Starting /dee2/code/volunteer_pipeline.sh SRR6958400 current disk space = 1548857163776 free memory = 1602850588 SRR6958400 SRAfilesize 81ef46fbf3561e7ac2afb83890799f72 SRR6958400.sra SRR6958400.sra file validated SRR6958400 is paired end SRR6958400 is conventional basespace SRR6958400 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958400_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.2345 18.0 18.0 25.0 18.0 32.0 2 25.88925 27.0 18.0 30.0 18.0 31.0 3 26.1075 27.0 18.0 30.0 18.0 33.0 4 29.75925 32.0 27.0 33.0 25.0 33.0 5 31.3225 33.0 32.0 33.0 27.0 33.0 6 35.54825 37.0 35.0 38.0 31.0 38.0 7 36.39525 38.0 37.0 38.0 34.0 38.0 8 36.7785 38.0 38.0 38.0 35.0 38.0 9 37.06575 38.0 38.0 38.0 35.0 38.0 10-14 37.169349999999994 38.0 38.0 38.0 36.0 38.0 15-19 37.21545 38.0 38.0 38.0 36.2 38.0 20-24 37.18085000000001 38.0 38.0 38.0 36.4 38.0 25-29 37.025600000000004 38.0 38.0 38.0 35.8 38.0 30-34 36.9062 38.0 38.0 38.0 35.2 38.0 35-39 36.6952 38.0 38.0 38.0 34.4 38.0 40-44 36.674350000000004 38.0 38.0 38.0 34.4 38.0 45-49 36.66925 38.0 38.0 38.0 34.6 38.0 50-54 36.1754 38.0 37.4 38.0 32.6 38.0 55-59 36.15585 38.0 37.0 38.0 33.0 38.0 60-64 36.620850000000004 38.0 37.8 38.0 34.0 38.0 65-69 36.59994999999999 38.0 38.0 38.0 34.2 38.0 70-74 36.37185 38.0 37.4 38.0 33.6 38.0 75-79 35.786 38.0 36.8 38.0 31.4 38.0 80-84 35.602900000000005 38.0 36.4 38.0 30.4 38.0 85-89 35.96255 38.0 37.0 38.0 32.2 38.0 90-94 35.94425 38.0 36.8 38.0 32.0 38.0 95-99 35.247749999999996 38.0 35.6 38.0 28.6 38.0 100-104 34.50685 38.0 34.4 38.0 25.0 38.0 105-109 34.213350000000005 38.0 34.0 38.0 23.4 38.0 110-114 34.1586 38.0 34.0 38.0 23.4 38.0 115-119 34.0526 38.0 34.2 38.0 23.4 38.0 120-124 33.374 37.6 32.6 38.0 20.6 38.0 125-129 32.68085 37.4 31.2 38.0 16.2 38.0 130-134 31.840349999999994 36.2 30.6 38.0 14.2 38.0 135-139 30.69905 35.6 27.6 38.0 13.0 38.0 140-144 29.354899999999997 34.0 25.2 38.0 9.6 38.0 145-149 27.1895 33.4 17.2 38.0 2.0 38.0 150-151 20.186124999999997 17.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 3.0 17 3.0 18 5.0 19 5.0 20 6.0 21 8.0 22 14.0 23 16.0 24 22.0 25 30.0 26 47.0 27 65.0 28 87.0 29 78.0 30 134.0 31 135.0 32 203.0 33 270.0 34 436.0 35 703.0 36 1070.0 37 657.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.277628032345014 17.547169811320753 5.040431266846361 40.13477088948787 2 19.900000000000002 11.55 29.049999999999997 39.5 3 18.425 16.950000000000003 26.6 38.025 4 23.425 22.125 21.325 33.125 5 26.5 25.5 24.55 23.45 6 23.925 31.05 22.975 22.05 7 16.85 24.224999999999998 38.75 20.175 8 21.525 23.625 29.4 25.45 9 19.900000000000002 22.075 33.425 24.6 10-14 22.39 25.995 26.165 25.45 15-19 23.115 24.62 26.290000000000003 25.974999999999998 20-24 23.005 24.995 25.740000000000002 26.26 25-29 23.3 24.52 26.119999999999997 26.06 30-34 22.945 24.765 26.345000000000002 25.945 35-39 23.044999999999998 25.195 25.715 26.045 40-44 22.900000000000002 24.8 26.384999999999998 25.915 45-49 22.695 25.180000000000003 26.6 25.525 50-54 23.28 24.75 26.245 25.724999999999998 55-59 23.765 24.505 25.94 25.790000000000003 60-64 22.865 24.42 26.435 26.279999999999998 65-69 23.21 24.69 25.965 