Starting /dee2/code/volunteer_pipeline.sh SRR6958404 current disk space = 1548455723008 free memory = 1599597336 SRR6958404 SRAfilesize 374733b3fffbfaeeec050414a7668568 SRR6958404.sra SRR6958404.sra file validated SRR6958404 is paired end SRR6958404 is conventional basespace SRR6958404 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958404_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6365 33.0 33.0 34.0 32.0 34.0 2 31.3925 33.0 31.0 33.0 28.0 34.0 3 32.3175 33.0 33.0 33.0 31.0 34.0 4 32.0275 33.0 31.0 33.0 30.0 34.0 5 32.8995 33.0 33.0 34.0 32.0 34.0 6 36.10575 38.0 36.0 38.0 33.0 38.0 7 37.01125 38.0 38.0 38.0 35.0 38.0 8 37.42025 38.0 38.0 38.0 37.0 38.0 9 37.507 38.0 38.0 38.0 37.0 38.0 10-14 37.51975 38.0 38.0 38.0 37.6 38.0 15-19 37.52329999999999 38.0 38.0 38.0 37.8 38.0 20-24 37.577799999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.522400000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.50915 38.0 38.0 38.0 38.0 38.0 35-39 37.48105 38.0 38.0 38.0 37.4 38.0 40-44 37.46585 38.0 38.0 38.0 37.0 38.0 45-49 37.4474 38.0 38.0 38.0 37.0 38.0 50-54 37.3658 38.0 38.0 38.0 37.0 38.0 55-59 37.196799999999996 38.0 38.0 38.0 36.6 38.0 60-64 37.00165 38.0 38.0 38.0 36.0 38.0 65-69 37.232099999999996 38.0 38.0 38.0 36.4 38.0 70-74 37.227599999999995 38.0 38.0 38.0 36.2 38.0 75-79 37.163050000000005 38.0 38.0 38.0 36.0 38.0 80-84 37.08055 38.0 38.0 38.0 36.0 38.0 85-89 36.9869 38.0 38.0 38.0 35.4 38.0 90-94 36.8905 38.0 38.0 38.0 35.0 38.0 95-99 36.80275 38.0 38.0 38.0 34.6 38.0 100-104 36.6562 38.0 38.0 38.0 34.2 38.0 105-109 36.52345 38.0 38.0 38.0 33.8 38.0 110-114 36.3645 38.0 37.8 38.0 34.0 38.0 115-119 36.181 38.0 37.4 38.0 33.2 38.0 120-124 35.92895 38.0 37.0 38.0 31.2 38.0 125-129 35.60635 38.0 36.2 38.0 30.8 38.0 130-134 35.20915 38.0 36.0 38.0 29.0 38.0 135-139 34.7291 38.0 35.6 38.0 27.4 38.0 140-144 34.43545 38.0 35.2 38.0 27.2 38.0 145-149 33.5098 38.0 33.2 38.0 22.2 38.0 150-151 27.65325 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 3.0 21 3.0 22 4.0 23 6.0 24 12.0 25 10.0 26 13.0 27 17.0 28 21.0 29 34.0 30 42.0 31 51.0 32 73.0 33 70.0 34 164.0 35 304.0 36 740.0 37 2428.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.0 11.025 9.325 36.65 2 25.2 10.525 34.849999999999994 29.425 3 21.55 15.65 25.525 37.275000000000006 4 24.975 22.6 23.125 29.299999999999997 5 25.924999999999997 26.474999999999998 24.775 22.825 6 25.124999999999996 30.075000000000003 23.95 20.849999999999998 7 18.725 23.599999999999998 37.6 20.075000000000003 8 20.424999999999997 24.025 28.775000000000002 26.775 9 21.775 21.475 31.275 25.474999999999998 10-14 23.284656931386277 25.41508301660332 25.870174034806958 25.43008601720344 15-19 23.79 24.415 26.174999999999997 25.619999999999997 20-24 23.605 24.86 25.874999999999996 25.66 25-29 23.225 25.135 25.71 25.929999999999996 30-34 23.674999999999997 24.235 25.895000000000003 26.195 35-39 23.525 24.81 25.36 26.305 40-44 23.45 24.72 26.005 25.825 45-49 23.875 24.585 25.45 26.090000000000003 50-54 23.94 24.104999999999997 25.435000000000002 26.52 55-59 23.84538152610442 24.518072289156624 25.557228915662648 26.079317269076306 60-64 23.98251432016883 24.43473017787157 25.655712993668978 25.927042508290626 65-69 23.974999999999998 24.279999999999998 25.85 25.895000000000003 70-74 24.485 24.335 25.369999999999997 25.81 75-79 23.51 24.435000000000002 26.169999999999998 25.885 80-84 24.125 24.73 25.195 25.95 85-89 24.515 23.695 25.89 25.900000000000002 90-94 24.099999999999998 24.425 25.52 25.955000000000002 95-99 24.36 23.97 