Starting /dee2/code/volunteer_pipeline.sh SRR6958397 current disk space = 1548892213248 free memory = 1600290028 SRR6958397 SRAfilesize 4f103178cd7cbbfd740507ff85772378 SRR6958397.sra SRR6958397.sra file validated SRR6958397 is paired end SRR6958397 is conventional basespace SRR6958397 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958397_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.15175 28.0 18.0 33.0 18.0 33.0 2 30.20125 32.0 27.0 33.0 25.0 33.0 3 31.68675 33.0 32.0 33.0 27.0 34.0 4 31.961 33.0 31.0 33.0 29.0 34.0 5 32.02275 33.0 32.0 33.0 30.0 34.0 6 36.25675 38.0 37.0 38.0 33.0 38.0 7 36.85675 38.0 38.0 38.0 35.0 38.0 8 37.09425 38.0 38.0 38.0 36.0 38.0 9 37.31275 38.0 38.0 38.0 37.0 38.0 10-14 37.2864 38.0 38.0 38.0 36.6 38.0 15-19 37.3408 38.0 38.0 38.0 37.0 38.0 20-24 37.197950000000006 38.0 38.0 38.0 36.4 38.0 25-29 37.10815 38.0 38.0 38.0 36.0 38.0 30-34 36.8127 38.0 38.0 38.0 35.4 38.0 35-39 36.8449 38.0 38.0 38.0 35.4 38.0 40-44 36.8506 38.0 38.0 38.0 35.4 38.0 45-49 36.7106 38.0 38.0 38.0 34.8 38.0 50-54 36.57045 38.0 38.0 38.0 34.2 38.0 55-59 36.4508 38.0 38.0 38.0 33.8 38.0 60-64 36.7966 38.0 38.0 38.0 34.6 38.0 65-69 36.459649999999996 38.0 37.8 38.0 33.6 38.0 70-74 36.20895 38.0 37.2 38.0 33.2 38.0 75-79 36.053999999999995 38.0 37.0 38.0 32.2 38.0 80-84 35.97815 38.0 37.0 38.0 32.0 38.0 85-89 35.94455000000001 38.0 37.0 38.0 31.8 38.0 90-94 35.91825 38.0 36.8 38.0 31.6 38.0 95-99 35.360899999999994 38.0 36.0 38.0 29.2 38.0 100-104 35.0838 38.0 35.4 38.0 27.6 38.0 105-109 34.979749999999996 38.0 35.0 38.0 27.6 38.0 110-114 34.7606 38.0 35.0 38.0 26.2 38.0 115-119 34.287 38.0 34.2 38.0 23.8 38.0 120-124 33.9794 38.0 34.0 38.0 22.6 38.0 125-129 33.9486 38.0 33.8 38.0 21.6 38.0 130-134 33.77105 38.0 33.8 38.0 22.4 38.0 135-139 32.174549999999996 36.6 31.0 38.0 15.6 38.0 140-144 31.71275 36.0 30.4 38.0 13.4 38.0 145-149 30.067500000000003 35.6 28.8 38.0 8.6 38.0 150-151 25.096375000000002 33.0 11.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 0.0 15 0.0 16 4.0 17 2.0 18 5.0 19 4.0 20 5.0 21 10.0 22 15.0 23 15.0 24 20.0 25 22.0 26 32.0 27 38.0 28 44.0 29 67.0 30 87.0 31 114.0 32 170.0 33 229.0 34 304.0 35 528.0 36 1028.0 37 1254.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.91384950926936 12.813522355507088 7.388222464558343 42.88440567066521 2 20.150000000000002 11.4 31.6 36.85 3 19.025 18.5 25.275 37.2 4 26.55 22.85 22.825 27.775 5 29.325000000000003 25.5 23.375 21.8 6 24.075 31.574999999999996 22.475 21.875 7 16.1 23.825 40.150000000000006 19.925 8 21.425 23.5 28.175 26.900000000000002 9 18.675 21.3 32.800000000000004 27.224999999999998 10-14 22.575 26.06 26.205000000000002 25.16 15-19 22.345000000000002 24.709999999999997 26.590000000000003 26.355 20-24 22.32 25.319999999999997 27.02 25.34 25-29 23.155 25.44 26.1 25.305 30-34 23.01 24.785 26.1 26.105 35-39 23.605 24.834999999999997 26.075 25.485000000000003 40-44 23.26 25.224999999999998 26.240000000000002 25.275 45-49 23.07 24.88 25.34 26.71 50-54 22.945 24.474999999999998 26.405 26.174999999999997 55-59 23.335 25.55 25.430000000000003 