Starting /dee2/code/volunteer_pipeline.sh SRR6958398 current disk space = 1548871471104 free memory = 1598199788 SRR6958398 SRAfilesize b41f1c2a5c42ba2fec668e67bd5423ba SRR6958398.sra SRR6958398.sra file validated SRR6958398 is paired end SRR6958398 is conventional basespace SRR6958398 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958398_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.7255 28.0 18.0 33.0 18.0 34.0 2 30.69825 32.0 30.0 33.0 27.0 34.0 3 31.84025 33.0 32.0 33.0 27.0 34.0 4 32.0405 33.0 31.0 33.0 29.0 34.0 5 32.37275 33.0 33.0 34.0 31.0 34.0 6 35.962 38.0 36.0 38.0 33.0 38.0 7 36.59775 38.0 37.0 38.0 34.0 38.0 8 37.131 38.0 38.0 38.0 36.0 38.0 9 37.265 38.0 38.0 38.0 36.0 38.0 10-14 37.299400000000006 38.0 38.0 38.0 36.4 38.0 15-19 37.3983 38.0 38.0 38.0 37.0 38.0 20-24 37.27955 38.0 38.0 38.0 36.8 38.0 25-29 37.1038 38.0 38.0 38.0 36.0 38.0 30-34 36.828250000000004 38.0 38.0 38.0 35.2 38.0 35-39 36.79109999999999 38.0 38.0 38.0 34.8 38.0 40-44 36.83805 38.0 38.0 38.0 35.0 38.0 45-49 36.731049999999996 38.0 38.0 38.0 34.6 38.0 50-54 36.51485 38.0 38.0 38.0 34.0 38.0 55-59 36.382999999999996 38.0 38.0 38.0 33.4 38.0 60-64 36.7572 38.0 38.0 38.0 34.8 38.0 65-69 36.44540000000001 38.0 37.8 38.0 33.4 38.0 70-74 36.23245 38.0 37.0 38.0 33.2 38.0 75-79 36.02935000000001 38.0 37.0 38.0 32.2 38.0 80-84 35.9475 38.0 37.0 38.0 31.6 38.0 85-89 35.99435 38.0 36.8 38.0 32.0 38.0 90-94 35.95885 38.0 36.8 38.0 32.0 38.0 95-99 35.32895 38.0 35.8 38.0 29.4 38.0 100-104 34.93455 38.0 35.2 38.0 27.0 38.0 105-109 34.803250000000006 38.0 35.0 38.0 26.6 38.0 110-114 34.5008 38.0 34.4 38.0 25.0 38.0 115-119 33.94715000000001 38.0 34.0 38.0 22.2 38.0 120-124 33.720600000000005 38.0 33.8 38.0 21.2 38.0 125-129 33.872350000000004 38.0 33.8 38.0 22.0 38.0 130-134 33.7907 38.0 34.0 38.0 22.0 38.0 135-139 32.02305 36.4 31.0 38.0 15.2 38.0 140-144 31.602000000000004 36.0 30.6 38.0 13.4 38.0 145-149 30.06345 35.4 29.2 38.0 8.6 38.0 150-151 24.665374999999997 33.0 8.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 1.0 16 2.0 17 5.0 18 5.0 19 6.0 20 8.0 21 5.0 22 13.0 23 6.0 24 22.0 25 24.0 26 24.0 27 42.0 28 54.0 29 88.0 30 97.0 31 130.0 32 158.0 33 198.0 34 329.0 35 561.0 36 968.0 37 1251.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.93705528188287 12.370005473453748 5.911330049261084 36.7816091954023 2 21.425 11.025 33.050000000000004 34.5 3 19.925 15.125 24.85 40.1 4 25.35 20.3 23.075000000000003 31.275 5 27.025 24.875 23.375 24.725 6 25.85 29.2 22.925 22.025 7 20.5 23.599999999999998 35.675000000000004 20.225 8 22.05 23.3 28.775000000000002 25.874999999999996 9 19.975 22.075 32.65 25.3 10-14 23.52 25.06 25.759999999999998 25.66 15-19 23.655 23.91 25.85 26.584999999999997 20-24 24.104999999999997 24.545 25.545 25.805 25-29 24.310000000000002 24.37 25.145 26.174999999999997 30-34 24.505 23.674999999999997 25.564999999999998 26.255 35-39 23.544999999999998 24.375 25.264999999999997 26.815 40-44 24.54 23.785 25.255 26.419999999999998 45-49 23.799999999999997 24.415 25.174999999999997 26.61 50-54 24.490000000000002 23.76 25.695 26.055 55-59 24.01 24.12 25.195 26.674999999999997 60-64 23.865 24.05 