25.474999999999998 26.195 100-104 24.325 24.45 24.975 26.25 105-109 24.33 24.64 25.055 25.974999999999998 110-114 25.014999999999997 23.91 25.1 25.974999999999998 115-119 24.855 24.325 24.435000000000002 26.384999999999998 120-124 24.645 24.215 25.430000000000003 25.71 125-129 24.45 24.279999999999998 25.295 25.974999999999998 130-134 24.3 24.285 25.240000000000002 26.174999999999997 135-139 24.095 24.085 25.509999999999998 26.31 140-144 24.42 24.6 24.895 26.085 145-149 24.865000000000002 24.825 24.39 25.919999999999998 150-151 25.0625 24.0375 24.712500000000002 26.187500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 0.5 28 2.0 29 3.5 30 4.0 31 7.0 32 10.5 33 15.0 34 19.0 35 25.0 36 40.5 37 56.5 38 70.5 39 87.0 40 104.0 41 121.5 42 148.5 43 182.5 44 198.0 45 200.5 46 193.0 47 196.0 48 201.0 49 191.0 50 177.5 51 151.0 52 130.5 53 116.0 54 110.5 55 109.0 56 101.0 57 105.5 58 104.5 59 86.5 60 76.0 61 77.5 62 79.0 63 69.0 64 71.0 65 71.0 66 55.0 67 55.0 68 43.5 69 27.5 70 26.0 71 23.0 72 17.5 73 8.0 74 6.0 75 8.5 76 6.0 77 4.0 78 3.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.4 60-64 0.49 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7060010085728694 1.4000000000000001 3 0.07564296520423601 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.7625 0.0 0.0 0.0 0.0 124-125 0.9625 0.0 0.0 0.0 0.0 126-127 1.1625 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.5375 0.0 0.0 0.0 0.0 134-135 1.7125 0.0 0.0 0.0 0.0 136-137 1.9375 0.0 0.0 0.0 0.0 138-139 2.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCATG 10 0.006830828 145.0 145 ATCAAGC 10 0.006830828 145.0 145 >>END_MODULE SRR6958404 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958404_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8445 33.0 33.0 34.0 32.0 34.0 2 33.002 33.0 33.0 34.0 32.0 34.0 3 32.98575 34.0 33.0 34.0 32.0 34.0 4 32.995 34.0 33.0 34.0 33.0 34.0 5 33.0085 34.0 33.0 34.0 32.0 34.0 6 37.149 38.0 38.0 38.0 37.0 38.0 7 37.1835 38.0 38.0 38.0 37.0 38.0 8 37.2015 38.0 38.0 38.0 37.0 38.0 9 37.16375 38.0 38.0 38.0 37.0 38.0 10-14 37.1534 38.0 38.0 38.0 37.0 38.0 15-19 37.1544 38.0 38.0 38.0 37.0 38.0 20-24 37.12265 38.0 38.0 38.0 36.8 38.0 25-29 37.072 38.0 38.0 38.0 36.8 38.0 30-34 37.0452 38.0 38.0 38.0 36.6 38.0 35-39 37.065 38.0 38.0 38.0 37.0 38.0 40-44 37.038850000000004 38.0 38.0 38.0 36.6 38.0 45-49 37.026050000000005 38.0 38.0 38.0 36.2 38.0 50-54 36.93855 38.0 38.0 38.0 36.0 38.0 55-59 36.903800000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.8986 38.0 38.0 38.0 36.0 38.0 65-69 36.7821 38.0 38.0 38.0 35.8 38.0 70-74 36.8596 38.0 38.0 38.0 35.8 38.0 75-79 36.75045 38.0 38.0 38.0 35.2 38.0 80-84 36.68615 38.0 38.0 38.0 35.0 38.0 85-89 36.60565 38.0 38.0 38.0 35.0 38.0 90-94 36.47735 38.0 38.0 38.0 34.4 38.0 95-99 36.33525 38.0 38.0 38.0 34.0 38.0 100-104 36.2461 38.0 38.0 38.0 34.0 38.0 105-109 36.1844 38.0 38.0 38.0 33.8 38.0 110-114 35.85455 38.0 37.6 38.0 32.2 38.0 115-119 35.7453 38.0 37.0 38.0 32.4 38.0 120-124 35.8239 38.0 37.0 38.0 32.8 38.0 125-129 35.81525 38.0 37.2 38.0 32.8 38.0 130-134 35.57285 38.0 36.2 38.0 31.6 38.0 135-139 35.38125 38.0 36.0 38.0 31.6 38.0 140-144 34.8984 38.0 35.8 38.0 29.4 38.0 145-149 34.1831 38.0 34.8 38.0 26.0 38.0 150-151 29.885375000000003 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 1.0 4 2.0 5 2.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 2.0 12 0.0 13 2.0 14 1.0 15 4.0 16 2.0 17 2.0 18 5.0 19 0.0 20 4.0 21 3.0 22 8.0 23 4.0 24 14.0 25 8.0 26 21.0 27 20.0 28 28.0 29 53.0 30 40.0 31 40.0 32 56.0 33 85.0 34 146.0 35 212.0 36 561.0 37 2658.