25.685000000000002 60-64 22.895 24.755 26.314999999999998 26.035000000000004 65-69 23.09 25.545 25.480000000000004 25.885 70-74 23.755000000000003 24.59 25.855 25.8 75-79 23.695 24.585 25.695 26.025 80-84 22.830000000000002 24.675 26.3 26.195 85-89 23.345 24.72 25.590000000000003 26.345000000000002 90-94 24.099999999999998 24.65 25.935000000000002 25.314999999999998 95-99 23.549999999999997 24.415 25.845000000000002 26.19 100-104 23.400000000000002 25.285000000000004 25.0 26.314999999999998 105-109 23.935000000000002 24.95 25.56 25.555 110-114 23.34 24.740000000000002 26.13 25.790000000000003 115-119 23.49 24.495 26.400000000000002 25.615 120-124 24.275 24.66 25.035 26.029999999999998 125-129 23.89 24.445 25.615 26.05 130-134 24.04 25.005 25.124999999999996 25.83 135-139 24.45 24.895 25.19 25.465 140-144 23.825 24.995 25.35 25.83 145-149 23.86 24.865000000000002 25.56 25.715 150-151 23.4125 24.3125 26.3625 25.912499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 1.0 26 2.0 27 1.5 28 0.5 29 2.0 30 4.0 31 8.5 32 11.0 33 13.5 34 21.5 35 36.0 36 48.0 37 59.0 38 86.5 39 111.0 40 119.5 41 145.0 42 183.5 43 191.5 44 181.0 45 206.0 46 218.5 47 194.5 48 199.5 49 192.5 50 170.5 51 148.5 52 133.0 53 133.5 54 110.0 55 91.5 56 87.0 57 93.5 58 87.5 59 65.5 60 67.5 61 70.5 62 70.0 63 61.5 64 46.5 65 41.5 66 43.5 67 43.5 68 42.0 69 35.0 70 25.0 71 25.0 72 19.0 73 10.5 74 13.5 75 11.0 76 5.5 77 4.5 78 2.0 79 0.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.2375 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.8875 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.4125 0.0 0.0 0.0 0.0 136-137 2.5999999999999996 0.0 0.0 0.0 0.0 138-139 2.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCGCTC 10 0.006841402 144.925 4 >>END_MODULE SRR6958397 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958397_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.583 33.0 33.0 34.0 32.0 34.0 2 32.47875 33.0 33.0 34.0 31.0 34.0 3 32.4255 33.0 33.0 34.0 31.0 34.0 4 32.52225 33.0 33.0 34.0 32.0 34.0 5 32.428 33.0 33.0 34.0 31.0 34.0 6 36.36325 38.0 38.0 38.0 34.0 38.0 7 36.55675 38.0 38.0 38.0 34.0 38.0 8 36.45875 38.0 38.0 38.0 34.0 38.0 9 36.68525 38.0 38.0 38.0 35.0 38.0 10-14 36.5261 38.0 38.0 38.0 34.0 38.0 15-19 36.6912 38.0 38.0 38.0 35.2 38.0 20-24 36.718900000000005 38.0 38.0 38.0 35.0 38.0 25-29 36.73805 38.0 38.0 38.0 35.2 38.0 30-34 36.60725 38.0 38.0 38.0 34.8 38.0 35-39 36.4799 38.0 38.0 38.0 34.4 38.0 40-44 36.384699999999995 38.0 38.0 38.0 34.0 38.0 45-49 36.40535 38.0 38.0 38.0 34.0 38.0 50-54 36.383599999999994 38.0 38.0 38.0 34.2 38.0 55-59 36.329899999999995 38.0 38.0 38.0 34.0 38.0 60-64 36.21205 38.0 38.0 38.0 33.4 38.0 65-69 35.897149999999996 38.0 37.2 38.0 31.6 38.0 70-74 35.77605 38.0 37.0 38.0 31.0 38.0 75-79 35.8789 38.0 37.0 38.0 32.0 38.0 80-84 35.7882 38.0 37.0 38.0 31.6 38.0 85-89 35.6502 38.0 37.0 38.0 31.2 38.0 90-94 35.48725 38.0 36.8 38.0 30.2 38.0 95-99 35.333600000000004 38.0 36.0 38.0 29.0 38.0 100-104 35.0438 38.0 36.0 38.0 28.0 38.0 105-109 34.748149999999995 38.0 35.0 38.0 26.8 38.0 110-114 34.531349999999996 38.0 35.0 38.0 25.8 38.0 115-119 34.4264 38.0 34.8 38.0 25.4 38.0 120-124 33.89535000000001 38.0 34.2 38.0 22.2 38.0 125-129 33.78825 38.0 34.0 38.0 22.0 38.0 130-134 33.047850000000004 38.0 32.8 38.0 18.6 38.0 135-139 32.512 38.0 31.0 38.0 14.0 38.0 140-144 31.939799999999998 37.4 31.0 38.0 13.0 38.0 145-149 29.868399999999998 36.0 28.6 38.0 6.0 38.0 150-151 23.854875 30.5 12.