25.040000000000003 27.045 65-69 24.145 24.085 25.445 26.325 70-74 23.61 23.9 25.580000000000002 26.91 75-79 24.585 23.505000000000003 25.255 26.655 80-84 24.29 24.505 24.985 26.22 85-89 24.52 24.2 24.625 26.655 90-94 25.09 23.86 24.725 26.325 95-99 24.87 23.485 25.245 26.400000000000002 100-104 24.46 23.935000000000002 25.119999999999997 26.484999999999996 105-109 24.665 23.855 25.06 26.419999999999998 110-114 24.15 24.265 25.165 26.419999999999998 115-119 25.019999999999996 23.415 24.815 26.75 120-124 25.124999999999996 23.805 24.795 26.275 125-129 24.884999999999998 23.72 25.240000000000002 26.155 130-134 25.314999999999998 24.25 24.98 25.455 135-139 24.75 23.919999999999998 24.805 26.525 140-144 24.779999999999998 23.799999999999997 25.35 26.07 145-149 24.585 24.66 24.445 26.31 150-151 25.5375 22.6 25.2875 26.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 0.0 27 0.0 28 1.5 29 3.5 30 5.5 31 10.0 32 11.0 33 17.5 34 24.0 35 26.5 36 32.5 37 38.5 38 52.0 39 73.0 40 93.5 41 113.0 42 136.0 43 174.0 44 189.5 45 181.0 46 191.5 47 184.5 48 185.0 49 178.5 50 164.5 51 173.5 52 153.5 53 118.5 54 110.5 55 109.0 56 90.5 57 96.0 58 106.0 59 98.0 60 91.0 61 88.5 62 90.5 63 79.5 64 71.5 65 76.0 66 65.5 67 57.0 68 53.0 69 41.5 70 32.5 71 27.5 72 21.0 73 12.5 74 13.5 75 13.0 76 10.0 77 5.5 78 2.5 79 2.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.649999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47103274559194 98.725 2 0.3526448362720403 0.7000000000000001 3 0.12594458438287154 0.375 4 0.05037783375314861 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.325 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.9 0.0 0.0 0.0 0.0 126-127 2.0875 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.4625 0.0 0.0 0.0 0.0 132-133 2.7375 0.0 0.0 0.0 0.0 134-135 3.0125 0.0 0.0 0.0 0.0 136-137 3.3875 0.0 0.0 0.0 0.0 138-139 3.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958398 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958398_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.51325 33.0 33.0 34.0 32.0 34.0 2 32.3775 33.0 33.0 34.0 31.0 34.0 3 32.4065 33.0 33.0 34.0 31.0 34.0 4 32.467 33.0 33.0 34.0 31.0 34.0 5 32.31875 33.0 33.0 34.0 31.0 34.0 6 36.126 38.0 38.0 38.0 33.0 38.0 7 36.389 38.0 38.0 38.0 34.0 38.0 8 36.3045 38.0 38.0 38.0 33.0 38.0 9 36.44375 38.0 38.0 38.0 34.0 38.0 10-14 36.40015000000001 38.0 38.0 38.0 34.0 38.0 15-19 36.56535 38.0 38.0 38.0 34.6 38.0 20-24 36.666000000000004 38.0 38.0 38.0 34.8 38.0 25-29 36.66445 38.0 38.0 38.0 35.0 38.0 30-34 36.51215 38.0 38.0 38.0 34.4 38.0 35-39 36.37925 38.0 38.0 38.0 34.0 38.0 40-44 36.39195 38.0 38.0 38.0 34.0 38.0 45-49 36.2601 38.0 38.0 38.0 33.4 38.0 50-54 36.358850000000004 38.0 38.0 38.0 34.0 38.0 55-59 36.314350000000005 38.0 38.0 38.0 33.6 38.0 60-64 36.12115 38.0 38.0 38.0 33.4 38.0 65-69 35.79405 38.0 37.2 38.0 31.6 38.0 70-74 35.7011 38.0 37.0 38.0 30.6 38.0 75-79 35.753 38.0 37.0 38.0 31.2 38.0 80-84 35.59475 38.0 37.0 38.0 30.8 38.0 85-89 35.51945 38.0 37.0 38.0 30.4 38.0 90-94 35.37435 38.0 36.6 38.0 29.6 38.0 95-99 35.135200000000005 38.0 36.0 38.0 28.8 38.0 100-104 34.791549999999994 38.0 35.4 38.0 27.0 38.0 105-109 34.5465 38.0 35.0 38.0 25.8 38.0 110-114 34.2858 38.0 34.8 38.0 24.0 38.0 115-119 34.148700000000005 38.0 34.8 38.0 22.2 38.0 120-124 33.55775 38.0 34.0 38.0 19.0 38.0 125-129 33.48085 38.0 33.8 38.0 21.4 38.0 130-134 32.82025 38.0 32.4 38.0 15.8 38.0 135-139 32.33095 38.0 31.0 38.0 13.4 38.0 140-144 31.762099999999997 37.0 31.0 38.0 13.0 38.0 145-149 29.52245 36.0 27.4 38.0 3.8 38.0 150-151 23.123375000000003 29.0 6.