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.85 17.875 12.75 32.525 2 29.37640871525169 23.36589030803907 26.170798898071624 21.086902078637614 3 22.489356373653894 25.31930879038317 27.372902579514154 24.818432256448787 4 26.73515409671762 29.64169381107492 21.723878727136057 21.899273365071412 5 26.314471707561342 32.72408612919379 19.929894842263394 21.031547320981474 6 23.52941176470588 35.49436795994993 18.67334167709637 22.302878598247812 7 23.25988983475213 19.42914371557336 32.799198798197295 24.511767651477214 8 23.410115172759138 24.98748122183275 22.408612919379067 29.193790686029043 9 22.8342513770656 23.084626940410615 26.389584376564844 27.691537305958942 10-14 26.074111166750125 25.89384076114171 22.493740610916372 25.53830746119179 15-19 25.709850267915268 24.883569532775805 24.17246732435275 25.234112874956182 20-24 25.591063915047087 25.410739330795433 23.732718894009217 25.265477860148266 25-29 25.7563614506111 25.54598276898417 23.77780004007213 24.9198557403326 30-34 25.667484846966886 24.330010519461005 24.40014025948004 25.60236437409207 35-39 25.16148415202043 25.451905262630813 23.8395673726904 25.547043212658355 40-44 26.06801222016327 25.612260229378474 23.608954775379377 24.71077277507888 45-49 26.011213456147374 25.310372446936324 23.18281938325991 25.495594713656388 50-54 26.21359223300971 25.552997697928138 23.76138524672205 24.472024822340106 55-59 26.612257160024033 24.56939715601843 23.853394752653713 24.964950931303825 60-64 25.7660725015021 25.435609853795317 23.653114360104148 25.145203284598438 65-69 26.28179451231724 25.6759463248548 23.32265171239736 24.7196074504306 70-74 26.82120863165273 24.9186401642217 23.531767886646975 24.728383317478595 75-79 25.704842505884116 24.933647153087286 24.447894236065903 24.913616104962692 80-84 26.11719961967672 24.956212780863734 24.02041735475154 24.906170244708 85-89 26.59127301841473 25.080064051240992 23.34367493995196 24.984987990392312 90-94 26.174026234104335 24.581956543506557 24.511865425052566 24.732151797336538 95-99 26.1476846057572 25.046307884856073 24.100125156445557 24.705882352941178 100-104 26.133747121834016 25.12764040444489 23.56091700870958 25.177695465011514 105-109 25.947434292866085 24.966207759699625 24.20525657071339 24.881101376720903 110-114 26.224091318714326 25.59327125262842 23.35536197056173 24.827275458095524 115-119 26.126802884615387 25.595953525641026 23.783052884615387 24.494190705128204 120-124 26.06345711140026 25.24271844660194 24.031628465619058 24.66219597637874 125-129 26.480749011165074 25.4593701497021 23.81214639763681 24.247734441496018 130-134 26.501200960768617 25.300240192153723 23.70896717373899 24.48959167333867 135-139 26.262575704489716 25.071324891135692 24.981230291806398 23.684869112568197 140-144 26.738074978727667 25.68697131988588 23.624806046348663 23.95014765503779 145-149 26.309994494770034 25.72443821630549 23.46228917471598 24.5032781142085 150-151 25.86055826761797 25.885592689948677 24.233320816122166 24.02052822631118 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 1.0 5 1.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.0 28 3.0 29 2.5 30 4.5 31 8.0 32 9.5 33 13.0 34 21.5 35 23.5 36 26.5 37 58.0 38 71.0 39 75.5 40 102.0 41 121.5 42 134.5 43 151.0 44 174.0 45 182.5 46 192.0 47 195.0 48 172.0 49 160.5 50 156.5 51 138.5 52 132.5 53 129.5 54 115.5 55 103.0 56 107.0 57 117.5 58 106.0 59 94.0 60 94.5 61 88.0 62 79.0 63 75.0 64 75.5 65 74.5 66 68.0 67 63.5 68 55.5 69 45.5 70 41.0 71 36.0 72 29.5 73 23.5 74 15.5 75 8.5 76 5.0 77 4.5 78 3.0 79 1.