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 5.0 4 3.0 5 2.0 6 4.0 7 0.0 8 1.0 9 1.0 10 2.0 11 2.0 12 0.0 13 3.0 14 1.0 15 4.0 16 2.0 17 2.0 18 3.0 19 7.0 20 18.0 21 7.0 22 19.0 23 20.0 24 23.0 25 29.0 26 39.0 27 43.0 28 43.0 29 55.0 30 83.0 31 115.0 32 138.0 33 187.0 34 250.0 35 452.0 36 910.0 37 1514.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.825 18.35 12.85 31.974999999999998 2 29.95 23.724999999999998 25.8 20.525 3 22.725 26.674999999999997 27.025 23.575 4 25.0 32.7 18.775 23.525 5 26.924999999999997 33.050000000000004 19.725 20.3 6 23.1 34.949999999999996 19.900000000000002 22.05 7 22.55 19.625 34.525 23.3 8 24.65 23.75 22.675 28.925 9 23.425 23.05 26.650000000000002 26.875 10-14 26.185000000000002 25.474999999999998 23.565 24.775 15-19 25.61 25.835 24.13 24.425 20-24 25.869999999999997 25.555 24.07 24.505 25-29 26.135 25.580000000000002 23.95 24.335 30-34 25.55 25.569999999999997 24.26 24.62 35-39 25.82 25.44 24.51 24.23 40-44 26.1 24.975 24.085 24.84 45-49 26.125 25.295 23.86 24.72 50-54 25.97 25.105 24.345 24.58 55-59 26.375 25.564999999999998 24.01 24.05 60-64 26.14 25.665 24.095 24.099999999999998 65-69 26.26 25.564999999999998 24.195 23.98 70-74 26.6 24.69 24.48 24.23 75-79 25.885 25.2 24.68 24.235 80-84 25.77 25.27 24.685000000000002 24.275 85-89 26.185000000000002 25.105 24.7 24.01 90-94 26.150000000000002 25.275 24.925 23.65 95-99 26.19 25.535000000000004 24.7 23.575 100-104 25.990000000000002 25.275 24.315 24.42 105-109 25.814999999999998 25.624999999999996 24.93 23.630000000000003 110-114 25.72 25.47 24.8 24.01 115-119 26.22 25.72 24.779999999999998 23.28 120-124 25.790000000000003 25.540000000000003 24.990000000000002 23.68 125-129 25.965 25.974999999999998 24.52 23.54 130-134 26.555 25.619999999999997 24.279999999999998 23.544999999999998 135-139 25.85 25.71 24.91 23.53 140-144 26.75 25.295 24.795 23.16 145-149 26.58 25.845000000000002 24.245 23.330000000000002 150-151 26.437500000000004 25.224999999999998 25.25 23.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 3.5 28 4.0 29 5.0 30 8.0 31 6.5 32 6.0 33 14.5 34 23.0 35 26.5 36 33.5 37 45.5 38 65.5 39 81.5 40 110.0 41 149.0 42 175.0 43 165.0 44 153.0 45 189.0 46 211.5 47 186.5 48 182.0 49 188.5 50 170.5 51 162.5 52 142.0 53 120.5 54 106.5 55 97.0 56 105.0 57 109.0 58 96.5 59 79.0 60 81.0 61 78.0 62 69.5 63 72.5 64 73.0 65 63.0 66 49.5 67 41.5 68 38.0 69 43.5 70 42.0 71 33.5 72 30.5 73 24.5 74 13.0 75 6.5 76 4.5 77 5.0 78 4.