Starting /dee2/code/volunteer_pipeline.sh SRR6958399 current disk space = 1548860088320 free memory = 1601268700 SRR6958399 SRAfilesize 9ebd39109e9eb2febb94fd60b02aaacc SRR6958399.sra SRR6958399.sra file validated SRR6958399 is paired end SRR6958399 is conventional basespace SRR6958399 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958399_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.43725 33.0 33.0 33.0 32.0 34.0 2 31.01275 33.0 31.0 33.0 27.0 34.0 3 32.1865 33.0 31.0 33.0 31.0 34.0 4 30.848 31.0 31.0 33.0 28.0 33.0 5 31.4495 33.0 31.0 33.0 30.0 33.0 6 36.21325 37.0 36.0 38.0 33.0 38.0 7 36.88275 38.0 37.0 38.0 35.0 38.0 8 37.303 38.0 38.0 38.0 37.0 38.0 9 37.5275 38.0 38.0 38.0 37.0 38.0 10-14 37.54805 38.0 38.0 38.0 37.6 38.0 15-19 37.57165 38.0 38.0 38.0 37.8 38.0 20-24 37.558499999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.53065 38.0 38.0 38.0 37.8 38.0 30-34 37.508 38.0 38.0 38.0 37.4 38.0 35-39 37.446349999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.457300000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.43325 38.0 38.0 38.0 37.0 38.0 50-54 37.36665 38.0 38.0 38.0 37.0 38.0 55-59 37.193650000000005 38.0 38.0 38.0 37.0 38.0 60-64 36.91375 38.0 38.0 38.0 36.0 38.0 65-69 37.215700000000005 38.0 38.0 38.0 36.2 38.0 70-74 37.2027 38.0 38.0 38.0 36.2 38.0 75-79 37.1012 38.0 38.0 38.0 36.0 38.0 80-84 37.06335 38.0 38.0 38.0 36.0 38.0 85-89 36.99225 38.0 38.0 38.0 35.8 38.0 90-94 36.83105 38.0 38.0 38.0 35.2 38.0 95-99 36.74555 38.0 38.0 38.0 34.8 38.0 100-104 36.57375 38.0 38.0 38.0 34.2 38.0 105-109 36.555400000000006 38.0 38.0 38.0 33.8 38.0 110-114 36.3273 38.0 37.8 38.0 34.0 38.0 115-119 36.17185 38.0 37.4 38.0 33.2 38.0 120-124 35.9099 38.0 37.0 38.0 31.4 38.0 125-129 35.70195 38.0 36.4 38.0 31.0 38.0 130-134 35.34930000000001 38.0 36.0 38.0 29.2 38.0 135-139 34.8678 38.0 35.4 38.0 27.6 38.0 140-144 34.58585 38.0 35.4 38.0 27.6 38.0 145-149 33.585249999999995 38.0 33.4 38.0 22.4 38.0 150-151 28.152875 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 4.0 19 3.0 20 2.0 21 4.0 22 8.0 23 4.0 24 9.0 25 8.0 26 15.0 27 16.0 28 20.0 29 22.0 30 35.0 31 49.0 32 67.0 33 84.0 34 168.0 35 302.0 36 772.0 37 2404.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.8 9.825000000000001 9.6 36.775000000000006 2 25.174999999999997 11.475 33.300000000000004 30.049999999999997 3 22.125 15.85 26.325 35.699999999999996 4 25.8 22.15 23.95 28.1 5 26.775 27.750000000000004 24.25 21.224999999999998 6 24.325 30.925000000000004 24.099999999999998 20.65 7 18.075 23.325000000000003 39.625 18.975 8 22.075 23.275000000000002 29.125 25.525 9 21.5 19.5 33.975 25.025 10-14 23.645911477869465 25.78144536134033 25.481370342585645 25.09127281820455 15-19 23.62 25.424999999999997 25.72 25.235000000000003 20-24 23.315 25.330000000000002 26.185000000000002 25.169999999999998 25-29 23.25 25.195 25.96 25.595000000000002 30-34 23.075000000000003 25.31 26.19 25.424999999999997 35-39 23.325000000000003 25.275 25.590000000000003 25.81 40-44 23.095 25.525 25.405 25.974999999999998 45-49 23.095 24.654999999999998 26.340000000000003 25.91 50-54 23.345 25.44 25.635 25.580000000000002 55-59 23.56278556007431 24.92343224381182 25.822161972184567 25.691620223929306 60-64 23.178641460103574 24.762431494796118 26.351249434360703 25.707677610739605 65-69 23.69 24.845 25.805 25.66 70-74 23.674999999999997 24.455 25.580000000000002 26.290000000000003 75-79 23.615 24.9 25.740000000000002 25.745 80-84 23.46 24.845 25.490000000000002 26.205000000000002 85-89 23.799999999999997 24.765 