Starting /dee2/code/volunteer_pipeline.sh SRR6958406 current disk space = 1548153749504 free memory = 1599822972 SRR6958406 SRAfilesize 71f7f198cec42661e90c31a0a0fe887b SRR6958406.sra SRR6958406.sra file validated SRR6958406 is paired end SRR6958406 is conventional basespace SRR6958406 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958406_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.229 18.0 18.0 18.0 18.0 32.0 2 21.9765 18.0 18.0 27.0 18.0 30.0 3 26.62725 27.0 25.0 29.0 18.0 31.0 4 30.1715 31.0 29.0 33.0 27.0 33.0 5 31.8635 33.0 31.0 33.0 29.0 33.0 6 36.96975 38.0 37.0 38.0 36.0 38.0 7 37.4005 38.0 38.0 38.0 37.0 38.0 8 37.54375 38.0 38.0 38.0 37.0 38.0 9 37.60475 38.0 38.0 38.0 38.0 38.0 10-14 37.42375 38.0 38.0 38.0 37.6 38.0 15-19 37.5064 38.0 38.0 38.0 37.6 38.0 20-24 37.47755000000001 38.0 38.0 38.0 37.8 38.0 25-29 37.18685000000001 38.0 38.0 38.0 36.2 38.0 30-34 37.3407 38.0 38.0 38.0 37.2 38.0 35-39 36.98375 38.0 38.0 38.0 36.0 38.0 40-44 37.50505 38.0 38.0 38.0 38.0 38.0 45-49 37.340250000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.2178 38.0 38.0 38.0 36.8 38.0 55-59 37.1549 38.0 38.0 38.0 36.4 38.0 60-64 37.32039999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.3514 38.0 38.0 38.0 37.0 38.0 70-74 37.22975 38.0 38.0 38.0 36.2 38.0 75-79 37.20985 38.0 38.0 38.0 36.2 38.0 80-84 37.09375 38.0 38.0 38.0 35.8 38.0 85-89 36.6557 38.0 38.0 38.0 34.6 38.0 90-94 35.9707 38.0 37.4 38.0 32.0 38.0 95-99 34.5788 38.0 34.2 38.0 25.4 38.0 100-104 35.75595 38.0 37.0 38.0 30.2 38.0 105-109 35.6501 38.0 36.6 38.0 30.6 38.0 110-114 35.336149999999996 38.0 36.2 38.0 29.6 38.0 115-119 35.49765 38.0 36.2 38.0 31.0 38.0 120-124 35.434250000000006 38.0 36.0 38.0 29.6 38.0 125-129 35.2088 38.0 36.0 38.0 29.2 38.0 130-134 34.8804 38.0 35.6 38.0 27.8 38.0 135-139 34.158449999999995 38.0 34.0 38.0 24.8 38.0 140-144 32.7273 38.0 32.2 38.0 17.8 38.0 145-149 31.844849999999997 38.0 32.2 38.0 10.4 38.0 150-151 25.927125 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 0.0 17 1.0 18 0.0 19 3.0 20 2.0 21 6.0 22 5.0 23 7.0 24 12.0 25 9.0 26 26.0 27 34.0 28 41.0 29 50.0 30 68.0 31 77.0 32 128.0 33 129.0 34 253.0 35 411.0 36 1077.0 37 1656.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.458161865569274 15.363511659807957 8.751714677640605 41.426611796982165 2 22.8 17.175 26.375 33.650000000000006 3 23.325000000000003 20.175 22.675 33.825 4 27.925 25.624999999999996 19.85 26.6 5 25.75 28.475 23.525 22.25 6 21.325 33.324999999999996 23.825 21.525 7 18.05 23.425 38.25 20.275000000000002 8 20.625 22.875 29.099999999999998 27.400000000000002 9 19.375 21.65 32.175 26.8 10-14 22.82 26.185000000000002 25.569999999999997 25.424999999999997 15-19 22.96 25.665 25.979999999999997 25.395 20-24 23.200000000000003 25.525 26.229999999999997 25.045 25-29 23.189999999999998 25.095 25.97 25.745 30-34 23.005 25.36 26.365 25.27 35-39 23.369999999999997 25.374999999999996 26.085 25.169999999999998 40-44 22.905 25.380000000000003 25.935000000000002 25.779999999999998 45-49 22.805 25.82 25.465 25.91 50-54 22.86 25.665 25.845000000000002 25.629999999999995 55-59 22.82 25.650000000000002 25.34 26.19 60-64 23.294999999999998 24.905 26.145000000000003 25.655 