Starting /dee2/code/volunteer_pipeline.sh SRR6958401 current disk space = 1548283293696 free memory = 1598606972 SRR6958401 SRAfilesize 0e9955ec7cf880644decf5de10369107 SRR6958401.sra SRR6958401.sra file validated SRR6958401 is paired end SRR6958401 is conventional basespace SRR6958401 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958401_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.72125 32.0 18.0 33.0 18.0 33.0 2 24.13875 25.0 18.0 29.0 18.0 33.0 3 29.4185 30.0 27.0 33.0 25.0 33.0 4 30.933 31.0 30.0 33.0 29.0 33.0 5 32.01675 33.0 31.0 33.0 31.0 33.0 6 36.773 38.0 37.0 38.0 35.0 38.0 7 37.17725 38.0 38.0 38.0 36.0 38.0 8 37.27575 38.0 38.0 38.0 36.0 38.0 9 37.47225 38.0 38.0 38.0 37.0 38.0 10-14 37.4685 38.0 38.0 38.0 37.6 38.0 15-19 37.4905 38.0 38.0 38.0 37.8 38.0 20-24 37.62645 38.0 38.0 38.0 38.0 38.0 25-29 37.53895 38.0 38.0 38.0 38.0 38.0 30-34 37.3726 38.0 38.0 38.0 37.6 38.0 35-39 37.480450000000005 38.0 38.0 38.0 37.6 38.0 40-44 37.5966 38.0 38.0 38.0 38.0 38.0 45-49 37.588649999999994 38.0 38.0 38.0 38.0 38.0 50-54 37.40885 38.0 38.0 38.0 37.0 38.0 55-59 37.3767 38.0 38.0 38.0 37.0 38.0 60-64 37.557950000000005 38.0 38.0 38.0 38.0 38.0 65-69 37.5817 38.0 38.0 38.0 38.0 38.0 70-74 37.2431 38.0 38.0 38.0 36.4 38.0 75-79 37.46395 38.0 38.0 38.0 37.0 38.0 80-84 37.4292 38.0 38.0 38.0 37.0 38.0 85-89 37.21025 38.0 38.0 38.0 36.4 38.0 90-94 36.009249999999994 38.0 37.0 38.0 31.0 38.0 95-99 36.2514 38.0 37.4 38.0 32.6 38.0 100-104 36.33995 38.0 37.6 38.0 33.2 38.0 105-109 36.5043 38.0 38.0 38.0 34.2 38.0 110-114 36.29855 38.0 38.0 38.0 33.6 38.0 115-119 36.7571 38.0 38.0 38.0 34.6 38.0 120-124 36.90135 38.0 38.0 38.0 35.0 38.0 125-129 36.8029 38.0 38.0 38.0 34.8 38.0 130-134 36.747550000000004 38.0 38.0 38.0 35.0 38.0 135-139 36.6865 38.0 38.0 38.0 34.6 38.0 140-144 36.3523 38.0 38.0 38.0 34.0 38.0 145-149 35.95485 38.0 37.6 38.0 33.2 38.0 150-151 29.198875 34.5 19.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 0.0 24 2.0 25 5.0 26 5.0 27 11.0 28 16.0 29 25.0 30 33.0 31 46.0 32 46.0 33 83.0 34 137.0 35 234.0 36 713.0 37 2640.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.69109947643979 14.083769633507853 9.293193717277488 42.93193717277487 2 23.45 17.75 29.4 29.4 3 22.1 18.7 23.9 35.3 4 25.874999999999996 25.924999999999997 22.025 26.174999999999997 5 24.925 30.85 22.375 21.85 6 21.775 32.675 23.549999999999997 22.0 7 15.25 22.45 41.349999999999994 20.95 8 21.099999999999998 23.35 28.825 26.724999999999998 9 19.3 21.65 33.825 25.224999999999998 10-14 23.31 26.334999999999997 25.88 24.474999999999998 15-19 22.99 25.324999999999996 26.515 25.169999999999998 20-24 23.235912321088982 25.613051746571912 26.343709338404565 24.80732659393454 25-29 22.445 25.929999999999996 25.965 25.66 30-34 22.115000000000002 25.929999999999996 26.645000000000003 25.31 35-39 22.759999999999998 25.88 25.55 25.81 40-44 22.715 25.765 25.955000000000002 25.564999999999998 45-49 22.415 26.015 25.990000000000002 25.580000000000002 50-54 22.835 25.814999999999998 26.02 25.330000000000002 55-59 22.650000000000002 25.64 26.11 25.6 60-64 22.415 25.974999999999998 25.924999999999997 25.685000000000002 65-69 23.095 25.88 25.91 25.115 70-74 23.23 25.47 25.965 25.335 75-79 