25.255 26.179999999999996 90-94 23.9 24.565 25.755 25.779999999999998 95-99 24.12 25.095 25.685000000000002 25.1 100-104 24.18 25.44 24.995 25.385 105-109 23.655 24.45 25.905 25.990000000000002 110-114 24.02 24.44 25.94 25.6 115-119 24.02 24.975 25.82 25.185000000000002 120-124 24.404999999999998 24.815 25.46 25.319999999999997 125-129 23.905 24.68 25.53 25.885 130-134 24.044999999999998 24.84 25.330000000000002 25.785000000000004 135-139 23.79 24.815 25.395 26.0 140-144 23.84 24.785 25.64 25.735000000000003 145-149 23.515 25.205 25.674999999999997 25.605 150-151 25.174999999999997 24.05 25.3125 25.4625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 1.0 28 2.5 29 2.5 30 3.5 31 7.5 32 13.0 33 17.0 34 21.5 35 28.0 36 36.0 37 53.5 38 77.0 39 100.5 40 125.0 41 149.0 42 179.0 43 205.5 44 200.5 45 200.5 46 200.0 47 181.0 48 185.5 49 194.0 50 183.0 51 163.0 52 144.5 53 132.5 54 112.0 55 100.0 56 93.0 57 85.0 58 76.5 59 67.5 60 69.5 61 64.0 62 59.0 63 67.0 64 65.0 65 51.0 66 41.5 67 36.5 68 39.0 69 38.5 70 35.0 71 28.5 72 18.5 73 14.5 74 10.0 75 4.5 76 4.5 77 4.0 78 2.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.025 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.415 60-64 0.555 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.8999999999999999 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.45 0.0 0.0 0.0 0.0 126-127 1.5499999999999998 0.0 0.0 0.0 0.0 128-129 1.7 0.0 0.0 0.0 0.0 130-131 2.0 0.0 0.0 0.0 0.0 132-133 2.1875 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.5125 0.0 0.0 0.0 0.0 138-139 2.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958399 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958399_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86525 33.0 33.0 34.0 32.0 34.0 2 32.9615 33.0 33.0 34.0 32.0 34.0 3 33.014 34.0 33.0 34.0 32.0 34.0 4 32.99 34.0 33.0 34.0 32.0 34.0 5 33.024 34.0 33.0 34.0 33.0 34.0 6 37.16825 38.0 38.0 38.0 37.0 38.0 7 37.1975 38.0 38.0 38.0 37.0 38.0 8 37.134 38.0 38.0 38.0 37.0 38.0 9 37.13375 38.0 38.0 38.0 37.0 38.0 10-14 37.0974 38.0 38.0 38.0 37.0 38.0 15-19 37.0846 38.0 38.0 38.0 37.0 38.0 20-24 37.0418 38.0 38.0 38.0 36.8 38.0 25-29 37.006449999999994 38.0 38.0 38.0 36.8 38.0 30-34 36.984500000000004 38.0 38.0 38.0 36.2 38.0 35-39 37.023250000000004 38.0 38.0 38.0 36.8 38.0 40-44 36.976350000000004 38.0 38.0 38.0 36.4 38.0 45-49 36.9226 38.0 38.0 38.0 36.0 38.0 50-54 36.83454999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.84055 38.0 38.0 38.0 35.8 38.0 60-64 36.77395 38.0 38.0 38.0 36.0 38.0 65-69 36.7156 38.0 38.0 38.0 35.8 38.0 70-74 36.7639 38.0 38.0 38.0 35.6 38.0 75-79 36.6806 38.0 38.0 38.0 35.0 38.0 80-84 36.61749999999999 38.0 38.0 38.0 35.0 38.0 85-89 36.515699999999995 38.0 38.0 38.0 34.6 38.0 90-94 36.44815 38.0 38.0 38.0 34.4 38.0 95-99 36.3333 38.0 38.0 38.0 34.2 38.0 100-104 36.19709999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.1282 38.0 38.0 38.0 33.8 38.0 110-114 35.7881 38.0 37.6 38.0 32.2 38.0 115-119 35.67309999999999 38.0 37.2 38.0 32.0 38.0 120-124 35.659749999999995 38.0 37.2 38.0 32.2 38.0 125-129 35.5758 38.0 37.0 38.0 31.6 38.0 130-134 35.35275 38.0 36.0 38.0 31.0 38.0 135-139 35.1823 38.0 36.0 38.0 30.2 38.0 140-144 34.67075 38.0 35.6 38.0 27.8 38.0 145-149 34.005 38.0 34.2 38.0 25.0 38.0 150-151 29.80975 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 3.0 4 0.0 5 1.0 6 2.0 7 0.0 8 2.0 9 0.0 10 1.0 11 3.0 12 2.0 13 3.0 14 0.0 15 5.0 16 2.0 17 4.0 18 5.0 19 4.0 20 8.0 21 8.0 22 4.0 23 9.0 24 5.0 25 17.0 26 21.0 27 22.0 28 28.0 29 32.0 30 35.0 31 45.0 32 46.0 33 86.0 34 145.0 35 218.0 36 551.0 37 2665.