Starting /dee2/code/volunteer_pipeline.sh SRR6958402 current disk space = 1548119236608 free memory = 1476759976 SRR6958402 SRAfilesize e17ea6c9ccd2af540b2eb474311538dc SRR6958402.sra SRR6958402.sra file validated SRR6958402 is paired end SRR6958402 is conventional basespace SRR6958402 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958402_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.76125 32.0 25.0 33.0 2.0 34.0 2 30.908 33.0 29.0 33.0 27.0 34.0 3 30.69525 33.0 29.0 33.0 27.0 33.0 4 32.5395 33.0 32.0 33.0 32.0 34.0 5 32.73875 33.0 33.0 34.0 32.0 34.0 6 36.928 38.0 37.0 38.0 35.0 38.0 7 37.48625 38.0 38.0 38.0 37.0 38.0 8 37.491 38.0 38.0 38.0 37.0 38.0 9 37.58425 38.0 38.0 38.0 38.0 38.0 10-14 37.509699999999995 38.0 38.0 38.0 37.6 38.0 15-19 37.4233 38.0 38.0 38.0 37.2 38.0 20-24 37.36945 38.0 38.0 38.0 37.2 38.0 25-29 36.97475 38.0 38.0 38.0 35.6 38.0 30-34 37.35335 38.0 38.0 38.0 37.0 38.0 35-39 37.36325 38.0 38.0 38.0 36.8 38.0 40-44 37.289049999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.28915 38.0 38.0 38.0 37.0 38.0 50-54 37.19575 38.0 38.0 38.0 36.8 38.0 55-59 37.27595 38.0 38.0 38.0 36.8 38.0 60-64 37.302749999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.29185 38.0 38.0 38.0 36.8 38.0 70-74 37.1474 38.0 38.0 38.0 36.4 38.0 75-79 37.222300000000004 38.0 38.0 38.0 36.4 38.0 80-84 37.078199999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.789300000000004 38.0 38.0 38.0 35.0 38.0 90-94 35.755 38.0 36.8 38.0 30.8 38.0 95-99 35.892849999999996 38.0 37.0 38.0 31.8 38.0 100-104 35.61155 38.0 36.8 38.0 29.8 38.0 105-109 35.7164 38.0 36.8 38.0 30.4 38.0 110-114 35.612550000000006 38.0 36.8 38.0 29.8 38.0 115-119 36.11045 38.0 37.2 38.0 33.0 38.0 120-124 36.327299999999994 38.0 38.0 38.0 34.0 38.0 125-129 36.2632 38.0 38.0 38.0 34.0 38.0 130-134 36.147800000000004 38.0 37.6 38.0 33.6 38.0 135-139 36.002449999999996 38.0 37.0 38.0 33.0 38.0 140-144 34.82940000000001 37.8 35.0 38.0 28.2 38.0 145-149 34.064550000000004 38.0 34.0 38.0 25.8 38.0 150-151 30.826 36.5 29.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 2.0 22 3.0 23 1.0 24 8.0 25 12.0 26 12.0 27 14.0 28 19.0 29 44.0 30 51.0 31 65.0 32 84.0 33 119.0 34 161.0 35 292.0 36 712.0 37 2392.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.44756817542873 9.389935338768625 7.675007028394715 38.48748945740793 2 25.5 13.350000000000001 32.875 28.275 3 21.871871871871875 17.442442442442445 26.95195195195195 33.733733733733736 4 26.5 25.775 21.45 26.275 5 26.075 28.849999999999998 22.425 22.650000000000002 6 22.7 32.15 23.125 22.025 7 17.724999999999998 24.099999999999998 39.025 19.15 8 21.275 22.75 29.25 26.724999999999998 9 19.15 21.8 32.175 26.875 10-14 22.56 26.695 25.345000000000002 25.4 15-19 22.509999999999998 24.825 26.845000000000002 25.82 20-24 22.739547909581916 25.1750350070014 26.455291058211643 25.63012602520504 25-29 23.150000000000002 25.515 25.86 25.474999999999998 30-34 23.3785067760164 25.028754313146973 26.333950092513874 25.258788818322746 35-39 23.625 24.685000000000002 26.115 25.575 40-44 23.005 25.435000000000002 25.915 25.645 45-49 22.8 24.845 26.169999999999998 26.185000000000002 50-54 23.61 25.430000000000003 25.45 25.509999999999998 55-59 