22.525000000000002 25.45 26.07 25.955000000000002 80-84 23.05 25.295 26.395000000000003 25.259999999999998 85-89 23.405 25.755 25.669999999999998 25.169999999999998 90-94 23.355 25.555 25.855 25.235000000000003 95-99 23.31 24.88 26.38 25.430000000000003 100-104 22.945 25.2 26.419999999999998 25.435000000000002 105-109 23.515 24.57 26.534999999999997 25.380000000000003 110-114 23.75 24.955 26.279999999999998 25.014999999999997 115-119 23.395 24.895 26.650000000000002 25.06 120-124 23.255 24.94 25.94 25.865 125-129 23.315 24.755 26.555 25.374999999999996 130-134 23.36 25.045 26.35 25.245 135-139 23.235 25.685000000000002 25.66 25.419999999999998 140-144 23.45 24.995 26.035000000000004 25.52 145-149 23.45 24.845 26.005 25.7 150-151 23.3875 24.9125 25.687500000000004 26.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 4.0 28 2.5 29 0.5 30 5.0 31 7.0 32 15.5 33 28.5 34 29.5 35 38.0 36 51.5 37 62.0 38 84.5 39 114.0 40 132.0 41 157.5 42 177.0 43 190.0 44 205.5 45 224.5 46 240.5 47 225.0 48 206.0 49 182.5 50 159.0 51 141.5 52 125.5 53 112.5 54 109.5 55 103.5 56 87.0 57 79.5 58 80.0 59 81.0 60 80.5 61 65.5 62 54.5 63 52.0 64 49.0 65 51.0 66 36.0 67 24.5 68 23.0 69 19.0 70 20.0 71 19.5 72 12.5 73 10.0 74 7.0 75 4.0 76 3.0 77 1.5 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.09 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83662114314619 97.7 2 1.163378856853819 2.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.9625 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.5875 0.0 0.0 0.0 0.0 126-127 1.8875000000000002 0.0 0.0 0.0 0.0 128-129 2.0875000000000004 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.6625 0.0 0.0 0.0 0.0 136-137 2.8499999999999996 0.0 0.0 0.0 0.0 138-139 3.2125000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958401 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958401_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05825 33.0 33.0 34.0 32.0 34.0 2 33.21425 34.0 33.0 34.0 33.0 34.0 3 33.24725 34.0 33.0 34.0 33.0 34.0 4 33.21425 34.0 33.0 34.0 33.0 34.0 5 33.18275 34.0 33.0 34.0 33.0 34.0 6 37.2455 38.0 38.0 38.0 37.0 38.0 7 37.27425 38.0 38.0 38.0 37.0 38.0 8 37.357 38.0 38.0 38.0 38.0 38.0 9 37.21325 38.0 38.0 38.0 37.0 38.0 10-14 37.15625 38.0 38.0 38.0 37.0 38.0 15-19 37.113800000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.13635 38.0 38.0 38.0 37.0 38.0 25-29 37.14880000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.26545 38.0 38.0 38.0 37.0 38.0 35-39 37.3464 38.0 38.0 38.0 37.8 38.0 40-44 37.3743 38.0 38.0 38.0 37.8 38.0 45-49 37.2575 38.0 38.0 38.0 37.0 38.0 50-54 37.21145 38.0 38.0 38.0 37.2 38.0 55-59 36.804249999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.200900000000004 38.0 37.8 38.0 32.2 38.0 65-69 36.69369999999999 38.0 38.0 38.0 35.2 38.0 70-74 36.9807 38.0 38.0 38.0 36.2 38.0 75-79 36.92745 38.0 38.0 38.0 36.0 38.0 80-84 36.825399999999995 38.0 38.0 38.0 35.8 38.0 85-89 36.59055 38.0 38.0 38.0 34.8 38.0 90-94 36.4773 38.0 38.0 38.0 34.4 38.0 95-99 36.8605 38.0 38.0 38.0 36.0 38.0 100-104 36.8438 38.0 38.0 38.0 36.0 38.0 105-109 36.7443 38.0 38.0 38.0 35.4 38.0 110-114 36.6906 38.0 38.0 38.0 35.0 38.0 115-119 36.4361 38.0 38.0 38.0 34.0 38.0 120-124 36.2093 38.0 38.0 