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 5.0 4 3.0 5 1.0 6 2.0 7 1.0 8 2.0 9 1.0 10 2.0 11 3.0 12 4.0 13 3.0 14 2.0 15 5.0 16 10.0 17 11.0 18 7.0 19 5.0 20 8.0 21 11.0 22 12.0 23 15.0 24 26.0 25 27.0 26 35.0 27 49.0 28 44.0 29 75.0 30 81.0 31 124.0 32 131.0 33 216.0 34 263.0 35 408.0 36 874.0 37 1518.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.1 20.0 8.924999999999999 31.974999999999998 2 28.075 25.25 26.125 20.549999999999997 3 22.5 26.6 26.1 24.8 4 26.674999999999997 30.95 19.875 22.5 5 28.775000000000002 31.775 18.5 20.95 6 24.474999999999998 35.525 19.175 20.825 7 23.025000000000002 20.375 31.2 25.4 8 24.575 24.025 22.6 28.799999999999997 9 24.275 23.549999999999997 26.6 25.575 10-14 26.645000000000003 25.745 21.94 25.669999999999998 15-19 26.69 25.605 23.200000000000003 24.505 20-24 26.8 25.419999999999998 22.814999999999998 24.965 25-29 26.195 24.85 23.71 25.245 30-34 26.275 24.595 24.085 25.045 35-39 25.779999999999998 25.335 23.355 25.53 40-44 26.31 25.0 23.39 25.3 45-49 26.55 24.625 23.415 25.41 50-54 26.68 24.87 23.525 24.925 55-59 27.155 24.474999999999998 22.82 25.55 60-64 26.185000000000002 25.165 23.525 25.124999999999996 65-69 26.255 24.675 23.625 25.445 70-74 27.11 24.23 23.69 24.97 75-79 26.405 24.685000000000002 23.369999999999997 25.540000000000003 80-84 26.700000000000003 25.224999999999998 23.44 24.635 85-89 26.889999999999997 24.75 23.26 25.1 90-94 26.450000000000003 25.025 23.61 24.915000000000003 95-99 26.790000000000003 24.445 23.665 25.1 100-104 27.195000000000004 24.75 23.16 24.895 105-109 26.185000000000002 25.485000000000003 23.705000000000002 24.625 110-114 26.590000000000003 25.515 23.315 24.58 115-119 26.979999999999997 24.79 23.56 24.67 120-124 27.005000000000003 25.324999999999996 23.085 24.585 125-129 27.189999999999998 25.525 23.25 24.035 130-134 27.365000000000002 25.135 23.16 24.34 135-139 26.810000000000002 25.365 23.7 24.125 140-144 27.325 25.5 23.255 23.919999999999998 145-149 27.26 25.014999999999997 23.155 24.57 150-151 27.825 25.2875 23.5875 23.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 1.0 28 2.0 29 3.0 30 3.0 31 4.0 32 5.5 33 6.5 34 12.0 35 18.5 36 23.0 37 37.5 38 51.5 39 62.5 40 81.0 41 114.5 42 150.5 43 164.0 44 160.5 45 174.0 46 182.0 47 177.0 48 177.0 49 172.0 50 179.0 51 181.0 52 157.5 53 129.0 54 121.0 55 109.5 56 90.5 57 91.5 58 98.5 59 97.0 60 95.5 61 89.0 62 89.5 63 100.5 64 89.5 65 74.0 66 69.5 67 54.5 68 46.0 69 54.5 70 52.5 71 39.0 72 32.5 73 23.0 74 13.5 75 11.0 76 6.5 77 7.5 78 7.0 79 3.