23.727118135440634 24.892467740322097 25.742722816845053 25.637691307392217 60-64 22.975 24.81 26.06 26.155 65-69 23.494999999999997 25.005 25.724999999999998 25.775 70-74 23.189999999999998 25.715 25.41 25.685000000000002 75-79 23.25 24.93 26.02 25.8 80-84 23.369999999999997 24.645 26.165 25.82 85-89 23.95 24.5 25.94 25.61 90-94 23.830000000000002 25.35 25.480000000000004 25.34 95-99 23.525 24.555 25.485000000000003 26.435 100-104 24.285 24.59 25.480000000000004 25.645 105-109 24.044999999999998 24.834999999999997 25.215 25.905 110-114 24.04 25.009999999999998 25.47 25.480000000000004 115-119 23.830000000000002 24.785 25.685000000000002 25.7 120-124 23.66 24.91 25.759999999999998 25.669999999999998 125-129 23.095 25.074999999999996 25.319999999999997 26.51 130-134 23.880000000000003 25.009999999999998 25.595000000000002 25.515 135-139 23.755000000000003 24.665 25.385 26.195 140-144 24.445 24.3 25.555 25.7 145-149 24.09 25.215 25.15 25.545 150-151 23.0375 25.474999999999998 25.4875 26.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 1.5 26 1.0 27 2.0 28 3.0 29 5.0 30 8.5 31 10.5 32 12.5 33 20.5 34 23.0 35 28.0 36 41.5 37 56.5 38 79.5 39 106.0 40 130.0 41 157.5 42 181.5 43 190.0 44 184.0 45 186.0 46 201.5 47 214.5 48 192.5 49 177.0 50 171.0 51 144.0 52 136.5 53 117.5 54 105.5 55 113.0 56 114.5 57 101.0 58 89.5 59 90.5 60 85.0 61 67.0 62 56.0 63 51.5 64 49.0 65 47.5 66 39.5 67 45.5 68 40.5 69 27.5 70 26.5 71 20.0 72 10.0 73 9.5 74 9.0 75 4.5 76 5.0 77 4.5 78 1.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.075 2 0.0 3 0.1 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.02 25-29 0.0 30-34 0.015 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.03 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.3250000000000002 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.6124999999999998 0.0 0.0 0.0 0.0 120-121 1.875 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.5625 0.0 0.0 0.0 0.0 128-129 2.8125 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.6 0.0 0.0 0.0 0.0 136-137 3.9000000000000004 0.0 0.0 0.0 0.0 138-139 4.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958402 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958402_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05525 33.0 33.0 34.0 32.0 34.0 2 33.12925 34.0 33.0 34.0 33.0 34.0 3 33.1595 34.0 33.0 34.0 33.0 34.0 4 33.114 34.0 33.0 34.0 33.0 34.0 5 33.0045 34.0 33.0 34.0 32.0 34.0 6 37.148 38.0 38.0 38.0 37.0 38.0 7 37.20225 38.0 38.0 38.0 37.0 38.0 8 37.16275 38.0 38.0 38.0 37.0 38.0 9 37.2455 38.0 38.0 38.0 37.0 38.0 10-14 36.78465 38.0 37.8 38.0 35.0 38.0 15-19 36.727549999999994 38.0 38.0 38.0 34.6 38.0 20-24 36.80145 38.0 38.0 38.0 35.6 38.0 25-29 36.95925 38.0 38.0 38.0 36.2 38.0 30-34 36.77995 38.0 37.8 38.0 34.6 38.0 35-39 37.21335 38.0 38.0 38.0 36.8 38.0 40-44 36.92325 38.0 37.8 38.0 35.2 38.0 45-49 36.3894 38.0 37.6 38.0 32.4 38.0 50-54 36.2653 38.0 36.6 38.0 32.2 38.0 55-59 36.414950000000005 38.0 37.4 38.0 33.6 38.0 60-64 33.988299999999995 37.2 32.4 38.0 24.2 38.0 65-69 36.63325 38.0 37.8 38.0 34.8 38.0 70-74 35.8408 38.0 37.2 38.0 30.2 38.0 75-79 36.165350000000004 38.0 37.8 38.0 33.0 38.0 80-84 34.55615 37.8 34.0 38.0 26.4 38.0 85-89 35.76775000000001 