed read pairs available after processing 11385199 (65.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 6 0.00% 25 5 0.00% 26 7 0.00% 27 5 0.00% 28 4 0.00% 29 9 0.00% 30 10 0.00% 31 4 0.00% 32 6 0.00% 33 6 0.00% 34 3 0.00% 35 7 0.00% 36 6 0.00% 37 9 0.00% 38 5 0.00% 39 9 0.00% 40 12 0.00% 41 9 0.00% 42 13 0.00% 43 7 0.00% 44 16 0.00% 45 12 0.00% 46 8 0.00% 47 17 0.00% 48 11 0.00% 49 17 0.00% 50 22 0.00% 51 32 0.00% 52 25 0.00% 53 39 0.00% 54 31 0.00% 55 22 0.00% 56 43 0.00% 57 47 0.00% 58 51 0.00% 59 47 0.00% 60 67 0.00% 61 73 0.00% 62 79 0.00% 63 92 0.00% 64 98 0.00% 65 107 0.00% 66 118 0.00% 67 134 0.00% 68 145 0.00% 69 178 0.00% 70 176 0.00% 71 222 0.00% 72 214 0.00% 73 253 0.00% 74 283 0.00% 75 304 0.00% 76 338 0.00% 77 430 0.00% 78 451 0.00% 79 490 0.00% 80 575 0.00% 81 678 0.00% 82 713 0.00% 83 843 0.00% 84 1390 0.01% 85 1724 0.01% 86 1745 0.01% 87 1922 0.01% 88 2012 0.01% 89 2119 0.01% 90 2088 0.01% 91 2332 0.01% 92 2510 0.01% 93 2728 0.02% 94 2893 0.02% 95 3128 0.02% 96 3269 0.02% 97 3490 0.02% 98 3823 0.02% 99 3994 0.02% 100 4372 0.03% 101 4620 0.03% 102 4964 0.03% 103 5272 0.03% 104 5730 0.03% 105 6141 0.04% 106 6544 0.04% 107 6906 0.04% 108 7374 0.04% 109 7915 0.05% 110 8326 0.05% 111 8769 0.05% 112 9447 0.05% 113 9996 0.06% 114 10606 0.06% 115 11359 0.07% 116 12262 0.07% 117 12470 0.07% 118 13607 0.08% 119 13976 0.08% 120 14895 0.09% 121 15599 0.09% 122 16297 0.09% 123 17259 0.10% 124 18361 0.11% 125 19543 0.11% 126 20489 0.12% 127 21644 0.12% 128 22922 0.13% 129 24415 0.14% 130 25598 0.15% 131 26942 0.15% 132 29002 0.17% 133 30990 0.18% 134 32693 0.19% 135 34922 0.20% 136 37469 0.21% 137 40224 0.23% 138 43152 0.25% 139 46550 0.27% 140 50701 0.29% 141 55941 0.32% 142 63058 0.36% 143 71802 0.41% 144 84823 0.49% 145 103142 0.59% 146 135825 0.78% 147 182710 1.05% 148 291737 1.67% 149 613025 3.51% 150 3674597 21.03% 151 11385199 65.17% 17471011 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=24 prefix-density=0.96 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=32.55 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=18 prefix-density=0.67 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=412.75 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=18.0 sequence=AGCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958396 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:59:33 Started mapping on | Dec 06 21:59:34 Finished on | Dec 06 22:01:09 Mapping speed, Million of reads per hour | 662.06 Number of input reads | 17471011 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17164269 Uniquely mapped reads % | 98.24% Average mapped length | 298.34 Number of splices: Total | 20560633 Number of splices: Annotated (sjdb) | 19404510 Number of splices: GT/AG | 20298579 Number of splices: GC/AG | 239613 Number of splices: AT/AC | 7662 Number of splices: Non-canonical | 14779 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 102990 % of reads mapped to multiple loci | 0.59% Number of reads mapped to too many loci | 10837 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.70% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 209712 209712 209712 N_multimapping 102990 102990 102990 N_noFeature 535703 16682295 664452 N_ambiguous 419985 2191 68027 UnstrandedReadsAssigned:16208581 PositiveStrandReadsAssigned:479783 NegativeStrandReadsAssigned:16431790 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958396 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958396-trimmed-pair1.fastq SRR6958396-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,471,011 reads, 16,444,630 reads pseudoaligned [quant] estimated average fragment length: 275.832 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR6958396.ke.tsv 35125 SRR6958396.se.tsv 88098 total ==> SRR6958396.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.783 0 0 PNS24247 1044 769.168 41.0326 4.79855 PNS24249 1928 1653.17 25.1274 1.3672 PNS24246 1044 769.168 41.0326 4.79855 PNS24248 1044 769.168 41.0326 4.79855 PNS24244 1471 1196.17 25.7749 1.93824 PNS24243 293 76.1627 0 0 KQK14069 1603 1328.17 4698.01 318.173 KQK14071 474 214.492 44.0713 18.4819 ==> SRR6958396.se.tsv <== BRADI_1g14170v3 5185 BRADI_1g53295v3 228 BRADI_1g59795v3 176 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 212 BRADI_1g74790v3 72 BRADI_1g09890v3 0 BRADI_1g77505v3 164 BRADI_1g48960v3 0 SRR6958396 completed mapping pipeline successfully