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.6266531027467 96.95 2 1.1953204476093593 2.35 3 0.050864699898270596 0.15 4 0.0762970498474059 0.3 5 0.050864699898270596 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.225 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.7875 0.0 0.0 0.0 0.0 126-127 1.9625 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.5999999999999996 0.0 0.0 0.0 0.0 134-135 2.8875 0.0 0.0 0.0 0.0 136-137 3.25 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCACC 10 0.006830828 145.0 8 GGCCAAT 10 0.006830828 145.0 9 >>END_MODULE Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127744 spots for SRR6958398.sra Written 1127744 spots for SRR6958398.sra Read 1127751 spots for SRR6958398.sra Written 1127751 spots for SRR6958398.sra SRR ids: ['SRR6958398.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ayu7dk8e SRR6958398.sra spots: 22554887 blocks: [[1, 1127744], [1127745, 2255488], [2255489, 3383232], [3383233, 4510976], [4510977, 5638720], [5638721, 6766464], [6766465, 7894208], [7894209, 9021952], [9021953, 10149696], [10149697, 11277440], [11277441, 12405184], [12405185, 13532928], [13532929, 14660672], [14660673, 15788416], [15788417, 16916160], [16916161, 18043904], [18043905, 19171648], [19171649, 20299392], [20299393, 21427136], [21427137, 22554887]] SRR6958398 file size 7621410 SRR6958398 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958398 SRR6958398_1.fastq SRR6958398_2.fastq Input file: SRR6958398_1.fastq Paired file: SRR6958398_2.fastq trimmed: SRR6958398-trimmed-pair1.fastq, SRR6958398-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:06:31 2024 >> started Fri Dec 6 22:07:33 2024 >> done (62.647s) 22554887 read pairs processed; of these: 41027 ( 0.18%) short read pairs filtered out after trimming by size control 39720 ( 0.18%) empty read pairs filtered out after trimming by size control 22474140 (99.64%) read pairs available; of these: 10490654 (46.68%) trimmed read pairs available after processing 11983486 (53.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 4 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 7 0.00% 25 9 0.00% 26 6 0.00% 27 9 0.00% 28 11 0.00% 29 8 0.00% 30 8 0.00% 31 10 0.00% 32 13 0.00% 33 13 0.00% 34 15 0.00% 35 13 0.00% 36 13 0.00% 37 18 0.00% 38 24 0.00% 39 22 0.00% 40 24 0.00% 41 24 0.00% 42 27 0.00% 43 26 0.00% 44 31 0.00% 45 40 0.00% 46 32 0.00% 47 36 0.00% 48 53 0.00% 49 54 0.00% 50 62 0.00% 51 70 0.00% 52 80 0.00% 53 84 0.00% 54 91 0.00% 55 97 0.00% 56 99 0.00% 57 115 0.00% 58 149 0.00% 59 155 0.00% 60 189 0.00% 61 182 0.00% 62 225 0.00% 63 217 0.00% 64 266 0.00% 65 305 0.00% 66 298 0.00% 67 336 0.00% 68 371 0.00% 69 401 0.00% 70 442 0.00% 71 507 0.00% 72 569 0.00% 73 642 0.00% 74 744 0.00% 75 812 0.00% 76 933 0.00% 77 1005 0.00% 78 1085 0.00% 79 1254 0.01% 80 1449 0.01% 81 1656 0.01% 82 1909 0.01% 83 2292 0.01% 84 4018 0.02% 85 4936 0.02% 86 5095 0.02% 87 5019 0.02% 88 5016 0.02% 89 5234 0.02% 90 5519 0.02% 91 5960 0.03% 92 6145 0.03% 93 6441 0.03% 94 7112 0.03% 95 7606 0.03% 96 7820 0.03% 97 8457 0.04% 98 9085 0.04% 99 9634 0.04% 100 10162 0.05% 101 10719 0.05% 102 11434 0.05% 103 12330 0.05% 104 12980 0.06% 105 13804 0.06% 106 14751 0.07% 107 15704 0.07% 108 16388 0.07% 109 17344 0.08% 110 18258 0.08% 111 19639 0.09% 112 20739 0.09% 113 21839 0.10% 114 23229 0.10% 115 24398 0.11% 116 26485 0.12% 117 27334 