Starting /dee2/code/volunteer_pipeline.sh SRR6958405 current disk space = 1548450725888 free memory = 1596727772 SRR6958405 SRAfilesize e48f27b2d3574164922ad4f67290bea5 SRR6958405.sra SRR6958405.sra file validated SRR6958405 is paired end SRR6958405 is conventional basespace SRR6958405 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958405_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.31475 30.0 18.0 32.0 18.0 33.0 2 22.94125 18.0 18.0 28.0 18.0 31.0 3 27.27825 29.0 25.0 31.0 18.0 33.0 4 29.95275 31.0 29.0 33.0 27.0 33.0 5 32.4845 33.0 33.0 33.0 32.0 33.0 6 36.2275 38.0 36.0 38.0 33.0 38.0 7 37.073 38.0 38.0 38.0 35.0 38.0 8 36.64725 38.0 38.0 38.0 34.0 38.0 9 37.364 38.0 38.0 38.0 36.0 38.0 10-14 37.56285 38.0 38.0 38.0 37.8 38.0 15-19 37.56225 38.0 38.0 38.0 38.0 38.0 20-24 37.56155 38.0 38.0 38.0 38.0 38.0 25-29 37.51875 38.0 38.0 38.0 38.0 38.0 30-34 37.26465 38.0 38.0 38.0 36.8 38.0 35-39 37.534749999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.54275 38.0 38.0 38.0 38.0 38.0 45-49 37.528549999999996 38.0 38.0 38.0 37.8 38.0 50-54 37.36135 38.0 38.0 38.0 37.0 38.0 55-59 37.3765 38.0 38.0 38.0 37.2 38.0 60-64 37.461200000000005 38.0 38.0 38.0 37.2 38.0 65-69 36.884499999999996 38.0 38.0 38.0 35.2 38.0 70-74 36.69675 38.0 37.8 38.0 33.8 38.0 75-79 37.2653 38.0 38.0 38.0 36.6 38.0 80-84 37.2991 38.0 38.0 38.0 37.0 38.0 85-89 36.576499999999996 38.0 37.6 38.0 33.8 38.0 90-94 34.9135 38.0 35.6 38.0 24.0 38.0 95-99 36.1903 38.0 37.4 38.0 32.8 38.0 100-104 35.952299999999994 38.0 37.2 38.0 30.4 38.0 105-109 36.0952 38.0 37.2 38.0 31.8 38.0 110-114 36.1943 38.0 37.8 38.0 33.6 38.0 115-119 36.52075000000001 38.0 38.0 38.0 34.0 38.0 120-124 36.629599999999996 38.0 38.0 38.0 34.4 38.0 125-129 36.5866 38.0 38.0 38.0 34.2 38.0 130-134 36.44345 38.0 38.0 38.0 34.0 38.0 135-139 36.23405 38.0 37.8 38.0 33.6 38.0 140-144 35.60315 38.0 36.2 38.0 31.2 38.0 145-149 35.12134999999999 38.0 35.6 38.0 30.6 38.0 150-151 31.076625 35.5 30.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 0.0 19 1.0 20 1.0 21 2.0 22 2.0 23 2.0 24 3.0 25 6.0 26 2.0 27 15.0 28 21.0 29 27.0 30 39.0 31 47.0 32 75.0 33 92.0 34 162.0 35 335.0 36 938.0 37 2225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.624572480926073 16.78505656406209 10.891870560378848 45.69850039463299 2 15.950000000000001 19.25 33.300000000000004 31.5 3 20.849999999999998 20.95 24.85 33.35 4 23.75 28.749999999999996 22.2 25.3 5 25.1 29.349999999999998 23.3 22.25 6 22.175 33.900000000000006 22.7 21.224999999999998 7 15.675 22.975 41.325 20.025000000000002 8 21.3 22.7 27.575 28.425 9 18.224999999999998 22.575 33.85 25.35 10-14 22.215 26.235000000000003 25.5 26.05 15-19 23.055 25.52 26.295 25.130000000000003 20-24 23.128469270390557 25.618842826423965 26.02890433565035 25.22378356753513 25-29 22.926146307315364 25.6112805640282 25.886294314715734 25.576278813940696 30-34 22.564999999999998 25.435000000000002 26.275 25.724999999999998 35-39 22.56612830641532 26.271313565678284 25.5612780639032 25.601280064003202 40-44 22.586129306465324 25.93629681484074 25.6062803140157 25.871293564678233 45-49 22.575 25.585 26.215 25.624999999999996 50-54 22.830000000000002 24.959999999999997 25.8 26.41 55-59 22.586129306465324 25.636281814090705 26.226311315565777 25.551277563878195 60-64 22.75 25.155 26.174999999999997 25.919999999999998 65-69 23.169999999999998 