26.135 70-74 22.95 24.86 25.85 26.340000000000003 75-79 23.26 25.1 26.27 25.369999999999997 80-84 23.28 24.925 26.174999999999997 25.619999999999997 85-89 23.935000000000002 24.58 25.765 25.72 90-94 23.7 24.365000000000002 26.005 25.929999999999996 95-99 23.535 24.04 26.055 26.369999999999997 100-104 23.655 24.72 26.040000000000003 25.585 105-109 23.72 24.695 25.335 26.25 110-114 23.375 25.055 25.85 25.72 115-119 23.395 23.794999999999998 25.985000000000003 26.825 120-124 23.905 23.74 26.11 26.245 125-129 23.7 24.154999999999998 25.885 26.26 130-134 23.525 24.635 25.695 26.145000000000003 135-139 23.535 24.755 25.335 26.375 140-144 23.56 23.965 25.985000000000003 26.490000000000002 145-149 24.125 24.82 25.41 25.645 150-151 24.4125 24.025 26.1125 25.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 1.5 28 3.5 29 4.5 30 6.0 31 7.5 32 10.5 33 16.5 34 22.0 35 29.5 36 38.0 37 49.0 38 72.0 39 90.0 40 107.0 41 146.0 42 177.0 43 187.5 44 210.0 45 218.0 46 214.5 47 211.5 48 198.0 49 176.5 50 165.5 51 168.5 52 154.5 53 134.0 54 114.0 55 103.0 56 89.5 57 84.5 58 88.5 59 86.5 60 74.5 61 69.5 62 63.0 63 53.0 64 55.5 65 53.0 66 45.0 67 42.5 68 34.5 69 23.0 70 21.0 71 19.5 72 17.0 73 12.5 74 12.0 75 8.0 76 3.5 77 1.5 78 1.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.249999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24414210128496 98.475 2 0.7306626354245402 1.4500000000000002 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.9 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.125 0.0 0.0 0.0 0.0 130-131 1.3 0.0 0.0 0.0 0.0 132-133 1.5375 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 2.0125 0.0 0.0 0.0 0.0 138-139 2.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGATGT 10 0.006841402 144.925 8 TTTTTTT 35 0.0035472352 20.703571 50-54 >>END_MODULE SRR6958400 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958400_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.31625 33.0 33.0 34.0 31.0 34.0 2 32.0805 33.0 33.0 34.0 30.0 34.0 3 32.19575 33.0 33.0 34.0 30.0 34.0 4 32.14175 33.0 33.0 34.0 31.0 34.0 5 32.1055 33.0 33.0 34.0 31.0 34.0 6 35.943 38.0 38.0 38.0 31.0 38.0 7 35.91475 38.0 38.0 38.0 31.0 38.0 8 35.78475 38.0 38.0 38.0 29.0 38.0 9 35.9755 38.0 38.0 38.0 31.0 38.0 10-14 35.87975 38.0 37.4 38.0 31.4 38.0 15-19 36.1218 38.0 37.6 38.0 32.6 38.0 20-24 36.35035 38.0 38.0 38.0 33.8 38.0 25-29 36.39815 38.0 38.0 38.0 34.0 38.0 30-34 36.393150000000006 38.0 38.0 38.0 34.0 38.0 35-39 36.18435 38.0 38.0 38.0 33.4 38.0 40-44 35.947199999999995 38.0 38.0 38.0 32.2 38.0 45-49 35.9969 38.0 37.8 38.0 32.6 38.0 50-54 36.0569 38.0 38.0 38.0 33.0 38.0 55-59 35.979200000000006 38.0 37.2 38.0 32.6 38.0 60-64 35.75595 38.0 37.2 38.0 31.2 38.0 65-69 35.396699999999996 38.0 36.8 38.0 29.2 38.0 70-74 35.200649999999996 38.0 36.2 38.0 28.6 38.0 75-79 35.3359 38.0 36.4 38.0 29.4 38.0 80-84 35.19265 38.0 36.0 38.0 29.0 38.0 85-89 35.0674 38.0 36.0 38.0 28.4 38.0 90-94 34.5721 38.0 35.2 38.0 25.8 38.0 95-99 34.01595 38.0 34.4 38.0 21.8 38.0 100-104 33.269549999999995 38.0 33.6 38.0 16.2 38.0 105-109 33.1125 38.0 32.6 38.0 16.2 38.0 110-114 32.6447 38.0 31.2 38.0 15.0 38.0 115-119 32.3267 37.8 31.4 38.0 14.6 38.0 120-124 31.373749999999994 36.8 28.8 38.0 13.0 38.0 125-129 30.5298 36.0 27.6 38.0 12.2 38.0 130-134 29.344450000000002 34.8 24.4 38.0 11.0 38.0 135-139 28.666449999999998 33.8 22.2 38.0 5.6 38.0 140-144 28.068649999999998 33.6 21.2 38.0 2.0 38.0 145-149 25.58205 33.0 10.2 38.0 2.0 38.0 150-151 19.03 17.5 2.0 34.