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21776431995963 98.3 2 0.6308352258390109 1.25 3 0.1514004542013626 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.2375 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.4125 0.0 0.0 0.0 0.0 136-137 2.6125 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGAGC 10 0.006830828 145.0 7 >>END_MODULE Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060470 spots for SRR6958397.sra Written 1060470 spots for SRR6958397.sra Read 1060485 spots for SRR6958397.sra Written 1060485 spots for SRR6958397.sra SRR ids: ['SRR6958397.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8u6lgfoh SRR6958397.sra spots: 21209415 blocks: [[1, 1060470], [1060471, 2120940], [2120941, 3181410], [3181411, 4241880], [4241881, 5302350], [5302351, 6362820], [6362821, 7423290], [7423291, 8483760], [8483761, 9544230], [9544231, 10604700], [10604701, 11665170], [11665171, 12725640], [12725641, 13786110], [13786111, 14846580], [14846581, 15907050], [15907051, 16967520], [16967521, 18027990], [18027991, 19088460], [19088461, 20148930], [20148931, 21209415]] SRR6958397 file size 7165474 SRR6958397 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958397 SRR6958397_1.fastq SRR6958397_2.fastq Input file: SRR6958397_1.fastq Paired file: SRR6958397_2.fastq trimmed: SRR6958397-trimmed-pair1.fastq, SRR6958397-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:02:06 2024 >> started Fri Dec 6 22:02:31 2024 >> done (25.341s) 21209415 read pairs processed; of these: 31045 ( 0.15%) short read pairs filtered out after trimming by size control 26855 ( 0.13%) empty read pairs filtered out after trimming by size control 21151515 (99.73%) read pairs available; of these: 9563225 (45.21%) trimmed read pairs available after processing 11588290 (54.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 4 0.00% 21 2 0.00% 22 4 0.00% 23 3 0.00% 24 4 0.00% 25 7 0.00% 26 4 0.00% 27 4 0.00% 28 3 0.00% 29 5 0.00% 30 8 0.00% 31 8 0.00% 32 13 0.00% 33 12 0.00% 34 14 0.00% 35 6 0.00% 36 8 0.00% 37 13 0.00% 38 11 0.00% 39 15 0.00% 40 16 0.00% 41 20 0.00% 42 21 0.00% 43 23 0.00% 44 20 0.00% 45 33 0.00% 46 33 0.00% 47 34 0.00% 48 31 0.00% 49 28 0.00% 50 55 0.00% 51 65 0.00% 52 45 0.00% 53 61 0.00% 54 68 0.00% 55 104 0.00% 56 92 0.00% 57 101 0.00% 58 112 0.00% 59 134 0.00% 60 153 0.00% 61 154 0.00% 62 180 0.00% 63 183 0.00% 64 200 0.00% 65 205 0.00% 66 213 0.00% 67 264 0.00% 68 267 0.00% 69 273 0.00% 70 336 0.00% 71 366 0.00% 72 410 0.00% 73 460 0.00% 74 502 0.00% 75 601 0.00% 76 623 0.00% 77 695 0.00% 78 792 0.00% 79 906 0.00% 80 956 0.00% 81 1161 0.01% 82 1318 0.01% 83 1509 0.01% 84 2923 0.01% 85 3651 0.02% 86 3636 0.02% 87 3740 0.02% 88 3762 0.02% 89 3975 0.02% 90 4133 0.02% 91 4273 0.02% 92 4412 0.02% 93 4799 0.02% 94 4982 0.02% 95 5423 0.03% 96 5736 0.03% 97 6113 0.03% 98 6392 0.03% 99 6884 0.03% 100 7152 0.03% 101 7707 0.04% 102 8268 0.04% 103 8890 0.04% 104 9542 0.05% 105 10308 0.05% 106 11059 0.05% 107 11731 0.06% 108 12182 0.06% 109 12859 0.06% 110 13884 0.07% 111 14853 0.07% 112 15774 0.07% 113 16933 0.08% 114 17875 0.08% 115 19021 0.09% 116 20012 0.09% 117 21115 0.10% 118 22272 0.11% 119 23000 0.11% 120 24378 0.12% 121 25739 0.12% 122 27221 0.13% 123 29298 0.14% 124 30818 0.15% 125 32336 0.15% 126 34860 0.16% 127 36880 