25.230000000000004 26.19 25.41 70-74 23.005 25.28 25.790000000000003 25.924999999999997 75-79 22.82 25.21 26.640000000000004 25.330000000000002 80-84 23.77 25.224999999999998 25.69 25.314999999999998 85-89 22.875 25.4 25.615 26.11 90-94 23.7 25.169999999999998 25.77 25.36 95-99 23.59 25.009999999999998 25.990000000000002 25.41 100-104 23.46 25.72 25.119999999999997 25.7 105-109 23.13 25.145 26.08 25.645 110-114 23.155 25.629999999999995 25.665 25.55 115-119 23.35 25.195 25.779999999999998 25.674999999999997 120-124 22.595000000000002 25.064999999999998 26.06 26.279999999999998 125-129 23.525 24.975 25.655 25.845000000000002 130-134 23.515 25.46 25.650000000000002 25.374999999999996 135-139 23.49 25.335 25.41 25.765 140-144 23.665 24.805 25.69 25.840000000000003 145-149 23.51 25.235000000000003 25.95 25.305 150-151 23.0625 24.75 26.05 26.137500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 2.5 28 4.0 29 4.0 30 7.0 31 11.5 32 12.5 33 21.0 34 28.0 35 38.5 36 52.5 37 67.0 38 94.0 39 120.5 40 133.0 41 150.5 42 188.0 43 211.5 44 213.0 45 210.5 46 211.0 47 203.5 48 184.0 49 176.5 50 166.0 51 145.5 52 137.5 53 112.0 54 97.0 55 92.0 56 77.5 57 84.5 58 84.0 59 79.5 60 71.5 61 68.5 62 66.5 63 56.5 64 49.0 65 40.5 66 33.0 67 33.0 68 33.5 69 29.5 70 24.0 71 18.0 72 13.5 73 8.5 74 9.0 75 7.0 76 4.0 77 3.5 78 2.5 79 1.5 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.005 30-34 0.0 35-39 0.005 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19314170448816 98.35000000000001 2 0.7564296520423601 1.5 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.025 0.0 0.0 0.0 0.025 72-73 0.025 0.0 0.0 0.0 0.025 74-75 0.05 0.0 0.0 0.0 0.025 76-77 0.075 0.0 0.0 0.0 0.025 78-79 0.1 0.0 0.0 0.0 0.025 80-81 0.175 0.0 0.0 0.0 0.025 82-83 0.175 0.0 0.0 0.0 0.025 84-85 0.175 0.0 0.0 0.0 0.025 86-87 0.175 0.0 0.0 0.0 0.025 88-89 0.1875 0.0 0.0 0.0 0.025 90-91 0.225 0.0 0.0 0.0 0.025 92-93 0.275 0.0 0.0 0.0 0.025 94-95 0.35 0.0 0.0 0.0 0.025 96-97 0.425 0.0 0.0 0.0 0.025 98-99 0.525 0.0 0.0 0.0 0.025 100-101 0.6 0.0 0.0 0.0 0.025 102-103 0.6875 0.0 0.0 0.0 0.025 104-105 0.7 0.0 0.0 0.0 0.025 106-107 0.7875 0.0 0.0 0.0 0.025 108-109 0.95 0.0 0.0 0.0 0.025 110-111 1.125 0.0 0.0 0.0 0.025 112-113 1.2374999999999998 0.0 0.0 0.0 0.025 114-115 1.475 0.0 0.0 0.0 0.025 116-117 1.725 0.0 0.0 0.0 0.025 118-119 1.9125 0.0 0.0 0.0 0.025 120-121 2.0625 0.0 0.0 0.0 0.025 122-123 2.2875 0.0 0.0 0.0 0.025 124-125 2.4875 0.0 0.0 0.0 0.025 126-127 2.7750000000000004 0.0 0.0 0.0 0.025 128-129 3.05 0.0 0.0 0.0 0.025 130-131 3.275 0.0 0.0 0.0 0.025 132-133 3.425 0.0 0.0 0.0 0.025 134-135 3.7125 0.0 0.0 0.0 0.025 136-137 4.0375 0.0 0.0 0.0 0.025 138-139 4.4625 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958405 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958405_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.885 33.0 33.0 34.0 32.0 34.0 2 33.078 34.0 33.0 34.0 32.0 34.0 3 33.06375 34.0 33.0 34.0 32.0 34.0 4 33.02425 34.0 33.0 34.0 32.0 34.0 5 33.02125 34.0 33.0 34.0 32.0 34.0 6 37.21325 38.0 38.0 38.0 37.0 38.0 7 37.27125 38.0 38.0 38.0 37.0 38.0 8 37.24025 38.0 38.0 38.0 37.0 38.0 9 37.14425 38.0 38.0 38.0 37.0 38.0 10-14 37.1216 38.0 38.0 38.0 36.8 38.0 15-19 36.99225 38.0 38.0 38.0 36.2 38.0 20-24 36.7658 38.0 38.0 38.0 35.8 38.0 25-29 36.517450000000004 38.0 37.8 38.0 33.8 38.0 30-34 36.751349999999995 38.0 