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.05 18.475 12.55 30.925000000000004 2 29.694541812719077 22.083124687030544 26.664997496244368 21.557336004006007 3 22.533800701051575 25.237856785177765 27.616424636955433 24.611917876815223 4 25.63845768652979 31.97295943915874 20.45568352528793 21.932899349023536 5 26.307884856070086 32.81602002503129 19.67459324155194 21.201501877346686 6 22.84784784784785 33.95895895895896 21.096096096096094 22.097097097097095 7 21.60200250312891 20.05006257822278 35.66958698372966 22.678347934918648 8 25.056320400500624 23.053817271589487 23.979974968710888 27.909887359198997 9 23.52941176470588 23.078848560700877 26.65832290362954 26.733416770963704 10-14 24.986235547324693 26.19750738275189 23.429601081135193 25.386655988788227 15-19 25.648342845699407 25.47311504956443 24.42174827275458 24.456793831981578 20-24 25.672224725852487 25.862500625907565 23.804516548996045 24.660758099243903 25-29 25.662210204796953 25.807420760102147 23.759451204246158 24.77091783085474 30-34 25.698547821732596 25.31296945418127 24.907361041562343 24.081121682523783 35-39 25.65193453125782 25.64192402022123 24.030231743330496 24.67590970519045 40-44 25.798538099529388 25.833583658756382 23.615700410533695 24.752177831180536 45-49 25.517862503752625 25.427799459621735 24.712298609026316 24.342039427599317 50-54 25.729151033068188 25.003752063634998 24.658562209215066 24.608534694081747 55-59 26.008407566810128 25.377840056050445 23.886497848063257 24.727254529076166 60-64 25.693123811430286 25.818236412771494 24.191772595335802 24.296867180462417 65-69 26.073466119507554 25.713141827644883 23.64628165348814 24.567110399359425 70-74 26.012110293749686 25.431616874343195 24.44077465845969 24.11549817344743 75-79 26.164013217182337 25.022529288074498 24.476819865825572 24.336637628917593 80-84 26.411885348406784 25.44144865189335 24.140863388524835 24.005802611175028 85-89 26.117835350605183 25.232569770931278 24.58737621286386 24.06221866559968 90-94 25.454090567925945 25.43907930948211 24.413309982486865 24.69352014010508 95-99 25.870696557245797 25.360288230584466 24.494595676541234 24.274419535628503 100-104 26.031920748486513 25.226397158152796 24.045629659278532 24.69605243408215 105-109 26.33711912743283 25.236403662380546 24.23074998749187 24.195727222694753 110-114 25.504128096072055 26.419814861145856 24.378283712784587 23.6977733299975 115-119 25.893482831114223 25.633196516167782 24.191610771849035 24.281709880868956 120-124 25.70914002701486 24.968732803041675 24.923708039421683 24.398419130521788 125-129 26.601281024819855 25.325260208166533 24.03923138510809 24.034227381905524 130-134 26.55327663831916 25.757878939469737 24.06703351675838 23.621810905452726 135-139 26.195956765412333 25.235188150520415 24.419535628502803 24.149319455564452 140-144 25.766748386451194 25.406514234252263 24.946215039775854 23.880522339520688 145-149 26.352128883774455 25.891829689298046 24.160704457897634 23.59533696902987 150-151 26.08532465907669 26.86100337795571 24.071062179406983 22.982609783560616 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 1.5 25 1.0 26 1.5 27 1.5 28 2.0 29 4.0 30 7.0 31 8.5 32 12.0 33 16.0 34 19.5 35 30.5 36 42.5 37 51.0 38 66.5 39 99.5 40 127.0 41 133.0 42 141.0 43 165.5 44 184.5 45 183.5 46 190.0 47 188.0 48 176.5 49 178.5 50 171.5 51 156.0 52 133.0 53 126.0 54 117.5 55 94.5 56 96.0 57 96.0 58 92.0 59 92.5 60 76.5 61 70.0 62 77.0 63 76.5 64 67.5 65 56.0 66 58.5 67 