Starting /dee2/code/volunteer_pipeline.sh SRR6958407 current disk space = 1548369502208 free memory = 1594747136 SRR6958407 SRAfilesize 34afd9124820f052cc2af8736852f8f2 SRR6958407.sra SRR6958407.sra file validated SRR6958407 is paired end SRR6958407 is conventional basespace SRR6958407 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958407_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.91675 32.0 18.0 33.0 18.0 33.0 2 26.94175 28.0 25.0 31.0 18.0 33.0 3 29.40075 31.0 27.0 33.0 25.0 33.0 4 32.163 33.0 32.0 33.0 32.0 33.0 5 32.67975 33.0 33.0 33.0 32.0 34.0 6 36.62 38.0 36.0 38.0 34.0 38.0 7 37.30225 38.0 38.0 38.0 36.0 38.0 8 37.37225 38.0 38.0 38.0 37.0 38.0 9 37.51 38.0 38.0 38.0 37.0 38.0 10-14 37.467349999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.42315 38.0 38.0 38.0 37.2 38.0 20-24 37.3765 38.0 38.0 38.0 37.0 38.0 25-29 36.967150000000004 38.0 38.0 38.0 35.4 38.0 30-34 37.3803 38.0 38.0 38.0 37.2 38.0 35-39 37.3278 38.0 38.0 38.0 36.8 38.0 40-44 37.281349999999996 38.0 38.0 38.0 36.6 38.0 45-49 37.230000000000004 38.0 38.0 38.0 36.8 38.0 50-54 37.19685 38.0 38.0 38.0 36.6 38.0 55-59 37.308550000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.30415000000001 38.0 38.0 38.0 36.8 38.0 65-69 37.2972 38.0 38.0 38.0 36.8 38.0 70-74 37.2346 38.0 38.0 38.0 36.6 38.0 75-79 37.277750000000005 38.0 38.0 38.0 36.8 38.0 80-84 37.1472 38.0 38.0 38.0 36.2 38.0 85-89 36.850849999999994 38.0 38.0 38.0 35.2 38.0 90-94 35.7082 38.0 37.2 38.0 29.4 38.0 95-99 35.834300000000006 38.0 37.0 38.0 31.2 38.0 100-104 35.6776 38.0 36.8 38.0 31.0 38.0 105-109 35.852900000000005 38.0 37.2 38.0 31.8 38.0 110-114 35.754599999999996 38.0 37.0 38.0 31.4 38.0 115-119 36.1717 38.0 37.6 38.0 33.2 38.0 120-124 36.36855 38.0 37.8 38.0 33.8 38.0 125-129 36.447700000000005 38.0 38.0 38.0 34.0 38.0 130-134 36.25545 38.0 37.6 38.0 33.6 38.0 135-139 36.127649999999996 38.0 37.4 38.0 33.4 38.0 140-144 34.8742 37.6 35.0 38.0 28.4 38.0 145-149 34.229150000000004 38.0 34.2 38.0 26.0 38.0 150-151 31.323 36.5 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 0.0 17 2.0 18 1.0 19 1.0 20 1.0 21 0.0 22 1.0 23 2.0 24 4.0 25 7.0 26 12.0 27 16.0 28 24.0 29 40.0 30 52.0 31 61.0 32 80.0 33 142.0 34 178.0 35 288.0 36 706.0 37 2379.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 50.16620498614959 7.922437673130194 7.617728531855955 34.29362880886427 2 26.625 12.725 31.7 28.95 3 22.05551387846962 17.35433858464616 25.156289072268066 35.43385846461615 4 26.775 25.650000000000002 21.8 25.775 5 26.025 28.675 23.400000000000002 21.9 6 23.1 31.474999999999998 24.375 21.05 7 17.775 22.6 39.925 19.7 8 21.2 22.325 29.175 27.3 9 20.474999999999998 21.4 33.15 24.975 10-14 22.915 25.83 25.505 25.75 15-19 23.32 25.16 25.929999999999996 25.590000000000003 20-24 23.086154307715386 25.10625531276564 26.48632431621581 25.321266063303167 25-29 22.66 25.6 25.965 25.775 30-34 23.24 25.16 26.195 25.405 35-39 22.99 24.905 25.945 26.16 40-44 23.175 25.25 25.86 25.715 45-49 23.380000000000003 25.615 25.285000000000004 25.72 50-54 23.465 24.865000000000002 25.424999999999997 26.245 55-59 23.32 25.435000000000002 26.090000000000003 25.155 60-64 