38.0 38.0 34.8 38.0 35-39 36.7345 38.0 37.8 38.0 34.4 38.0 40-44 35.74555 38.0 36.8 38.0 29.4 38.0 45-49 36.726000000000006 38.0 37.6 38.0 34.8 38.0 50-54 37.013999999999996 38.0 38.0 38.0 36.6 38.0 55-59 37.029849999999996 38.0 38.0 38.0 36.4 38.0 60-64 35.6315 38.0 35.6 38.0 30.4 38.0 65-69 36.0833 38.0 37.2 38.0 31.0 38.0 70-74 35.479200000000006 38.0 36.0 38.0 28.2 38.0 75-79 36.588499999999996 38.0 38.0 38.0 34.8 38.0 80-84 36.4777 38.0 38.0 38.0 34.6 38.0 85-89 36.2892 38.0 38.0 38.0 34.0 38.0 90-94 36.50515 38.0 38.0 38.0 34.6 38.0 95-99 36.56385 38.0 38.0 38.0 34.8 38.0 100-104 36.62015 38.0 38.0 38.0 35.0 38.0 105-109 36.297850000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.240899999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.1228 38.0 38.0 38.0 33.8 38.0 120-124 35.29755 38.0 37.0 38.0 29.2 38.0 125-129 35.21195 38.0 35.8 38.0 29.2 38.0 130-134 35.613749999999996 38.0 36.6 38.0 32.2 38.0 135-139 35.30085 38.0 36.0 38.0 31.0 38.0 140-144 34.92614999999999 38.0 36.0 38.0 30.2 38.0 145-149 34.63975000000001 38.0 36.0 38.0 29.8 38.0 150-151 29.316000000000003 35.5 19.0 38.0 10.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 3.0 5 1.0 6 1.0 7 1.0 8 2.0 9 2.0 10 0.0 11 1.0 12 3.0 13 1.0 14 2.0 15 1.0 16 2.0 17 1.0 18 4.0 19 6.0 20 4.0 21 6.0 22 7.0 23 11.0 24 8.0 25 11.0 26 21.0 27 27.0 28 23.0 29 34.0 30 39.0 31 68.0 32 78.0 33 98.0 34 182.0 35 281.0 36 666.0 37 2394.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.1 17.775 12.8 31.324999999999996 2 32.074999999999996 23.400000000000002 26.1 18.425 3 23.9 28.050000000000004 25.5 22.55 4 27.500000000000004 31.45 19.900000000000002 21.15 5 26.55 33.0 19.6 20.849999999999998 6 23.375 33.425 20.200000000000003 23.0 7 22.625 18.95 35.9 22.525000000000002 8 25.074999999999996 23.875 22.400000000000002 28.65 9 23.375 22.725 27.425 26.474999999999998 10-14 26.229999999999997 26.009999999999998 22.99 24.77 15-19 25.979999999999997 24.98 24.895 24.145 20-24 25.845000000000002 25.495 24.654999999999998 24.005000000000003 25-29 26.155 25.779999999999998 24.04 24.025 30-34 25.14 26.009999999999998 24.86 23.990000000000002 35-39 25.430000000000003 26.314999999999998 23.895 24.36 40-44 25.724999999999998 25.619999999999997 24.57 24.085 45-49 25.755 25.775 24.245 24.224999999999998 50-54 25.869999999999997 25.465 24.67 23.995 55-59 25.16 25.35 25.119999999999997 24.37 60-64 25.905 25.395 24.3 24.4 65-69 25.71 25.735000000000003 24.59 23.965 70-74 26.16 25.480000000000004 24.705 23.655 75-79 25.915 25.979999999999997 23.880000000000003 24.224999999999998 80-84 25.95 25.36 25.44 23.25 85-89 26.064999999999998 25.44 25.28 23.215 90-94 25.624999999999996 25.575 24.51 24.29 95-99 25.924999999999997 26.085 24.765 23.225 100-104 25.995 25.69 24.485 23.830000000000002 105-109 25.779999999999998 25.485000000000003 25.264999999999997 23.47 110-114 25.915 26.229999999999997 24.099999999999998 23.755000000000003 115-119 26.02 25.34 25.040000000000003 23.599999999999998 120-124 26.07 26.179999999999996 24.575 23.175 125-129 26.490000000000002 25.855 24.73 22.925 130-134 26.5 25.71 24.8 22.99 135-139 26.185000000000002 25.724999999999998 24.995 23.095 140-144 26.419999999999998 26.005 24.93 22.645 145-149 26.634999999999998 26.235000000000003 24.345 22.785 150-151 26.437500000000004 26.3625 24.95 22.