65-69 23.205000000000002 25.105 25.465 26.224999999999998 70-74 23.805 24.515 25.869999999999997 25.81 75-79 23.419999999999998 25.275 25.655 25.650000000000002 80-84 22.98 25.22 26.005 25.795 85-89 23.815 25.055 25.674999999999997 25.455 90-94 23.849999999999998 25.75 25.215 25.185000000000002 95-99 23.385 24.855 25.635 26.125 100-104 24.395 25.424999999999997 25.465 24.715 105-109 23.955000000000002 25.06 25.705 25.28 110-114 23.630000000000003 24.759999999999998 25.924999999999997 25.685000000000002 115-119 24.04 25.135 25.345000000000002 25.480000000000004 120-124 23.474999999999998 25.155 25.52 25.85 125-129 23.825 24.21 26.06 25.905 130-134 23.73 24.759999999999998 25.81 25.7 135-139 24.4 24.88 24.915000000000003 25.805 140-144 23.93 24.94 25.290000000000003 25.840000000000003 145-149 24.21 24.845 25.380000000000003 25.564999999999998 150-151 24.025 25.137500000000003 24.712500000000002 26.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 1.5 27 2.5 28 3.5 29 5.5 30 5.0 31 6.0 32 10.0 33 15.5 34 27.5 35 43.5 36 53.5 37 60.5 38 72.0 39 92.5 40 121.0 41 149.5 42 179.5 43 201.5 44 209.5 45 212.5 46 225.5 47 212.0 48 181.5 49 178.5 50 162.5 51 140.0 52 136.0 53 120.0 54 96.5 55 99.0 56 99.5 57 89.5 58 86.0 59 89.0 60 83.5 61 65.5 62 57.5 63 55.5 64 58.5 65 51.5 66 39.0 67 33.5 68 29.5 69 31.0 70 27.5 71 20.5 72 16.0 73 11.0 74 8.0 75 5.0 76 4.0 77 5.5 78 4.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1625 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.9875 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 3.025 0.0 0.0 0.0 0.0 126-127 3.2875 0.0 0.0 0.0 0.0 128-129 3.675 0.0 0.0 0.0 0.0 130-131 4.0375 0.0 0.0 0.0 0.0 132-133 4.4 0.0 0.0 0.0 0.0 134-135 4.725 0.0 0.0 0.0 0.0 136-137 5.2125 0.0 0.0 0.0 0.0 138-139 5.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCACA 10 0.006841402 144.925 3 >>END_MODULE SRR6958406 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958406_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.909 33.0 33.0 34.0 32.0 34.0 2 33.1185 34.0 33.0 34.0 33.0 34.0 3 33.0315 34.0 33.0 34.0 32.0 34.0 4 32.97125 34.0 33.0 34.0 32.0 34.0 5 32.91375 34.0 33.0 34.0 32.0 34.0 6 37.09275 38.0 38.0 38.0 37.0 38.0 7 37.0565 38.0 38.0 38.0 37.0 38.0 8 36.79025 38.0 38.0 38.0 36.0 38.0 9 36.83 38.0 38.0 38.0 36.0 38.0 10-14 36.73265 38.0 38.0 38.0 35.6 38.0 15-19 36.80535 38.0 38.0 38.0 35.8 38.0 20-24 36.8197 38.0 38.0 38.0 35.6 38.0 25-29 36.95865 38.0 38.0 38.0 36.6 38.0 30-34 37.04645000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.111000000000004 38.0 38.0 38.0 37.0 38.0 40-44 35.13695 38.0 35.2 38.0 28.0 38.0 45-49 35.2552 38.0 35.6 38.0 27.0 38.0 50-54 35.0226 38.0 35.0 38.0 27.2 38.0 55-59 35.2602 38.0 35.8 38.0 28.8 38.0 60-64 36.34725 38.0 37.8 38.0 34.2 38.0 65-69 35.86879999999999 38.0 37.4 38.0 31.2 38.0 70-74 35.90075 38.0 37.8 38.0 32.0 38.0 75-79 36.02355 38.0 38.0 38.0 33.0 38.0 80-84 35.897149999999996 38.0 38.0 38.0 32.6 38.0 85-89 35.703649999999996 38.0 37.6 38.0 31.2 38.0 90-94 35.5674 38.0 37.2 38.0 30.6 38.0 95-99 35.81575 38.0 37.6 38.0 32.4 38.0 100-104 33.718300000000006 37.2 30.8 38.0 24.6 38.0 105-109 35.6782 38.0 37.0 38.0 31.2 38.0 110-114 35.3752 38.0 37.0 38.0 30.6 38.0 115-119 34.7097 38.0 36.0 38.0 26.6 38.0 120-124 30.62405 34.8 26.0 38.0 15.6 38.0 125-129 29.523900000000005 34.4 22.2 38.0 12.8 38.0 130-134 29.616449999999997 34.6 23.6 38.0 12.2 38.0 135-139 32.431799999999996 37.6 32.4 38.0 13.8 38.0 140-144 30.77835 36.8 28.4 38.0 11.6 38.0 145-149 29.6967 36.8 27.0 38.0 2.0 38.0 150-151 23.431875 29.5 15.