0.12% 118 28878 0.13% 119 29960 0.13% 120 31290 0.14% 121 32351 0.14% 122 34866 0.16% 123 36596 0.16% 124 38933 0.17% 125 41512 0.18% 126 43310 0.19% 127 46371 0.21% 128 48017 0.21% 129 50849 0.23% 130 53633 0.24% 131 56328 0.25% 132 59832 0.27% 133 64121 0.29% 134 67520 0.30% 135 71914 0.32% 136 76329 0.34% 137 81535 0.36% 138 87456 0.39% 139 94579 0.42% 140 102395 0.46% 141 112944 0.50% 142 125589 0.56% 143 143714 0.64% 144 167300 0.74% 145 204828 0.91% 146 260777 1.16% 147 359174 1.60% 148 561320 2.50% 149 1135922 5.05% 150 5700222 25.36% 151 11983486 53.32% 22474140 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=16 prefix-density=0.95 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=26.52 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=16 prefix-density=0.65 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=48.38 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=7.0 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958398 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:09:33 Started mapping on | Dec 06 22:09:33 Finished on | Dec 06 22:11:15 Mapping speed, Million of reads per hour | 793.20 Number of input reads | 22474140 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21998945 Uniquely mapped reads % | 97.89% Average mapped length | 295.99 Number of splices: Total | 24835947 Number of splices: Annotated (sjdb) | 23393057 Number of splices: GT/AG | 24512058 Number of splices: GC/AG | 288514 Number of splices: AT/AC | 8588 Number of splices: Non-canonical | 26787 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.61 Insertion rate per base | 0.01% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 165305 % of reads mapped to multiple loci | 0.74% Number of reads mapped to too many loci | 11418 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.02% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 333651 333651 333651 N_multimapping 165305 165305 165305 N_noFeature 505728 21393974 658950 N_ambiguous 534347 2662 83775 UnstrandedReadsAssigned:20958870 PositiveStrandReadsAssigned:602309 NegativeStrandReadsAssigned:21256220 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958398 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958398-trimmed-pair1.fastq SRR6958398-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,474,140 reads, 21,236,364 reads pseudoaligned [quant] estimated average fragment length: 251.125 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR6958398.ke.tsv 35125 SRR6958398.se.tsv 88098 total ==> SRR6958398.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.177 17.6091 1.69997 PNS24247 1044 793.875 68.988 5.75656 PNS24249 1928 1677.88 63.7403 2.5165 PNS24246 1044 793.875 68.988 5.75656 PNS24248 1044 793.875 68.988 5.75656 PNS24244 1471 1220.88 25.6866 1.39372 PNS24243 293 84.8479 0 0 KQK14069 1603 1352.88 6079.76 297.694 KQK14071 474 233.49 115.588 32.7932 ==> SRR6958398.se.tsv <== BRADI_1g14170v3 6685 BRADI_1g53295v3 145 BRADI_1g59795v3 221 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 288 BRADI_1g74790v3 144 BRADI_1g09890v3 0 BRADI_1g77505v3 267 BRADI_1g48960v3 0 SRR6958398 completed mapping pipeline successfully