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 7.0 4 4.0 5 1.0 6 3.0 7 2.0 8 2.0 9 3.0 10 1.0 11 5.0 12 4.0 13 5.0 14 6.0 15 5.0 16 11.0 17 6.0 18 18.0 19 19.0 20 20.0 21 25.0 22 28.0 23 34.0 24 55.0 25 48.0 26 53.0 27 66.0 28 70.0 29 93.0 30 115.0 31 154.0 32 200.0 33 266.0 34 368.0 35 550.0 36 943.0 37 792.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.425 18.25 11.525 29.799999999999997 2 28.325 24.3 25.874999999999996 21.5 3 23.3 26.474999999999998 28.499999999999996 21.725 4 27.250000000000004 30.775000000000002 19.325 22.650000000000002 5 26.674999999999997 32.275 20.200000000000003 20.849999999999998 6 21.7 36.95 20.349999999999998 21.0 7 22.575 18.975 34.9 23.549999999999997 8 23.95 23.05 23.125 29.875 9 23.325000000000003 23.925 25.474999999999998 27.275 10-14 25.865 25.81 23.65 24.675 15-19 25.655 25.61 23.75 24.985 20-24 25.674999999999997 26.055 23.91 24.36 25-29 25.595000000000002 25.895000000000003 24.305 24.205 30-34 25.729999999999997 25.385 23.845 25.040000000000003 35-39 25.695 25.95 23.62 24.735 40-44 25.369999999999997 25.264999999999997 23.96 25.405 45-49 25.905 25.825 23.87 24.4 50-54 26.095000000000002 25.705 24.465 23.735 55-59 25.81 25.41 23.985 24.795 60-64 26.21 25.490000000000002 24.05 24.25 65-69 26.595000000000002 25.230000000000004 24.0 24.175 70-74 26.41 24.64 24.435000000000002 24.515 75-79 26.105 24.9 24.525 24.47 80-84 26.205000000000002 25.650000000000002 23.585 24.560000000000002 85-89 25.564999999999998 25.495 24.5 24.44 90-94 25.955000000000002 25.36 24.505 24.18 95-99 26.135 25.669999999999998 23.95 24.245 100-104 25.790000000000003 25.28 24.990000000000002 23.94 105-109 26.345000000000002 25.395 24.325 23.935000000000002 110-114 26.0 26.085 23.919999999999998 23.995 115-119 26.56 25.324999999999996 24.29 23.825 120-124 26.314999999999998 26.029999999999998 24.39 23.265 125-129 26.834999999999997 25.755 23.805 23.605 130-134 26.575 25.564999999999998 24.404999999999998 23.455000000000002 135-139 26.93 25.845000000000002 23.745 23.48 140-144 26.705000000000002 26.25 24.36 22.685 145-149 26.384999999999998 25.71 24.2 23.705000000000002 150-151 26.825 25.525 24.099999999999998 23.549999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 0.5 26 0.5 27 1.5 28 2.0 29 3.0 30 3.5 31 4.5 32 8.0 33 7.0 34 9.5 35 22.0 36 38.0 37 51.0 38 70.5 39 91.0 40 114.0 41 130.0 42 159.0 43 173.5 44 184.5 45 205.5 46 205.5 47 193.5 48 169.5 49 173.5 50 169.5 51 149.0 52 140.5 53 128.5 54 108.0 55 99.0 56 102.5 57 104.0 58 101.5 59 86.0 60 80.5 61 80.0 62 69.5 63 74.5 64 75.0 65 62.5 66 53.0 67 54.0 68 49.0 69 42.5 70 37.5 71 32.0 72 27.5 73 18.0 74 13.0 75 7.0 76 3.0 77 2.0 78 1.5 79 1.5 80 1.