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 3.0 4 4.0 5 9.0 6 3.0 7 3.0 8 1.0 9 1.0 10 4.0 11 2.0 12 1.0 13 1.0 14 6.0 15 3.0 16 4.0 17 3.0 18 6.0 19 9.0 20 12.0 21 14.0 22 21.0 23 17.0 24 28.0 25 31.0 26 48.0 27 48.0 28 43.0 29 75.0 30 85.0 31 97.0 32 148.0 33 220.0 34 323.0 35 587.0 36 1149.0 37 980.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.6 18.275 11.475 30.65 2 28.349999999999998 24.099999999999998 27.075 20.474999999999998 3 22.525000000000002 26.575 27.0 23.9 4 26.650000000000002 31.0 20.575 21.775 5 27.325 32.175 19.6 20.9 6 21.6 36.125 20.275000000000002 22.0 7 22.575 19.675 34.725 23.025000000000002 8 24.775 23.7 23.25 28.275 9 23.925 23.35 26.400000000000002 26.325 10-14 25.374999999999996 26.174999999999997 23.47 24.98 15-19 25.995 25.569999999999997 24.075 24.36 20-24 24.995 26.105 24.52 24.38 25-29 25.580000000000002 25.785000000000004 24.0 24.635 30-34 25.900000000000002 25.264999999999997 24.4 24.435000000000002 35-39 25.385 25.929999999999996 24.19 24.495 40-44 25.52 25.055 24.45 24.975 45-49 26.119999999999997 25.14 24.735 24.005000000000003 50-54 25.525 25.89 24.545 24.04 55-59 26.119999999999997 25.169999999999998 24.93 23.78 60-64 25.445 26.045 23.925 24.585 65-69 25.66 25.905 23.985 24.45 70-74 25.935000000000002 25.590000000000003 24.455 24.02 75-79 26.06 25.064999999999998 24.815 24.060000000000002 80-84 25.85 25.1 24.275 24.775 85-89 25.53 24.915000000000003 25.115 24.44 90-94 25.814999999999998 25.724999999999998 24.52 23.94 95-99 25.47 25.575 25.35 23.605 100-104 26.169999999999998 25.330000000000002 24.57 23.93 105-109 26.395000000000003 25.319999999999997 24.895 23.39 110-114 26.235000000000003 25.629999999999995 24.83 23.305 115-119 26.195 25.790000000000003 24.335 23.68 120-124 26.35 25.374999999999996 24.79 23.485 125-129 25.99629981499075 26.00630031501575 24.62123106155308 23.376168808440422 130-134 26.56 26.025 24.075 23.34 135-139 26.605 26.08 24.755 22.56 140-144 27.36 25.705 24.25 22.685 145-149 26.825 26.095000000000002 24.16 22.919999999999998 150-151 27.1 26.05 24.474999999999998 22.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 1.5 27 2.0 28 2.0 29 3.5 30 7.0 31 8.0 32 8.0 33 10.5 34 18.0 35 30.5 36 43.5 37 48.5 38 61.5 39 100.0 40 118.5 41 134.5 42 156.5 43 175.5 44 197.5 45 207.0 46 207.0 47 200.5 48 194.0 49 179.0 50 155.0 51 148.0 52 136.0 53 114.0 54 115.0 55 109.5 56 97.0 57 91.5 58 84.5 59 83.5 60 82.0 61 76.5 62 70.0 63 62.0 64 62.5 65 61.0 66 56.5 67 46.5 68 46.5 69 45.0 70 31.0 71 21.0 72 17.0 73 13.0 74 12.0 75 14.0 76 9.5 77 5.5 78 5.0 79 4.0 80 1.0 81 1.0 82 1.5 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47103274559194 98.725 2 0.3778337531486146 0.75 3 0.10075566750629722 0.3 4 0.025188916876574305 0.1 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1625 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.7124999999999999 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1375000000000002 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.9125 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.425 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.3625 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.075 0.0 0.0 0.0 0.0 136-137 4.5375 0.0 0.0 0.0 0.0 138-139 5.