38.0 33.6 38.0 125-129 33.6987 37.6 32.0 38.0 23.4 38.0 130-134 36.001549999999995 38.0 38.0 38.0 33.2 38.0 135-139 36.074349999999995 38.0 38.0 38.0 33.6 38.0 140-144 35.8629 38.0 38.0 38.0 33.0 38.0 145-149 35.42985 38.0 36.8 38.0 32.0 38.0 150-151 31.814124999999997 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 1.0 12 2.0 13 1.0 14 2.0 15 2.0 16 1.0 17 1.0 18 1.0 19 4.0 20 2.0 21 10.0 22 2.0 23 4.0 24 11.0 25 13.0 26 10.0 27 14.0 28 21.0 29 29.0 30 31.0 31 52.0 32 54.0 33 73.0 34 132.0 35 197.0 36 545.0 37 2771.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.099999999999994 17.525 13.0 34.375 2 30.175 24.675 26.75 18.4 3 22.525000000000002 26.125 27.450000000000003 23.9 4 25.474999999999998 32.275 21.175 21.075 5 28.075 33.275 18.224999999999998 20.424999999999997 6 24.25 34.825 20.200000000000003 20.724999999999998 7 22.425 20.075000000000003 34.9 22.6 8 24.275 23.7 24.3 27.725 9 23.525 23.0 27.275 26.200000000000003 10-14 25.845000000000002 26.3 23.875 23.98 15-19 25.255 25.585 24.93 24.23 20-24 25.064999999999998 26.125 24.68 24.13 25-29 25.490000000000002 25.474999999999998 25.245 23.79 30-34 24.990000000000002 26.450000000000003 23.985 24.575 35-39 25.635 25.629999999999995 24.55 24.185000000000002 40-44 25.465 25.865 24.43 24.240000000000002 45-49 25.235000000000003 26.3 24.515 23.95 50-54 25.345000000000002 26.165 24.709999999999997 23.78 55-59 25.55 26.119999999999997 24.12 24.21 60-64 24.95 25.665 25.215 24.169999999999998 65-69 25.314999999999998 26.195 24.985 23.505000000000003 70-74 26.340000000000003 25.775 24.54 23.345 75-79 25.75 25.22 24.845 24.185000000000002 80-84 25.835 25.825 24.955 23.385 85-89 25.45 25.905 25.069999999999997 23.575 90-94 25.34 25.95 25.145 23.565 95-99 25.775 25.785000000000004 24.795 23.645 100-104 25.569999999999997 26.05 25.22 23.16 105-109 25.85 25.655 25.275 23.22 110-114 25.995 26.76 24.32 22.925 115-119 25.61 26.815 24.66 22.915 120-124 25.724999999999998 26.095000000000002 24.605 23.575 125-129 25.445 26.515 24.59 23.45 130-134 26.125 26.615 24.585 22.675 135-139 25.46 26.72 24.779999999999998 23.04 140-144 26.27 26.400000000000002 24.41 22.919999999999998 145-149 26.169999999999998 26.540000000000003 24.37 22.919999999999998 150-151 26.125 26.200000000000003 25.2125 22.4625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 1.5 28 3.0 29 6.0 30 8.0 31 7.0 32 8.0 33 16.5 34 20.5 35 26.0 36 41.0 37 62.0 38 83.5 39 100.5 40 134.0 41 164.0 42 173.0 43 190.5 44 195.5 45 192.0 46 191.0 47 196.5 48 199.5 49 172.5 50 158.0 51 148.5 52 126.0 53 105.5 54 96.0 55 104.0 56 102.0 57 91.5 58 90.5 59 98.0 60 89.5 61 74.0 62 76.0 63 71.5 64 56.5 65 50.0 66 50.5 67 42.5 68 34.0 69 35.0 70 28.5 71 18.0 72 18.5 73 16.5 74 10.0 75 5.5 76 3.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62944162436548 97.15 2 1.2690355329949239 2.5 3 0.050761421319796954 0.15 4 0.050761421319796954 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 0.9874999999999999 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.1375 0.0 0.0 0.0 0.0 122-123 1.2375 0.0 0.0 0.0 0.0 124-125 1.4875 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 1.9875 0.0 0.0 0.0 0.0 130-131 2.1625 0.0 0.0 0.0 0.0 132-133 2.3625 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 3.