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.17500000000000002 4 0.22499999999999998 5 0.15 6 0.125 7 0.15 8 0.15 9 0.15 10-14 0.15 15-19 0.155 20-24 0.18 25-29 0.18 30-34 0.185 35-39 0.145 40-44 0.165 45-49 0.12 50-54 0.09 55-59 0.13999999999999999 60-64 0.13999999999999999 65-69 0.13999999999999999 70-74 0.135 75-79 0.155 80-84 0.08499999999999999 85-89 0.08 90-94 0.13 95-99 0.125 100-104 0.11 105-109 0.125 110-114 0.13 115-119 0.16 120-124 0.09 125-129 0.135 130-134 0.08 135-139 0.105 140-144 0.105 145-149 0.095 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01190777805928 97.7 2 0.709399543957436 1.4000000000000001 3 0.2280212819863187 0.675 4 0.02533569799847986 0.1 5 0.02533569799847986 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.7625 0.0 0.0 0.0 0.0 124-125 0.9625 0.0 0.0 0.0 0.0 126-127 1.1625 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.525 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.8875 0.0 0.0 0.0 0.0 138-139 2.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGGAG 10 0.006830828 145.0 7 >>END_MODULE Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201548 spots for SRR6958404.sra Written 1201548 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra Read 1201540 spots for SRR6958404.sra Written 1201540 spots for SRR6958404.sra SRR ids: ['SRR6958404.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vfioft9l SRR6958404.sra spots: 24030808 blocks: [[1, 1201540], [1201541, 2403080], [2403081, 3604620], [3604621, 4806160], [4806161, 6007700], [6007701, 7209240], [7209241, 8410780], [8410781, 9612320], [9612321, 10813860], [10813861, 12015400], [12015401, 13216940], [13216941, 14418480], [14418481, 15620020], [15620021, 16821560], [16821561, 18023100], [18023101, 19224640], [19224641, 20426180], [20426181, 21627720], [21627721, 22829260], [22829261, 24030808]] SRR6958404 file size 8121551 SRR6958404 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958404 SRR6958404_1.fastq SRR6958404_2.fastq Input file: SRR6958404_1.fastq Paired file: SRR6958404_2.fastq trimmed: SRR6958404-trimmed-pair1.fastq, SRR6958404-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:14:36 2024 >> started Fri Dec 6 22:15:04 2024 >> done (27.743s) 24030808 read pairs processed; of these: 29449 ( 0.12%) short read pairs filtered out after trimming by size control 53936 ( 0.22%) empty read pairs filtered out after trimming by size control 23947423 (99.65%) read pairs available; of these: 9658419 (40.33%) trimmed read pairs available after processing 14289004 (59.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 10 0.00% 23 3 0.00% 24 8 0.00% 25 5 0.00% 26 9 0.00% 27 2 0.00% 28 6 0.00% 29 5 0.00% 30 8 0.00% 31 6 0.00% 32 6 0.00% 33 7 0.00% 34 6 0.00% 35 13 0.00% 36 10 0.00% 37 9 0.00% 38 6 0.00% 39 9 0.00% 40 8 0.00% 41 4 0.00% 42 8 0.00% 43 14 0.00% 44 18 0.00% 45 11 0.00% 46 15 0.00% 47 23 0.00% 48 25 0.00% 49 30 0.00% 50 35 0.00% 51 37 0.00% 52 27 0.00% 53 42 0.00% 54 46 0.00% 55 62 0.00% 56 49 0.00% 57 58 0.00% 58 64 0.00% 59 58 0.00% 60 89 0.00% 61 94 0.00% 62 112 0.00% 63 106 0.00% 64 108 0.00% 65 137 0.00% 66 153 0.00% 67 192 0.00% 68 161 0.00% 69 192 0.00% 70 216 0.00% 71 280 0.00% 72 302 0.00% 73 331 0.00% 74 341 0.00% 75 436 0.00% 76 484 0.00% 77 475 0.00% 78 590 0.00% 79 602 0.00% 80 755 0.00% 81 861 0.00% 82 1005 0.00% 83 1173 0.00% 84 2116 0.01% 85 2592 0.01% 86 2639 0.01% 87 2714 0.01% 88 2920 0.01% 89 3037 0.01% 90 3167 0.01% 91 3347 0.01% 92 3534 0.01% 93 3655 0.02% 94 4081 0.02% 95 4229 0.02% 96 