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 1.5 24 1.0 25 2.0 26 2.0 27 1.0 28 0.0 29 2.0 30 5.0 31 10.5 32 17.0 33 20.0 34 20.5 35 23.5 36 37.5 37 60.0 38 81.5 39 90.5 40 107.0 41 145.5 42 163.0 43 167.0 44 191.0 45 200.0 46 203.5 47 193.5 48 189.0 49 188.0 50 166.5 51 149.5 52 124.5 53 113.0 54 105.5 55 106.0 56 100.5 57 88.0 58 86.5 59 82.5 60 82.5 61 83.5 62 77.5 63 68.0 64 59.5 65 54.0 66 59.0 67 57.0 68 52.0 69 42.0 70 28.5 71 25.0 72 22.5 73 16.5 74 10.5 75 6.5 76 2.5 77 2.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.4500000000000002 0.0 0.0 0.0 0.0 116-117 1.7 0.0 0.0 0.0 0.0 118-119 1.8875 0.0 0.0 0.0 0.0 120-121 2.0375 0.0 0.0 0.0 0.0 122-123 2.2625 0.0 0.0 0.0 0.0 124-125 2.4625 0.0 0.0 0.0 0.0 126-127 2.75 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.25 0.0 0.0 0.0 0.0 132-133 3.3875 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 4.0125 0.0 0.0 0.0 0.0 138-139 4.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727393 spots for SRR6958405.sra Written 727393 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra Read 727381 spots for SRR6958405.sra Written 727381 spots for SRR6958405.sra SRR ids: ['SRR6958405.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jfn49w94 SRR6958405.sra spots: 14547632 blocks: [[1, 727381], [727382, 1454762], [1454763, 2182143], [2182144, 2909524], [2909525, 3636905], [3636906, 4364286], [4364287, 5091667], [5091668, 5819048], [5819049, 6546429], [6546430, 7273810], [7273811, 8001191], [8001192, 8728572], [8728573, 9455953], [9455954, 10183334], [10183335, 10910715], [10910716, 11638096], [11638097, 12365477], [12365478, 13092858], [13092859, 13820239], [13820240, 14547632]] SRR6958405 file size 4908014 SRR6958405 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958405 SRR6958405_1.fastq SRR6958405_2.fastq Input file: SRR6958405_1.fastq Paired file: SRR6958405_2.fastq trimmed: SRR6958405-trimmed-pair1.fastq, SRR6958405-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:13:19 2024 >> started Fri Dec 6 22:13:34 2024 >> done (14.432s) 14547632 read pairs processed; of these: 13587 ( 0.09%) short read pairs filtered out after trimming by size control 16490 ( 0.11%) empty read pairs filtered out after trimming by size control 14517555 (99.79%) read pairs available; of these: 5351556 (36.86%) trimmed read pairs available after processing 9165999 (63.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 2 0.00% 21 1 0.00% 22 5 0.00% 23 11 0.00% 24 3 0.00% 25 1 0.00% 26 7 0.00% 27 8 0.00% 28 5 0.00% 29 7 0.00% 30 11 0.00% 31 5 0.00% 32 2 0.00% 33 8 0.00% 34 9 0.00% 35 7 0.00% 36 6 0.00% 37 9 0.00% 38 8 0.00% 39 13 0.00% 40 18 0.00% 41 14 0.00% 42 16 0.00% 43 16 0.00% 44 10 0.00% 45 8 0.00% 46 13 0.00% 47 20 0.00% 48 23 0.00% 49 35 0.00% 50 24 0.00% 51 38 0.00% 52 46 0.00% 53 55 0.00% 54 43 0.00% 55 59 0.00% 56 64 0.00% 57 62 0.00% 58 69 0.00% 59 105 0.00% 60 106 0.00% 61 114 0.00% 62 140 0.00% 63 154 0.00% 64 158 0.00% 65 168 0.00% 66 198 0.00% 67 215 0.00% 68 242 0.00% 69 292 0.00% 70 301 0.00% 71 335 0.00% 72 434 0.00% 73 515 0.00% 74 560 0.00% 75 624 0.00% 76 676 0.00% 77 683 0.00% 78 773 0.01% 79 930 0.01% 80 1014 0.01% 81 1223 0.01% 82 1324 0.01% 83 1595 0.01% 84 2301 0.02% 85 2774 0.02% 86 2807 0.02% 87 2889 0.02% 88 2948 0.02% 89 3040 0.02% 90 3294 0.02% 91 3612 0.02% 92 4094 0.03% 93 4378 0.03% 94 4725 0.03% 95 4895 0.03% 96 5040 0.03% 97 5180 0.04% 98 