0.17% 128 38892 0.18% 129 41697 0.20% 130 42969 0.20% 131 46308 0.22% 132 48975 0.23% 133 52975 0.25% 134 56576 0.27% 135 60336 0.29% 136 64581 0.31% 137 69267 0.33% 138 74770 0.35% 139 81065 0.38% 140 87801 0.42% 141 97372 0.46% 142 109535 0.52% 143 126835 0.60% 144 149691 0.71% 145 184052 0.87% 146 235987 1.12% 147 329950 1.56% 148 520051 2.46% 149 1059048 5.01% 150 5369718 25.39% 151 11588290 54.79% 21151515 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=20 prefix-density=0.66 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=55.28 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.0 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=19 prefix-density=0.51 prefix-fanout=2.9 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.14 sequence-density-rank=19 fanout-score=47.78 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=10.1 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR6958397 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:03:12 Started mapping on | Dec 06 22:03:13 Finished on | Dec 06 22:05:16 Mapping speed, Million of reads per hour | 619.07 Number of input reads | 21151515 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20490873 Uniquely mapped reads % | 96.88% Average mapped length | 296.69 Number of splices: Total | 23889578 Number of splices: Annotated (sjdb) | 22473632 Number of splices: GT/AG | 23571998 Number of splices: GC/AG | 278934 Number of splices: AT/AC | 9205 Number of splices: Non-canonical | 29441 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.52 Insertion rate per base | 0.01% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 166146 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 13682 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.87% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 513811 513811 513811 N_multimapping 166146 166146 166146 N_noFeature 622046 19948749 766754 N_ambiguous 478215 2741 81927 UnstrandedReadsAssigned:19390612 PositiveStrandReadsAssigned:539383 NegativeStrandReadsAssigned:19642192 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958397 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958397-trimmed-pair1.fastq SRR6958397-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,151,515 reads, 19,643,194 reads pseudoaligned [quant] estimated average fragment length: 266.941 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR6958397.ke.tsv 35125 SRR6958397.se.tsv 88098 total ==> SRR6958397.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.537 0 0 PNS24247 1044 778.059 61.4124 5.97867 PNS24249 1928 1662.06 50.2719 2.29108 PNS24246 1044 778.059 61.4124 5.97867 PNS24248 1044 778.059 61.4124 5.97867 PNS24244 1471 1205.06 41.491 2.60799 PNS24243 293 80.5731 0 0 KQK14069 1603 1337.06 2873.69 162.799 KQK14071 474 221.79 59.0529 20.1679 ==> SRR6958397.se.tsv <== BRADI_1g14170v3 3324 BRADI_1g53295v3 397 BRADI_1g59795v3 269 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 284 BRADI_1g74790v3 119 BRADI_1g09890v3 0 BRADI_1g77505v3 214 BRADI_1g48960v3 0 SRR6958397 completed mapping pipeline successfully