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAATA 10 0.006830828 145.0 5 >>END_MODULE Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966247 spots for SRR6958406.sra Written 966247 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra Read 966236 spots for SRR6958406.sra Written 966236 spots for SRR6958406.sra SRR ids: ['SRR6958406.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pfm6ysp_ SRR6958406.sra spots: 19324731 blocks: [[1, 966236], [966237, 1932472], [1932473, 2898708], [2898709, 3864944], [3864945, 4831180], [4831181, 5797416], [5797417, 6763652], [6763653, 7729888], [7729889, 8696124], [8696125, 9662360], [9662361, 10628596], [10628597, 11594832], [11594833, 12561068], [12561069, 13527304], [13527305, 14493540], [14493541, 15459776], [15459777, 16426012], [16426013, 17392248], [17392249, 18358484], [18358485, 19324731]] SRR6958406 file size 6526816 SRR6958406 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958406 SRR6958406_1.fastq SRR6958406_2.fastq Input file: SRR6958406_1.fastq Paired file: SRR6958406_2.fastq trimmed: SRR6958406-trimmed-pair1.fastq, SRR6958406-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:18:41 2024 >> started Fri Dec 6 22:19:01 2024 >> done (19.914s) 19324731 read pairs processed; of these: 22960 ( 0.12%) short read pairs filtered out after trimming by size control 23433 ( 0.12%) empty read pairs filtered out after trimming by size control 19278338 (99.76%) read pairs available; of these: 8826639 (45.79%) trimmed read pairs available after processing 10451699 (54.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 4 0.00% 21 3 0.00% 22 1 0.00% 23 7 0.00% 24 4 0.00% 25 5 0.00% 26 6 0.00% 27 4 0.00% 28 3 0.00% 29 4 0.00% 30 6 0.00% 31 9 0.00% 32 9 0.00% 33 6 0.00% 34 14 0.00% 35 12 0.00% 36 10 0.00% 37 12 0.00% 38 11 0.00% 39 15 0.00% 40 15 0.00% 41 11 0.00% 42 18 0.00% 43 23 0.00% 44 20 0.00% 45 17 0.00% 46 21 0.00% 47 26 0.00% 48 32 0.00% 49 46 0.00% 50 48 0.00% 51 34 0.00% 52 50 0.00% 53 43 0.00% 54 57 0.00% 55 55 0.00% 56 71 0.00% 57 94 0.00% 58 97 0.00% 59 109 0.00% 60 123 0.00% 61 145 0.00% 62 183 0.00% 63 226 0.00% 64 240 0.00% 65 248 0.00% 66 258 0.00% 67 313 0.00% 68 338 0.00% 69 425 0.00% 70 450 0.00% 71 534 0.00% 72 585 0.00% 73 688 0.00% 74 759 0.00% 75 905 0.00% 76 985 0.01% 77 1114 0.01% 78 1170 0.01% 79 1289 0.01% 80 1528 0.01% 81 1784 0.01% 82 2060 0.01% 83 2389 0.01% 84 3413 0.02% 85 4244 0.02% 86 4338 0.02% 87 4584 0.02% 88 4806 0.02% 89 5159 0.03% 90 5379 0.03% 91 5777 0.03% 92 6307 0.03% 93 6974 0.04% 94 7688 0.04% 95 7918 0.04% 96 8526 0.04% 97 9196 0.05% 98 9300 0.05% 99 9956 0.05% 100 10690 0.06% 101 11445 0.06% 102 12622 0.07% 103 13458 0.07% 104 14501 0.08% 105 15362 0.08% 106 16085 0.08% 107 16885 0.09% 108 17549 0.09% 109 18275 0.09% 110 19067 0.10% 111 20295 0.11% 112 