38.0 37.2 38.0 30.2 38.0 90-94 36.23819999999999 38.0 37.8 38.0 33.2 38.0 95-99 34.432849999999995 37.2 31.6 38.0 28.4 38.0 100-104 36.21685 38.0 37.2 38.0 33.2 38.0 105-109 36.397450000000006 38.0 38.0 38.0 34.2 38.0 110-114 35.91005 38.0 37.8 38.0 32.8 38.0 115-119 35.875699999999995 38.0 37.6 38.0 32.2 38.0 120-124 35.235549999999996 38.0 36.2 38.0 28.8 38.0 125-129 34.233999999999995 38.0 34.4 38.0 24.0 38.0 130-134 34.3052 38.0 34.4 38.0 24.0 38.0 135-139 35.011700000000005 38.0 35.8 38.0 29.2 38.0 140-144 34.10595 38.0 34.6 38.0 23.6 38.0 145-149 34.261700000000005 38.0 35.4 38.0 27.2 38.0 150-151 29.748375000000003 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 3.0 5 0.0 6 0.0 7 0.0 8 3.0 9 1.0 10 1.0 11 2.0 12 2.0 13 1.0 14 3.0 15 2.0 16 2.0 17 7.0 18 3.0 19 6.0 20 11.0 21 5.0 22 8.0 23 11.0 24 10.0 25 12.0 26 19.0 27 33.0 28 35.0 29 55.0 30 55.0 31 74.0 32 101.0 33 136.0 34 187.0 35 393.0 36 1007.0 37 1808.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.875 18.3 11.65 32.175 2 30.325000000000003 23.775 25.35 20.549999999999997 3 22.925 26.650000000000002 28.075 22.35 4 26.85 31.874999999999996 19.075 22.2 5 27.875 32.775 18.925 20.424999999999997 6 23.95 35.25 21.099999999999998 19.7 7 22.400000000000002 20.3 34.075 23.225 8 23.625 23.974999999999998 23.474999999999998 28.925 9 25.25 21.65 26.674999999999997 26.424999999999997 10-14 26.384999999999998 26.229999999999997 22.485 24.9 15-19 25.34 26.290000000000003 24.355 24.015 20-24 26.08 25.785000000000004 24.095 24.04 25-29 26.14 25.805 23.525 24.529999999999998 30-34 25.36 26.415 23.549999999999997 24.675 35-39 25.935000000000002 26.105 23.84 24.12 40-44 26.22 25.44 24.169999999999998 24.169999999999998 45-49 26.665 25.224999999999998 24.195 23.915 50-54 26.090000000000003 25.495 24.525 23.89 55-59 25.52 25.650000000000002 24.345 24.485 60-64 25.619999999999997 25.575 24.33 24.474999999999998 65-69 25.83 25.080000000000002 24.884999999999998 24.205 70-74 26.174999999999997 25.035 24.395 24.395 75-79 26.040000000000003 25.415 24.5 24.044999999999998 80-84 25.81 25.395 24.43 24.365000000000002 85-89 26.305 25.71 24.29 23.695 90-94 25.585 25.435000000000002 24.72 24.26 95-99 26.090000000000003 24.945 25.115 23.849999999999998 100-104 25.56 25.814999999999998 24.63 23.995 105-109 26.27 26.11 24.14 23.48 110-114 26.625 25.785000000000004 24.345 23.244999999999997 115-119 26.325 25.645 24.19 23.84 120-124 26.015 25.86 24.6 23.525 125-129 26.805 25.305 24.4 23.49 130-134 27.099064859728962 25.303795569335403 24.143621543231486 23.453518027704156 135-139 26.205000000000002 25.645 24.745 23.405 140-144 26.565 26.075 24.22 23.14 145-149 26.235000000000003 25.845000000000002 23.935000000000002 23.985 150-151 26.825 25.7125 24.3125 23.150000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 3.0 29 6.5 30 8.0 31 5.5 32 11.0 33 17.0 34 18.0 35 30.5 36 41.5 37 49.5 38 74.0 39 98.0 40 111.5 41 123.5 42 153.5 43 172.5 44 177.5 45 184.5 46 182.0 47 180.5 48 179.5 49 175.5 50 154.5 51 148.5 52 151.0 53 139.5 54 126.5 55 126.0 56 114.0 57 101.0 58 102.0 59 89.0 60 82.0 61 75.5 62 79.0 63 78.5 64 67.5 65 58.5 66 42.5 67 39.5 68 42.0 69 41.0 70 39.0 71 28.5 72 22.0 73 20.5 74 12.0 75 5.5 76 4.0 77 3.