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1411972720384 98.125 2 0.6819904016165698 1.35 3 0.17681232634503663 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.9 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.125 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.625 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138-139 2.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011323 spots for SRR6958400.sra Written 1011323 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra Read 1011315 spots for SRR6958400.sra Written 1011315 spots for SRR6958400.sra SRR ids: ['SRR6958400.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f9cu2y2_ SRR6958400.sra spots: 20226308 blocks: [[1, 1011315], [1011316, 2022630], [2022631, 3033945], [3033946, 4045260], [4045261, 5056575], [5056576, 6067890], [6067891, 7079205], [7079206, 8090520], [8090521, 9101835], [9101836, 10113150], [10113151, 11124465], [11124466, 12135780], [12135781, 13147095], [13147096, 14158410], [14158411, 15169725], [15169726, 16181040], [16181041, 17192355], [17192356, 18203670], [18203671, 19214985], [19214986, 20226308]] SRR6958400 file size 6832331 SRR6958400 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958400 SRR6958400_1.fastq SRR6958400_2.fastq Input file: SRR6958400_1.fastq Paired file: SRR6958400_2.fastq trimmed: SRR6958400-trimmed-pair1.fastq, SRR6958400-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:09:13 2024 >> started Fri Dec 6 22:09:33 2024 >> done (20.200s) 20226308 read pairs processed; of these: 41910 ( 0.21%) short read pairs filtered out after trimming by size control 37553 ( 0.19%) empty read pairs filtered out after trimming by size control 20146845 (99.61%) read pairs available; of these: 10643401 (52.83%) trimmed read pairs available after processing 9503444 (47.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 5 0.00% 21 1 0.00% 22 1 0.00% 23 5 0.00% 24 3 0.00% 25 9 0.00% 26 1 0.00% 27 9 0.00% 28 5 0.00% 29 5 0.00% 30 8 0.00% 31 4 0.00% 32 10 0.00% 33 16 0.00% 34 12 0.00% 35 13 0.00% 36 19 0.00% 37 11 0.00% 38 11 0.00% 39 15 0.00% 40 18 0.00% 41 16 0.00% 42 20 0.00% 43 23 0.00% 44 21 0.00% 45 18 0.00% 46 28 0.00% 47 31 0.00% 48 37 0.00% 49 35 0.00% 50 47 0.00% 51 52 0.00% 52 57 0.00% 53 54 0.00% 54 76 0.00% 55 77 0.00% 56 65 0.00% 57 96 0.00% 58 117 0.00% 59 152 0.00% 60 162 0.00% 61 147 0.00% 62 178 0.00% 63 175 0.00% 64 184 0.00% 65 221 0.00% 66 261 0.00% 67 272 0.00% 68 309 0.00% 69 319 0.00% 70 374 0.00% 71 439 0.00% 72 466 0.00% 73 474 0.00% 74 564 0.00% 75 630 0.00% 76 697 0.00% 77 762 0.00% 78 927 0.00% 79 992 0.00% 80 1185 0.01% 81 1261 0.01% 82 1509 0.01% 83 1834 0.01% 84 3369 0.02% 85 4160 0.02% 86 4121 0.02% 87 4106 0.02% 88 4211 0.02% 89 4317 0.02% 90 4428 0.02% 91 4669 0.02% 92 4980 0.02% 93 5088 0.03% 94 5407 0.03% 95 5684 0.03% 96 6069 0.03% 97 6378 0.03% 98 6709 0.03% 99 7057 0.04% 100 7643 0.04% 101 8084 0.04% 102 8341 0.04% 103 9297 0.05% 104 9703 0.05% 105 10449 0.05% 106 11090 0.06% 107 11538 0.06% 108 12364 0.06% 109 12994 0.06% 110 13928 0.07% 111 14643 0.07% 112 15699 0.08% 113 16260 0.08% 114 17675 0.09% 115 19013 0.09% 116 20075 0.10% 117 21320 0.11% 118 22336 0.11% 119 23687 0.12% 120 25198 0.13% 121 26527 0.13% 122 27974 0.14% 123 29923 