22.955000000000002 24.66 25.900000000000002 26.484999999999996 65-69 23.65 25.03 26.08 25.240000000000002 70-74 23.52 24.990000000000002 25.655 25.835 75-79 23.145 25.385 25.569999999999997 25.900000000000002 80-84 23.23 24.43 26.0 26.340000000000003 85-89 23.630000000000003 24.89 25.555 25.924999999999997 90-94 23.95 24.115000000000002 26.21 25.724999999999998 95-99 24.05 24.285 25.735000000000003 25.929999999999996 100-104 23.919999999999998 24.83 25.385 25.865 105-109 24.05 24.955 25.525 25.47 110-114 23.3 25.0 25.47 26.229999999999997 115-119 23.715 25.045 25.22 26.02 120-124 23.875 24.75 25.509999999999998 25.865 125-129 23.085 25.290000000000003 25.715 25.91 130-134 23.580000000000002 24.46 25.825 26.135 135-139 24.18 24.465 25.255 26.1 140-144 24.25 24.654999999999998 25.295 25.8 145-149 23.955000000000002 25.06 25.290000000000003 25.695 150-151 24.337500000000002 24.45 25.387500000000003 25.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.5 27 3.0 28 4.0 29 3.5 30 3.0 31 11.0 32 15.0 33 18.5 34 25.0 35 31.0 36 41.0 37 51.5 38 74.5 39 101.5 40 119.0 41 141.0 42 164.0 43 189.0 44 191.5 45 181.5 46 198.0 47 204.5 48 196.0 49 200.0 50 198.0 51 165.5 52 136.5 53 129.0 54 119.0 55 102.0 56 101.0 57 93.0 58 79.5 59 82.0 60 76.0 61 72.0 62 63.5 63 62.5 64 67.0 65 48.0 66 35.0 67 36.0 68 30.5 69 26.0 70 26.0 71 21.5 72 16.0 73 12.0 74 10.5 75 8.5 76 6.0 77 3.0 78 1.0 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.75 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.1375000000000002 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.7625 0.0 0.0 0.0 0.0 124-125 2.025 0.0 0.0 0.0 0.0 126-127 2.275 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.9000000000000004 0.0 0.0 0.0 0.0 132-133 3.2249999999999996 0.0 0.0 0.0 0.0 134-135 3.5 0.0 0.0 0.0 0.0 136-137 3.8375 0.0 0.0 0.0 0.0 138-139 4.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATGG 10 0.0068396386 144.9375 9 >>END_MODULE SRR6958407 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958407_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9315 33.0 33.0 34.0 32.0 34.0 2 33.03975 34.0 33.0 34.0 32.0 34.0 3 33.01 34.0 33.0 34.0 32.0 34.0 4 33.047 34.0 33.0 34.0 33.0 34.0 5 32.84275 34.0 33.0 34.0 32.0 34.0 6 37.06675 38.0 38.0 38.0 36.0 38.0 7 37.0975 38.0 38.0 38.0 37.0 38.0 8 37.12625 38.0 38.0 38.0 37.0 38.0 9 37.16675 38.0 38.0 38.0 37.0 38.0 10-14 36.61675 38.0 37.8 38.0 34.4 38.0 15-19 36.579 38.0 38.0 38.0 34.4 38.0 20-24 36.6893 38.0 38.0 38.0 35.2 38.0 25-29 36.829750000000004 38.0 38.0 38.0 35.8 38.0 30-34 36.547399999999996 38.0 37.8 38.0 34.4 38.0 35-39 37.06235 38.0 38.0 38.0 36.6 38.0 40-44 36.7614 38.0 37.8 38.0 35.0 38.0 45-49 36.308550000000004 38.0 37.6 38.0 32.8 38.0 50-54 36.0826 38.0 36.6 38.0 32.0 38.0 55-59 36.24060000000001 38.0 37.4 38.0 33.2 38.0 60-64 33.7685 37.2 31.8 38.0 24.2 38.0 65-69 36.50965 38.0 37.8 38.0 34.6 38.0 70-74 35.64 38.0 37.2 38.0 29.6 38.0 75-79 35.93130000000001 38.0 37.6 38.0 32.0 38.0 80-84 34.34805 37.8 33.8 38.0 26.0 38.0 85-89 35.603 38.0 37.2 38.0 30.2 38.0 90-94 36.11 38.0 37.8 38.0 33.2 38.0 95-99 34.37785 37.2 31.8 38.0 28.4 38.0 100-104 36.0775 38.0 37.2 38.0 33.2 38.0 105-109 36.303250000000006 38.0 38.0 38.0 34.2 38.0 110-114 35.896 38.0 38.0 38.0 32.8 38.0 115-119 35.7125 38.0 37.6 38.0 31.6 38.0 120-124 35.07535 38.0 36.2 38.0 28.0 38.0 125-129 34.153800000000004 38.0 34.2 38.0 23.2 38.0 130-134 34.172450000000005 38.0 34.4 38.0 23.0 38.0 135-139 35.093650000000004 38.0 35.8 38.0 29.2 38.0 140-144 34.3331 38.0 34.6 38.0 24.4 38.0 145-149 34.33995 38.0 35.4 38.0 27.6 38.0 150-151 30.0745 35.5 28.