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTGCT 10 0.006830828 145.0 8 >>END_MODULE Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779754 spots for SRR6958401.sra Written 779754 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra Read 779739 spots for SRR6958401.sra Written 779739 spots for SRR6958401.sra SRR ids: ['SRR6958401.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_707ipo4p SRR6958401.sra spots: 15594795 blocks: [[1, 779739], [779740, 1559478], [1559479, 2339217], [2339218, 3118956], [3118957, 3898695], [3898696, 4678434], [4678435, 5458173], [5458174, 6237912], [6237913, 7017651], [7017652, 7797390], [7797391, 8577129], [8577130, 9356868], [9356869, 10136607], [10136608, 10916346], [10916347, 11696085], [11696086, 12475824], [12475825, 13255563], [13255564, 14035302], [14035303, 14815041], [14815042, 15594795]] SRR6958401 file size 5262863 SRR6958401 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958401 SRR6958401_1.fastq SRR6958401_2.fastq Input file: SRR6958401_1.fastq Paired file: SRR6958401_2.fastq trimmed: SRR6958401-trimmed-pair1.fastq, SRR6958401-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:11:01 2024 >> started Fri Dec 6 22:11:20 2024 >> done (18.343s) 15594795 read pairs processed; of these: 11440 ( 0.07%) short read pairs filtered out after trimming by size control 10643 ( 0.07%) empty read pairs filtered out after trimming by size control 15572712 (99.86%) read pairs available; of these: 4570602 (29.35%) trimmed read pairs available after processing 11002110 (70.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 1 0.00% 24 6 0.00% 25 5 0.00% 26 1 0.00% 27 4 0.00% 28 6 0.00% 29 3 0.00% 30 4 0.00% 31 7 0.00% 32 2 0.00% 33 2 0.00% 34 5 0.00% 35 6 0.00% 36 8 0.00% 37 3 0.00% 38 10 0.00% 39 9 0.00% 40 7 0.00% 41 10 0.00% 42 10 0.00% 43 9 0.00% 44 10 0.00% 45 10 0.00% 46 22 0.00% 47 15 0.00% 48 11 0.00% 49 13 0.00% 50 23 0.00% 51 13 0.00% 52 20 0.00% 53 28 0.00% 54 37 0.00% 55 22 0.00% 56 29 0.00% 57 33 0.00% 58 34 0.00% 59 56 0.00% 60 57 0.00% 61 59 0.00% 62 59 0.00% 63 72 0.00% 64 101 0.00% 65 97 0.00% 66 108 0.00% 67 110 0.00% 68 157 0.00% 69 149 0.00% 70 197 0.00% 71 177 0.00% 72 264 0.00% 73 286 0.00% 74 308 0.00% 75 348 0.00% 76 354 0.00% 77 415 0.00% 78 435 0.00% 79 521 0.00% 80 602 0.00% 81 695 0.00% 82 812 0.01% 83 943 0.01% 84 1509 0.01% 85 1824 0.01% 86 1942 0.01% 87 2047 0.01% 88 2158 0.01% 89 2171 0.01% 90 2452 0.02% 91 2679 0.02% 92 2864 0.02% 93 3003 0.02% 94 3359 0.02% 95 3525 0.02% 96 3689 0.02% 97 3939 0.03% 98 4178 0.03% 99 4359 0.03% 100 4795 0.03% 101 5100 0.03% 102 5653 0.04% 103 6058 0.04% 104 6691 0.04% 105 7027 0.05% 106 7395 0.05% 107 7557 0.05% 108 7735 0.05% 109 8480 0.05% 110 9051 0.06% 111 9650 0.06% 112 10280 0.07% 113 10868 0.07% 114 11625 0.07% 115 12606 0.08% 116 13153 0.08% 117 13290 0.09% 118 13967 0.09% 119 14467 0.09% 120 15081 0.10% 121 15822 0.10% 122 16748 0.11% 123 17584 0.11% 124 18651 0.12% 125 19828 0.13% 126 20670 0.13% 127 21282 0.14% 128 21899 0.14% 129 23130 0.15% 130 23887 0.15% 131 25174 0.16% 132 26433 0.17% 133 28161 0.18% 134 29669 0.19% 135 31304 0.20% 136 33303 0.21% 137 34676 0.22% 138 36844 0.24% 139 38718 0.25% 140 