5360 0.04% 99 5694 0.04% 100 6044 0.04% 101 6649 0.05% 102 7298 0.05% 103 7864 0.05% 104 8172 0.06% 105 8661 0.06% 106 8924 0.06% 107 9161 0.06% 108 9541 0.07% 109 9823 0.07% 110 10214 0.07% 111 10944 0.08% 112 11826 0.08% 113 12648 0.09% 114 13449 0.09% 115 14282 0.10% 116 14611 0.10% 117 15112 0.10% 118 15658 0.11% 119 15530 0.11% 120 16444 0.11% 121 17204 0.12% 122 18332 0.13% 123 19331 0.13% 124 20915 0.14% 125 21384 0.15% 126 22666 0.16% 127 23140 0.16% 128 23715 0.16% 129 24823 0.17% 130 25473 0.18% 131 26391 0.18% 132 28412 0.20% 133 30172 0.21% 134 32007 0.22% 135 34201 0.24% 136 35940 0.25% 137 37481 0.26% 138 39300 0.27% 139 42263 0.29% 140 44724 0.31% 141 48537 0.33% 142 53330 0.37% 143 59725 0.41% 144 69293 0.48% 145 81039 0.56% 146 99363 0.68% 147 132196 0.91% 148 203405 1.40% 149 423211 2.92% 150 3304054 22.76% 151 9165999 63.14% 14517555 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=19 prefix-density=0.57 prefix-fanout=2.8 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=161.67 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.2 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=19 prefix-density=0.59 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=37.79 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=4.8 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958405 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:14:15 Started mapping on | Dec 06 22:14:15 Finished on | Dec 06 22:15:51 Mapping speed, Million of reads per hour | 544.41 Number of input reads | 14517555 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14034628 Uniquely mapped reads % | 96.67% Average mapped length | 296.78 Number of splices: Total | 16504640 Number of splices: Annotated (sjdb) | 15586688 Number of splices: GT/AG | 16277750 Number of splices: GC/AG | 190903 Number of splices: AT/AC | 6075 Number of splices: Non-canonical | 29912 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161158 % of reads mapped to multiple loci | 1.11% Number of reads mapped to too many loci | 6699 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 330266 330266 330266 N_multimapping 161158 161158 161158 N_noFeature 454555 13574835 562921 N_ambiguous 401474 1717 50653 UnstrandedReadsAssigned:13178599 PositiveStrandReadsAssigned:458076 NegativeStrandReadsAssigned:13421054 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958405 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958405-trimmed-pair1.fastq SRR6958405-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,517,555 reads, 13,393,642 reads pseudoaligned [quant] estimated average fragment length: 272.978 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52973 SRR6958405.ke.tsv 35125 SRR6958405.se.tsv 88098 total ==> SRR6958405.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.448 0 0 PNS24247 1044 772.022 39.7585 5.66021 PNS24249 1928 1656.02 39.7244 2.63647 PNS24246 1044 772.022 39.7585 5.66021 PNS24248 1044 772.022 39.7585 5.66021 PNS24244 1471 1199.02 0 0 PNS24243 293 83.019 0 0 KQK14069 1603 1331.02 3363.39 277.73 KQK14071 474 220.083 17.9833 8.98078 ==> SRR6958405.se.tsv <== BRADI_1g14170v3 3510 BRADI_1g53295v3 690 BRADI_1g59795v3 53 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 283 BRADI_1g74790v3 65 BRADI_1g09890v3 0 BRADI_1g77505v3 167 BRADI_1g48960v3 0 SRR6958405 completed mapping pipeline successfully