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85931558935361 97.5 2 0.988593155893536 1.95 3 0.07604562737642585 0.22499999999999998 4 0.050697084917617236 0.2 5 0.025348542458808618 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8374999999999999 0.0 0.0 0.0 0.0 110-111 0.9625 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.2999999999999998 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 2.075 0.0 0.0 0.0 0.0 124-125 2.3 0.0 0.0 0.0 0.0 126-127 2.4375 0.0 0.0 0.0 0.0 128-129 2.6625 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.7125 0.0 0.0 0.0 0.0 138-139 4.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062416 spots for SRR6958402.sra Written 1062416 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra Read 1062415 spots for SRR6958402.sra Written 1062415 spots for SRR6958402.sra SRR ids: ['SRR6958402.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8nmwb5vo SRR6958402.sra spots: 21248301 blocks: [[1, 1062415], [1062416, 2124830], [2124831, 3187245], [3187246, 4249660], [4249661, 5312075], [5312076, 6374490], [6374491, 7436905], [7436906, 8499320], [8499321, 9561735], [9561736, 10624150], [10624151, 11686565], [11686566, 12748980], [12748981, 13811395], [13811396, 14873810], [14873811, 15936225], [15936226, 16998640], [16998641, 18061055], [18061056, 19123470], [19123471, 20185885], [20185886, 21248301]] SRR6958402 file size 7178651 SRR6958402 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958402 SRR6958402_1.fastq SRR6958402_2.fastq Input file: SRR6958402_1.fastq Paired file: SRR6958402_2.fastq trimmed: SRR6958402-trimmed-pair1.fastq, SRR6958402-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:16:25 2024 >> started Fri Dec 6 22:20:13 2024 >> done (228.354s) 21248301 read pairs processed; of these: 18859 ( 0.09%) short read pairs filtered out after trimming by size control 16727 ( 0.08%) empty read pairs filtered out after trimming by size control 21212715 (99.83%) read pairs available; of these: 6935232 (32.69%) trimmed read pairs available after processing 14277483 (67.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 6 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 6 0.00% 25 8 0.00% 26 5 0.00% 27 8 0.00% 28 3 0.00% 29 6 0.00% 30 9 0.00% 31 6 0.00% 32 4 0.00% 33 7 0.00% 34 6 0.00% 35 9 0.00% 36 8 0.00% 37 13 0.00% 38 7 0.00% 39 7 0.00% 40 14 0.00% 41 10 0.00% 42 21 0.00% 43 15 0.00% 44 12 0.00% 45 17 0.00% 46 19 0.00% 47 21 0.00% 48 31 0.00% 49 35 0.00% 50 30 0.00% 51 50 0.00% 52 47 0.00% 53 41 0.00% 54 51 0.00% 55 64 0.00% 56 58 0.00% 57 58 0.00% 58 82 0.00% 59 103 0.00% 60 105 0.00% 61 130 0.00% 62 142 0.00% 63 187 0.00% 64 181 0.00% 65 172 0.00% 66 212 0.00% 67 259 0.00% 68 258 0.00% 69 322 0.00% 70 394 0.00% 71 411 0.00% 72 491 0.00% 73 549 0.00% 74 619 0.00% 75 667 0.00% 76 832 0.00% 77 876 0.00% 78 952 0.00% 79 1094 0.01% 80 1201 0.01% 81 1363 0.01% 82 1686 0.01% 83 1895 0.01% 84 2854 0.01% 85 3438 0.02% 86 3721 0.02% 87 3713 0.02% 88 3942 0.02% 89 4179 0.02% 90 4401 0.02% 91 4850 0.02% 92 5159 0.02% 93 5779 0.03% 94 6292 0.03% 95 6564 0.03% 96 7069 0.03% 97 7397 0.03% 98 7751 0.04% 99 8311 0.04% 100 8876 0.04% 101 9556 0.05% 102 10416 0.05% 103 11219 0.05% 104 11896 0.06% 105 12476 0.06% 106 13216 