61.0 68 50.0 69 41.5 70 35.5 71 33.0 72 28.5 73 20.5 74 16.0 75 8.0 76 3.0 77 2.0 78 1.5 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.15 4 0.15 5 0.125 6 0.1 7 0.125 8 0.125 9 0.125 10-14 0.105 15-19 0.13 20-24 0.145 25-29 0.145 30-34 0.15 35-39 0.105 40-44 0.13 45-49 0.06999999999999999 50-54 0.055 55-59 0.09 60-64 0.09 65-69 0.09 70-74 0.08499999999999999 75-79 0.13 80-84 0.045 85-89 0.03 90-94 0.075 95-99 0.08 100-104 0.065 105-109 0.065 110-114 0.075 115-119 0.11 120-124 0.055 125-129 0.08 130-134 0.05 135-139 0.08 140-144 0.065 145-149 0.065 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96255060728745 97.775 2 0.9109311740890688 1.7999999999999998 3 0.07591093117408906 0.22499999999999998 4 0.05060728744939271 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.8999999999999999 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.425 0.0 0.0 0.0 0.0 126-127 1.525 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.975 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.5125 0.0 0.0 0.0 0.0 138-139 2.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAATCC 10 0.006830828 145.0 1 >>END_MODULE Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Read 1190977 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra Written 1190977 spots for SRR6958399.sra Read 1190965 spots for SRR6958399.sra Written 1190965 spots for SRR6958399.sra SRR ids: ['SRR6958399.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_86d8134i SRR6958399.sra spots: 23819312 blocks: [[1, 1190965], [1190966, 2381930], [2381931, 3572895], [3572896, 4763860], [4763861, 5954825], [5954826, 7145790], [7145791, 8336755], [8336756, 9527720], [9527721, 10718685], [10718686, 11909650], [11909651, 13100615], [13100616, 14291580], [14291581, 15482545], [15482546, 16673510], [16673511, 17864475], [17864476, 19055440], [19055441, 20246405], [20246406, 21437370], [21437371, 22628335], [22628336, 23819312]] SRR6958399 file size 8049882 SRR6958399 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958399 SRR6958399_1.fastq SRR6958399_2.fastq Input file: SRR6958399_1.fastq Paired file: SRR6958399_2.fastq trimmed: SRR6958399-trimmed-pair1.fastq, SRR6958399-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:07:50 2024 >> started Fri Dec 6 22:08:33 2024 >> done (43.176s) 23819312 read pairs processed; of these: 31046 ( 0.13%) short read pairs filtered out after trimming by size control 54969 ( 0.23%) empty read pairs filtered out after trimming by size control 23733297 (99.64%) read pairs available; of these: 9727690 (40.99%) trimmed read pairs available after processing 14005607 (59.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 4 0.00% 21 3 0.00% 22 3 0.00% 23 8 0.00% 24 5 0.00% 25 3 0.00% 26 3 0.00% 27 6 0.00% 28 5 0.00% 29 6 0.00% 30 3 0.00% 31 8 0.00% 32 8 0.00% 33 3 0.00% 34 9 0.00% 35 6 0.00% 36 13 0.00% 37 11 0.00% 38 8 0.00% 39 10 0.00% 40 6 0.00% 41 12 0.00% 42 18 0.00% 43 13 0.00% 44 15 0.00% 45 24 0.00% 46 17 0.00% 47 24 0.00% 48 34 0.00% 49 28 0.00% 50 48 0.00% 51 32 0.00% 52 50 0.00% 53 51 0.00% 54 61 0.00% 55 61 0.00% 56 73 0.00% 57 69 0.00% 58 100 0.00% 59 95 0.00% 60 104 0.00% 61 133 0.00% 62 130 0.00% 63 174 0.00% 64 176 0.00% 65 213 0.00% 66 227 0.00% 67 258 0.00% 68 265 0.00% 69 302 0.00% 70 347 0.00% 71 427 0.00% 72 497 0.00% 73 542 0.00% 74 594 0.00% 75 643 0.00% 76 724 0.00% 77 742 0.00% 78 918 0.00% 79 1017 0.00% 80 1133 0.00% 81 1308 0.01% 82 1541 0.01% 83 1698 0.01% 84 2814 0.01% 85 3470 0.01% 86 3549 0.01% 87 3756 0.02% 88 3989 0.02% 89 4249 0.02% 90 4589 0.02% 91 