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 5.0 4 2.0 5 2.0 6 1.0 7 1.0 8 2.0 9 3.0 10 1.0 11 1.0 12 2.0 13 3.0 14 2.0 15 4.0 16 3.0 17 3.0 18 3.0 19 2.0 20 4.0 21 4.0 22 3.0 23 12.0 24 12.0 25 13.0 26 20.0 27 26.0 28 41.0 29 51.0 30 80.0 31 74.0 32 104.0 33 150.0 34 197.0 35 359.0 36 928.0 37 1869.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.15 17.95 13.25 31.65 2 29.575000000000003 23.425 26.125 20.875 3 22.775000000000002 26.875 27.075 23.275000000000002 4 26.224999999999998 31.775 19.475 22.525000000000002 5 24.95 33.175 21.0 20.875 6 24.55 35.25 20.125 20.075000000000003 7 23.65 18.75 33.550000000000004 24.05 8 24.75 23.400000000000002 22.85 28.999999999999996 9 23.3 22.35 28.15 26.200000000000003 10-14 26.375 25.624999999999996 23.330000000000002 24.67 15-19 25.979999999999997 24.740000000000002 24.525 24.755 20-24 25.485000000000003 26.02 23.810000000000002 24.685000000000002 25-29 25.474999999999998 25.840000000000003 23.990000000000002 24.695 30-34 25.855 25.814999999999998 23.865 24.465 35-39 26.045 25.779999999999998 23.87 24.305 40-44 25.515 25.515 24.48 24.490000000000002 45-49 25.615 25.7 24.23 24.455 50-54 26.395000000000003 25.14 24.14 24.325 55-59 26.14 25.655 24.2 24.005000000000003 60-64 25.28 25.509999999999998 24.755 24.455 65-69 26.205000000000002 25.430000000000003 24.12 24.245 70-74 26.515 25.3 24.265 23.919999999999998 75-79 26.0 25.424999999999997 24.5 24.075 80-84 26.400000000000002 25.21 24.09 24.3 85-89 26.32 25.555 23.78 24.345 90-94 26.07 25.380000000000003 24.735 23.815 95-99 26.369999999999997 25.255 24.265 24.11 100-104 26.085 25.509999999999998 24.905 23.5 105-109 25.919999999999998 25.735000000000003 24.265 24.08 110-114 26.16 26.13 23.925 23.785 115-119 26.540000000000003 25.2 24.59 23.669999999999998 120-124 26.3 25.585 24.224999999999998 23.89 125-129 26.35 25.895000000000003 24.445 23.31 130-134 26.625 25.419999999999998 24.38 23.575 135-139 26.32 25.374999999999996 25.064999999999998 23.24 140-144 26.38 26.36 24.349999999999998 22.91 145-149 26.779999999999998 26.16 23.919999999999998 23.14 150-151 26.5375 26.687499999999996 24.125 22.650000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.0 24 0.5 25 2.0 26 2.0 27 0.5 28 1.5 29 3.0 30 5.0 31 8.0 32 10.5 33 13.5 34 20.0 35 29.5 36 39.5 37 51.5 38 65.0 39 92.5 40 121.0 41 128.0 42 145.0 43 167.5 44 178.5 45 174.0 46 185.0 47 195.5 48 176.5 49 181.5 50 179.0 51 163.0 52 149.5 53 130.5 54 117.5 55 106.5 56 97.5 57 97.5 58 97.5 59 87.5 60 79.5 61 75.5 62 79.5 63 73.5 64 60.0 65 55.5 66 58.5 67 54.5 68 52.0 69 50.0 70 39.0 71 30.0 72 21.0 73 14.0 74 10.5 75 9.0 76 5.0 77 3.0 78 1.0 79 1.0 80 1.