0.15% 124 32175 0.16% 125 35048 0.17% 126 36966 0.18% 127 39091 0.19% 128 41597 0.21% 129 44913 0.22% 130 48014 0.24% 131 51374 0.25% 132 56166 0.28% 133 60446 0.30% 134 64968 0.32% 135 70559 0.35% 136 76430 0.38% 137 83931 0.42% 138 90765 0.45% 139 100618 0.50% 140 111105 0.55% 141 125167 0.62% 142 142373 0.71% 143 165000 0.82% 144 195054 0.97% 145 239803 1.19% 146 308077 1.53% 147 427163 2.12% 148 672616 3.34% 149 1370028 6.80% 150 5461893 27.11% 151 9503444 47.17% 20146845 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.24 fanout-score-rank=24 prefix-density=0.65 prefix-fanout=3.0 sequence=GGTGTTGTCGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=212.80 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=10.8 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=21 prefix-density=0.49 prefix-fanout=2.8 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.13 sequence-density-rank=17 fanout-score=50.46 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=10.4 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR6958400 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:10:19 Started mapping on | Dec 06 22:10:19 Finished on | Dec 06 22:11:59 Mapping speed, Million of reads per hour | 725.29 Number of input reads | 20146845 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19570558 Uniquely mapped reads % | 97.14% Average mapped length | 295.99 Number of splices: Total | 23235379 Number of splices: Annotated (sjdb) | 21879340 Number of splices: GT/AG | 22936533 Number of splices: GC/AG | 274340 Number of splices: AT/AC | 9057 Number of splices: Non-canonical | 15449 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 130935 % of reads mapped to multiple loci | 0.65% Number of reads mapped to too many loci | 7050 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.93% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 469989 469989 469989 N_multimapping 130935 130935 130935 N_noFeature 538858 19070632 666422 N_ambiguous 444700 2693 73113 UnstrandedReadsAssigned:18587000 PositiveStrandReadsAssigned:497233 NegativeStrandReadsAssigned:18831023 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6958400 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958400-trimmed-pair1.fastq SRR6958400-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,146,845 reads, 18,866,247 reads pseudoaligned [quant] estimated average fragment length: 269.201 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 SRR6958400.ke.tsv 35125 SRR6958400.se.tsv 88098 total ==> SRR6958400.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.26 0 0 PNS24247 1044 775.799 65.329 6.69027 PNS24249 1928 1659.8 66.1621 3.16694 PNS24246 1044 775.799 65.329 6.69027 PNS24248 1044 775.799 65.329 6.69027 PNS24244 1471 1202.8 42.851 2.83044 PNS24243 293 76.4983 0 0 KQK14069 1603 1334.8 3109.92 185.106 KQK14071 474 218.008 48.793 17.7817 ==> SRR6958400.se.tsv <== BRADI_1g14170v3 3514 BRADI_1g53295v3 242 BRADI_1g59795v3 265 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 287 BRADI_1g74790v3 122 BRADI_1g09890v3 0 BRADI_1g77505v3 239 BRADI_1g48960v3 0 SRR6958400 completed mapping pipeline successfully