4527 0.02% 92 4839 0.02% 93 5221 0.02% 94 5456 0.02% 95 5793 0.02% 96 6099 0.03% 97 6377 0.03% 98 6675 0.03% 99 7114 0.03% 100 7567 0.03% 101 8046 0.03% 102 8628 0.04% 103 9191 0.04% 104 9624 0.04% 105 10317 0.04% 106 10804 0.05% 107 11469 0.05% 108 12241 0.05% 109 12397 0.05% 110 13347 0.06% 111 13837 0.06% 112 15212 0.06% 113 15641 0.07% 114 16534 0.07% 115 17791 0.07% 116 18602 0.08% 117 19294 0.08% 118 20359 0.09% 119 21209 0.09% 120 22451 0.09% 121 23113 0.10% 122 24413 0.10% 123 25832 0.11% 124 27394 0.12% 125 28899 0.12% 126 30200 0.13% 127 31756 0.13% 128 33492 0.14% 129 35175 0.15% 130 36344 0.15% 131 38162 0.16% 132 40735 0.17% 133 42820 0.18% 134 45922 0.19% 135 49411 0.21% 136 52376 0.22% 137 55566 0.23% 138 59391 0.25% 139 64438 0.27% 140 69303 0.29% 141 75677 0.32% 142 85310 0.36% 143 96734 0.41% 144 113006 0.48% 145 136966 0.58% 146 174179 0.73% 147 243702 1.03% 148 396334 1.67% 149 881074 3.71% 150 6321812 26.64% 151 14005607 59.01% 23733297 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=22 prefix-density=0.69 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=155.98 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.4 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=22 prefix-density=0.53 prefix-fanout=2.9 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=99.95 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.1 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958399 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:10:08 Started mapping on | Dec 06 22:10:09 Finished on | Dec 06 22:11:49 Mapping speed, Million of reads per hour | 854.40 Number of input reads | 23733297 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 22985491 Uniquely mapped reads % | 96.85% Average mapped length | 297.81 Number of splices: Total | 26415473 Number of splices: Annotated (sjdb) | 24852848 Number of splices: GT/AG | 26071459 Number of splices: GC/AG | 310773 Number of splices: AT/AC | 10699 Number of splices: Non-canonical | 22542 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 152849 % of reads mapped to multiple loci | 0.64% Number of reads mapped to too many loci | 25274 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.71% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 611272 611272 611272 N_multimapping 152849 152849 152849 N_noFeature 762712 22375297 923194 N_ambiguous 538070 3233 89228 UnstrandedReadsAssigned:21684709 PositiveStrandReadsAssigned:606961 NegativeStrandReadsAssigned:21973069 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958399 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958399-trimmed-pair1.fastq SRR6958399-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,733,297 reads, 21,986,085 reads pseudoaligned [quant] estimated average fragment length: 277.663 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR6958399.ke.tsv 35125 SRR6958399.se.tsv 88098 total ==> SRR6958399.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 659.869 0 0 PNS24247 1044 767.337 85.7431 7.61528 PNS24249 1928 1651.34 43.2271 1.78399 PNS24246 1044 767.337 85.7431 7.61528 PNS24248 1044 767.337 85.7431 7.61528 PNS24244 1471 1194.34 54.5437 3.11236 PNS24243 293 77.1295 0 0 KQK14069 1603 1326.34 3213.63 165.126 KQK14071 474 214.207 86.9466 27.6626 ==> SRR6958399.se.tsv <== BRADI_1g14170v3 3797 BRADI_1g53295v3 367 BRADI_1g59795v3 315 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 421 BRADI_1g74790v3 105 BRADI_1g09890v3 0 BRADI_1g77505v3 292 BRADI_1g48960v3 0 SRR6958399 completed mapping pipeline successfully