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7749999999999999 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.1124999999999998 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.7 0.0 0.0 0.0 0.0 124-125 1.925 0.0 0.0 0.0 0.0 126-127 2.15 0.0 0.0 0.0 0.0 128-129 2.425 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 3.0125 0.0 0.0 0.0 0.0 134-135 3.2625 0.0 0.0 0.0 0.0 136-137 3.55 0.0 0.0 0.0 0.0 138-139 3.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGAAA 10 0.006830828 145.0 8 >>END_MODULE Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066336 spots for SRR6958407.sra Written 1066336 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra Read 1066334 spots for SRR6958407.sra Written 1066334 spots for SRR6958407.sra SRR ids: ['SRR6958407.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kq6oyo5u SRR6958407.sra spots: 21326682 blocks: [[1, 1066334], [1066335, 2132668], [2132669, 3199002], [3199003, 4265336], [4265337, 5331670], [5331671, 6398004], [6398005, 7464338], [7464339, 8530672], [8530673, 9597006], [9597007, 10663340], [10663341, 11729674], [11729675, 12796008], [12796009, 13862342], [13862343, 14928676], [14928677, 15995010], [15995011, 17061344], [17061345, 18127678], [18127679, 19194012], [19194013, 20260346], [20260347, 21326682]] SRR6958407 file size 7205212 SRR6958407 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958407 SRR6958407_1.fastq SRR6958407_2.fastq Input file: SRR6958407_1.fastq Paired file: SRR6958407_2.fastq trimmed: SRR6958407-trimmed-pair1.fastq, SRR6958407-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:21:13 2024 >> started Fri Dec 6 22:21:37 2024 >> done (23.559s) 21326682 read pairs processed; of these: 17973 ( 0.08%) short read pairs filtered out after trimming by size control 13778 ( 0.06%) empty read pairs filtered out after trimming by size control 21294931 (99.85%) read pairs available; of these: 6903909 (32.42%) trimmed read pairs available after processing 14391022 (67.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 2 0.00% 20 1 0.00% 21 3 0.00% 22 4 0.00% 23 2 0.00% 24 9 0.00% 25 6 0.00% 26 5 0.00% 27 1 0.00% 28 4 0.00% 29 4 0.00% 30 5 0.00% 31 5 0.00% 32 6 0.00% 33 6 0.00% 34 9 0.00% 35 5 0.00% 36 4 0.00% 37 8 0.00% 38 5 0.00% 39 11 0.00% 40 7 0.00% 41 10 0.00% 42 8 0.00% 43 12 0.00% 44 7 0.00% 45 19 0.00% 46 10 0.00% 47 23 0.00% 48 25 0.00% 49 19 0.00% 50 26 0.00% 51 27 0.00% 52 32 0.00% 53 42 0.00% 54 49 0.00% 55 40 0.00% 56 64 0.00% 57 58 0.00% 58 64 0.00% 59 91 0.00% 60 75 0.00% 61 99 0.00% 62 116 0.00% 63 141 0.00% 64 162 0.00% 65 145 0.00% 66 179 0.00% 67 218 0.00% 68 222 0.00% 69 261 0.00% 70 324 0.00% 71 327 0.00% 72 397 0.00% 73 485 0.00% 74 491 0.00% 75 550 0.00% 76 637 0.00% 77 715 0.00% 78 832 0.00% 79 923 0.00% 80 1037 0.00% 81 1183 0.01% 82 1404 0.01% 83 1651 0.01% 84 2466 0.01% 85 3248 0.02% 86 3271 0.02% 87 3348 0.02% 88 3741 0.02% 89 3759 0.02% 90 4030 0.02% 91 4367 0.02% 92 4683 0.02% 93 5141 0.02% 94 5590 0.03% 95 5937 0.03% 96 6350 0.03% 97 6827 0.03% 98 7269 0.03% 99 7652 0.04% 100 8310 0.04% 101 8829 0.04% 102 9685 0.05% 103 10319 0.05% 104 11101 0.05% 105 11759 0.06% 106 12574 0.06% 107 13100 0.06% 108 13728 0.06% 109 14463 0.07% 110 15323 0.07% 111 16032 0.08% 112 17241 0.08% 113 