21452 0.11% 113 22954 0.12% 114 24169 0.13% 115 25621 0.13% 116 26998 0.14% 117 27860 0.14% 118 28599 0.15% 119 29380 0.15% 120 30538 0.16% 121 31861 0.17% 122 34017 0.18% 123 35567 0.18% 124 37785 0.20% 125 39458 0.20% 126 41340 0.21% 127 42982 0.22% 128 44360 0.23% 129 46071 0.24% 130 47930 0.25% 131 50133 0.26% 132 53317 0.28% 133 56746 0.29% 134 59347 0.31% 135 62719 0.33% 136 66410 0.34% 137 70653 0.37% 138 74140 0.38% 139 78640 0.41% 140 83430 0.43% 141 90235 0.47% 142 99686 0.52% 143 111184 0.58% 144 127768 0.66% 145 150570 0.78% 146 187033 0.97% 147 255311 1.32% 148 388749 2.02% 149 795579 4.13% 150 5016474 26.02% 151 10451699 54.21% 19278338 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=21 prefix-density=0.90 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=77.84 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.4 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=13 prefix-density=0.59 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=109.29 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.3 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958406 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:19:40 Started mapping on | Dec 06 22:19:40 Finished on | Dec 06 22:20:56 Mapping speed, Million of reads per hour | 913.18 Number of input reads | 19278338 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18834572 Uniquely mapped reads % | 97.70% Average mapped length | 295.81 Number of splices: Total | 21129967 Number of splices: Annotated (sjdb) | 19884075 Number of splices: GT/AG | 20857327 Number of splices: GC/AG | 248738 Number of splices: AT/AC | 7781 Number of splices: Non-canonical | 16121 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 134301 % of reads mapped to multiple loci | 0.70% Number of reads mapped to too many loci | 24844 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.77% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 324497 324497 324497 N_multimapping 134301 134301 134301 N_noFeature 669635 18288380 824029 N_ambiguous 462114 2500 71136 UnstrandedReadsAssigned:17702823 PositiveStrandReadsAssigned:543692 NegativeStrandReadsAssigned:17939407 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6958406 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958406-trimmed-pair1.fastq SRR6958406-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,278,338 reads, 17,957,053 reads pseudoaligned [quant] estimated average fragment length: 256.217 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR6958406.ke.tsv 35125 SRR6958406.se.tsv 88098 total ==> SRR6958406.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.15 0 0 PNS24247 1044 788.783 54.5142 5.86549 PNS24249 1928 1672.78 57.3866 2.91154 PNS24246 1044 788.783 54.5142 5.86549 PNS24248 1044 788.783 54.5142 5.86549 PNS24244 1471 1215.78 30.0708 2.09914 PNS24243 293 89.3305 0 0 KQK14069 1603 1347.78 5629.57 354.493 KQK14071 474 232.981 100.746 36.6994 ==> SRR6958406.se.tsv <== BRADI_1g14170v3 6361 BRADI_1g53295v3 256 BRADI_1g59795v3 186 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 279 BRADI_1g74790v3 109 BRADI_1g09890v3 1 BRADI_1g77505v3 184 BRADI_1g48960v3 0 SRR6958406 completed mapping pipeline successfully