0.06% 107 13667 0.06% 108 14274 0.07% 109 15110 0.07% 110 15844 0.07% 111 16613 0.08% 112 17918 0.08% 113 18949 0.09% 114 20196 0.10% 115 21701 0.10% 116 22422 0.11% 117 23005 0.11% 118 23887 0.11% 119 24300 0.11% 120 25507 0.12% 121 26461 0.12% 122 27870 0.13% 123 30008 0.14% 124 31450 0.15% 125 32849 0.15% 126 34308 0.16% 127 35439 0.17% 128 36363 0.17% 129 37528 0.18% 130 39159 0.18% 131 40792 0.19% 132 42613 0.20% 133 45424 0.21% 134 47713 0.22% 135 50752 0.24% 136 53205 0.25% 137 55260 0.26% 138 57679 0.27% 139 61385 0.29% 140 65369 0.31% 141 69758 0.33% 142 76810 0.36% 143 85436 0.40% 144 97650 0.46% 145 112806 0.53% 146 136779 0.64% 147 180117 0.85% 148 268908 1.27% 149 530446 2.50% 150 4072513 19.20% 151 14277483 67.31% 21212715 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=21 prefix-density=0.95 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=30.38 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.44 fanout-score-rank=14 prefix-density=0.59 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=96.08 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.5 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958402 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:25:40 Started mapping on | Dec 06 22:25:41 Finished on | Dec 06 22:57:07 Mapping speed, Million of reads per hour | 40.49 Number of input reads | 21212715 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20105753 Uniquely mapped reads % | 94.78% Average mapped length | 296.91 Number of splices: Total | 23232574 Number of splices: Annotated (sjdb) | 21877738 Number of splices: GT/AG | 22907661 Number of splices: GC/AG | 272123 Number of splices: AT/AC | 8273 Number of splices: Non-canonical | 44517 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 347434 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 53872 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 1.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 770836 770836 770836 N_multimapping 347434 347434 347434 N_noFeature 769833 19498187 922635 N_ambiguous 530171 2588 76097 UnstrandedReadsAssigned:18805749 PositiveStrandReadsAssigned:604978 NegativeStrandReadsAssigned:19107021 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958402 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958402-trimmed-pair1.fastq SRR6958402-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,212,715 reads, 19,143,160 reads pseudoaligned [quant] estimated average fragment length: 271.245 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR6958402.ke.tsv 35125 SRR6958402.se.tsv 88098 total ==> SRR6958402.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.259 0 0 PNS24247 1044 773.755 61.4304 6.08257 PNS24249 1928 1657.75 42.8482 1.98025 PNS24246 1044 773.755 61.4304 6.08257 PNS24248 1044 773.755 61.4304 6.08257 PNS24244 1471 1200.75 38.8605 2.47948 PNS24243 293 84.1318 0 0 KQK14069 1603 1332.75 7393.13 424.996 KQK14071 474 222.309 94.449 32.5497 ==> SRR6958402.se.tsv <== BRADI_1g14170v3 8274 BRADI_1g53295v3 964 BRADI_1g59795v3 111 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 299 BRADI_1g74790v3 76 BRADI_1g09890v3 0 BRADI_1g77505v3 227 BRADI_1g48960v3 0 SRR6958402 completed mapping pipeline successfully