41302 0.27% 141 44654 0.29% 142 49489 0.32% 143 54558 0.35% 144 62663 0.40% 145 73386 0.47% 146 88452 0.57% 147 114613 0.74% 148 168825 1.08% 149 334860 2.15% 150 2799958 17.98% 151 11002110 70.65% 15572712 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=26 prefix-density=0.78 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=90.34 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.8 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=17 prefix-density=0.48 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=44.34 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=2.8 sequence=AGAAGGTGCAGTACGCCGTGCGCGGGGAGCTCTACCTCCGCGCCTCCGAGCTCCAGAAGGAGGGCAAGCGGATCATCTTCACCAACGTCGGCAACCCGCACGCCCTCGGCCAGAAGCCCCTCACCTTCCCCCGCCAGGTGGTGGCGCTGTGCCAGGCTCCGTTCCTGCTCGATGATCCCAACGTCGGCCTCATCTTCCCCGCCGATGCCATCGCCCGGGCCAAGCACTACCTCTCCATGGCGCCCGGTGGTTTAGGTGCCTACAGTGACTCCCGAGGTATCCCCGGAGTTAGGAAGGAAGTTGCCGAGTTCATTCAGAGGCGTGACGGGTATCCGAGTGATCCGGAGCTTATTTACCTGACTGATGGTGCCAGCAAAGGTGTGATGCAAATGCTCAACGCCATTATCAGAAACGAGAGAGACGGGATTTTGGTCCCTGTTCCACAATACCCGCTTTATTCTGCAGCCATTTCTCTCTTTGGTGGCTCGCTTGTCCCATATTACTTAGAAGA SRR6958401 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:12:04 Started mapping on | Dec 06 22:12:04 Finished on | Dec 06 22:14:15 Mapping speed, Million of reads per hour | 427.95 Number of input reads | 15572712 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14955744 Uniquely mapped reads % | 96.04% Average mapped length | 297.73 Number of splices: Total | 18173113 Number of splices: Annotated (sjdb) | 17149029 Number of splices: GT/AG | 17924612 Number of splices: GC/AG | 210551 Number of splices: AT/AC | 6785 Number of splices: Non-canonical | 31165 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 184191 % of reads mapped to multiple loci | 1.18% Number of reads mapped to too many loci | 13631 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.15% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 440214 440214 440214 N_multimapping 184191 184191 184191 N_noFeature 494110 14498859 598007 N_ambiguous 408297 1890 56087 UnstrandedReadsAssigned:14053337 PositiveStrandReadsAssigned:454995 NegativeStrandReadsAssigned:14301650 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6958401 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958401-trimmed-pair1.fastq SRR6958401-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,572,712 reads, 14,290,737 reads pseudoaligned [quant] estimated average fragment length: 275.979 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52973 SRR6958401.ke.tsv 35125 SRR6958401.se.tsv 88098 total ==> SRR6958401.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.669 0 0 PNS24247 1044 769.021 38.0229 5.06147 PNS24249 1928 1653.02 51.2526 3.174 PNS24246 1044 769.021 38.0229 5.06147 PNS24248 1044 769.021 38.0229 5.06147 PNS24244 1471 1196.02 23.6786 2.02669 PNS24243 293 80.1638 0 0 KQK14069 1603 1328.02 4715.97 363.526 KQK14071 474 217.461 25.626 12.0634 ==> SRR6958401.se.tsv <== BRADI_1g14170v3 4984 BRADI_1g53295v3 794 BRADI_1g59795v3 67 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 219 BRADI_1g74790v3 71 BRADI_1g09890v3 0 BRADI_1g77505v3 217 BRADI_1g48960v3 0 SRR6958401 completed mapping pipeline successfully