18447 0.09% 114 19553 0.09% 115 20706 0.10% 116 21518 0.10% 117 22664 0.11% 118 23044 0.11% 119 23643 0.11% 120 24925 0.12% 121 26103 0.12% 122 27267 0.13% 123 29274 0.14% 124 30822 0.14% 125 32246 0.15% 126 33868 0.16% 127 35107 0.16% 128 35859 0.17% 129 36956 0.17% 130 38687 0.18% 131 40344 0.19% 132 42614 0.20% 133 45116 0.21% 134 47447 0.22% 135 49981 0.23% 136 52840 0.25% 137 54934 0.26% 138 57553 0.27% 139 61187 0.29% 140 64463 0.30% 141 69170 0.32% 142 76414 0.36% 143 84651 0.40% 144 97207 0.46% 145 112879 0.53% 146 136684 0.64% 147 178770 0.84% 148 267134 1.25% 149 527056 2.48% 150 4083314 19.18% 151 14391022 67.58% 21294931 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=18 prefix-density=0.90 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=41.63 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=24 prefix-density=0.64 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=66.09 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.8 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958407 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:22:17 Started mapping on | Dec 06 22:22:17 Finished on | Dec 06 22:24:25 Mapping speed, Million of reads per hour | 598.92 Number of input reads | 21294931 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20345365 Uniquely mapped reads % | 95.54% Average mapped length | 297.53 Number of splices: Total | 23308590 Number of splices: Annotated (sjdb) | 21953850 Number of splices: GT/AG | 23008595 Number of splices: GC/AG | 273572 Number of splices: AT/AC | 8600 Number of splices: Non-canonical | 17823 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 248786 % of reads mapped to multiple loci | 1.17% Number of reads mapped to too many loci | 46920 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.64% % of reads unmapped: other | 1.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 711601 711601 711601 N_multimapping 248786 248786 248786 N_noFeature 728906 19772503 887783 N_ambiguous 491871 2755 78895 UnstrandedReadsAssigned:19124588 PositiveStrandReadsAssigned:570107 NegativeStrandReadsAssigned:19378687 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958407 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958407-trimmed-pair1.fastq SRR6958407-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,294,931 reads, 19,451,074 reads pseudoaligned [quant] estimated average fragment length: 268.916 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52973 SRR6958407.ke.tsv 35125 SRR6958407.se.tsv 88098 total ==> SRR6958407.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.6 0 0 PNS24247 1044 776.084 64.8569 6.32853 PNS24249 1928 1660.08 37.0636 1.69073 PNS24246 1044 776.084 64.8569 6.32853 PNS24248 1044 776.084 64.8569 6.32853 PNS24244 1471 1203.08 27.3658 1.72253 PNS24243 293 83.9106 0 0 KQK14069 1603 1335.08 6433.42 364.913 KQK14071 474 223.624 71.8627 24.3355 ==> SRR6958407.se.tsv <== BRADI_1g14170v3 7111 BRADI_1g53295v3 257 BRADI_1g59795v3 189 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 206 BRADI_1g74790v3 116 BRADI_1g09890v3 0 BRADI_1g77505v3 219 BRADI_1g48960v3 0 SRR6958407 completed mapping pipeline successfully