4433 0.02% 97 4869 0.02% 98 5170 0.02% 99 5454 0.02% 100 5972 0.02% 101 6427 0.03% 102 6663 0.03% 103 7176 0.03% 104 7642 0.03% 105 8242 0.03% 106 8828 0.04% 107 9359 0.04% 108 9774 0.04% 109 10363 0.04% 110 11171 0.05% 111 11820 0.05% 112 12606 0.05% 113 13593 0.06% 114 14450 0.06% 115 15582 0.07% 116 16692 0.07% 117 17148 0.07% 118 18257 0.08% 119 18938 0.08% 120 20014 0.08% 121 21112 0.09% 122 22301 0.09% 123 23652 0.10% 124 24876 0.10% 125 26492 0.11% 126 28100 0.12% 127 29599 0.12% 128 30778 0.13% 129 32916 0.14% 130 34255 0.14% 131 36177 0.15% 132 38699 0.16% 133 41396 0.17% 134 43600 0.18% 135 46976 0.20% 136 50168 0.21% 137 53761 0.22% 138 57330 0.24% 139 61724 0.26% 140 68139 0.28% 141 74286 0.31% 142 82994 0.35% 143 94169 0.39% 144 110560 0.46% 145 134562 0.56% 146 171453 0.72% 147 240163 1.00% 148 391335 1.63% 149 872561 3.64% 150 6395642 26.71% 151 14289004 59.67% 23947423 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=23 prefix-density=0.76 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=38.52 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.6 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=22 prefix-density=0.55 prefix-fanout=2.9 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.15 sequence-density-rank=21 fanout-score=51.44 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=10.5 sequence=GCCGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGA SRR6958404 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:15:53 Started mapping on | Dec 06 22:15:53 Finished on | Dec 06 22:18:18 Mapping speed, Million of reads per hour | 594.56 Number of input reads | 23947423 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 23239571 Uniquely mapped reads % | 97.04% Average mapped length | 298.06 Number of splices: Total | 27030406 Number of splices: Annotated (sjdb) | 25452349 Number of splices: GT/AG | 26672692 Number of splices: GC/AG | 314426 Number of splices: AT/AC | 10091 Number of splices: Non-canonical | 33197 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 176833 % of reads mapped to multiple loci | 0.74% Number of reads mapped to too many loci | 11001 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.86% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 544936 544936 544936 N_multimapping 176833 176833 176833 N_noFeature 676573 22628007 827879 N_ambiguous 549582 3221 90069 UnstrandedReadsAssigned:22013416 PositiveStrandReadsAssigned:608343 NegativeStrandReadsAssigned:22321623 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958404 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958404-trimmed-pair1.fastq SRR6958404-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,947,423 reads, 22,296,480 reads pseudoaligned [quant] estimated average fragment length: 276.572 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR6958404.ke.tsv 35125 SRR6958404.se.tsv 88098 total ==> SRR6958404.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 660.872 2.31663e-06 2.29731e-07 PNS24247 1044 768.428 74.8677 6.38516 PNS24249 1928 1652.43 76.3432 3.02781 PNS24246 1044 768.428 74.8677 6.38516 PNS24248 1044 768.428 74.8677 6.38516 PNS24244 1471 1195.43 37.0537 2.03136 PNS24243 293 75.9046 0 0 KQK14069 1603 1327.43 2469.65 121.928 KQK14071 474 213.427 37.0943 11.3904 ==> SRR6958404.se.tsv <== BRADI_1g14170v3 2762 BRADI_1g53295v3 220 BRADI_1g59795v3 354 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 357 BRADI_1g74790v3 100 BRADI_1g09890v3 0 BRADI_1g77505v3 310 BRADI_1g48960v3 0 SRR6958404 completed mapping pipeline successfully