Starting /dee2/code/volunteer_pipeline.sh SRR6958408 current disk space = 1548476997632 free memory = 1598532016 SRR6958408 SRAfilesize 3c8c841044eff02d76da99aeb519bd3a SRR6958408.sra SRR6958408.sra file validated SRR6958408 is paired end SRR6958408 is conventional basespace SRR6958408 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958408_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.357 18.0 18.0 31.0 2.0 32.0 2 29.7945 30.0 27.0 33.0 27.0 33.0 3 30.65925 31.0 29.0 33.0 27.0 33.0 4 31.9215 33.0 32.0 33.0 31.0 33.0 5 32.84 33.0 33.0 33.0 32.0 34.0 6 37.1485 38.0 37.0 38.0 36.0 38.0 7 37.48025 38.0 38.0 38.0 37.0 38.0 8 37.56275 38.0 38.0 38.0 37.0 38.0 9 37.5325 38.0 38.0 38.0 38.0 38.0 10-14 37.438199999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.4281 38.0 38.0 38.0 37.2 38.0 20-24 37.37625 38.0 38.0 38.0 37.0 38.0 25-29 36.97765 38.0 38.0 38.0 35.6 38.0 30-34 37.329049999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.37094999999999 38.0 38.0 38.0 37.4 38.0 40-44 37.206 38.0 38.0 38.0 36.8 38.0 45-49 37.2102 38.0 38.0 38.0 36.8 38.0 50-54 37.17614999999999 38.0 38.0 38.0 36.8 38.0 55-59 37.21455 38.0 38.0 38.0 36.8 38.0 60-64 37.2727 38.0 38.0 38.0 37.0 38.0 65-69 37.28959999999999 38.0 38.0 38.0 36.8 38.0 70-74 37.179249999999996 38.0 38.0 38.0 36.4 38.0 75-79 37.262100000000004 38.0 38.0 38.0 37.0 38.0 80-84 37.11534999999999 38.0 38.0 38.0 36.2 38.0 85-89 36.7675 38.0 38.0 38.0 35.0 38.0 90-94 35.64945 38.0 36.8 38.0 29.8 38.0 95-99 35.78625000000001 38.0 37.0 38.0 30.6 38.0 100-104 35.6323 38.0 36.8 38.0 30.4 38.0 105-109 35.862700000000004 38.0 37.2 38.0 31.8 38.0 110-114 35.6845 38.0 37.0 38.0 30.8 38.0 115-119 36.1512 38.0 37.8 38.0 33.6 38.0 120-124 36.3779 38.0 38.0 38.0 33.8 38.0 125-129 36.411199999999994 38.0 38.0 38.0 34.0 38.0 130-134 36.2166 38.0 37.8 38.0 33.6 38.0 135-139 36.0783 38.0 37.6 38.0 33.4 38.0 140-144 34.9082 38.0 35.2 38.0 28.4 38.0 145-149 34.17755 38.0 34.4 38.0 26.4 38.0 150-151 31.24825 36.5 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 2.0 18 3.0 19 3.0 20 3.0 21 2.0 22 1.0 23 4.0 24 6.0 25 15.0 26 11.0 27 22.0 28 33.0 29 24.0 30 45.0 31 69.0 32 84.0 33 106.0 34 150.0 35 285.0 36 691.0 37 2436.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.559322033898304 9.6045197740113 13.192090395480227 38.64406779661017 2 25.15 12.6 32.725 29.525000000000002 3 22.91718789091819 16.437327995997 24.093069802351764 36.55241431073305 4 27.85 23.75 21.85 26.55 5 26.3 27.325 23.275000000000002 23.1 6 21.224999999999998 32.65 23.375 22.75 7 18.125 22.475 40.550000000000004 18.85 8 22.175 22.35 28.499999999999996 26.974999999999998 9 20.175 21.05 32.550000000000004 26.224999999999998 10-14 22.689999999999998 26.615 26.13 24.565 15-19 23.225 25.295 25.765 25.715 20-24 23.532353235323534 25.447544754475448 25.7025702570257 25.317531753175317 25-29 23.28 25.009999999999998 25.915 25.795 30-34 23.411170558527928 24.8262413120656 26.01630081504075 25.746287314365716 35-39 23.35 25.045 26.279999999999998 25.324999999999996 40-44 23.01 25.174999999999997 26.529999999999998 25.285000000000004 45-49 22.54 24.765 26.515 26.179999999999996 50-54 23.25 25.25 25.419999999999998 26.08 55-59 23.637363736373636 25.05750575057506 25.447544754475448 25.85758575857586 60-64 22.814999999999998 25.25 25.85 26.085 65-69 23.61 24.685000000000002 25.669999999999998 26.035000000000004 70-74 23.355 24.86 25.82 25.965 75-79 23.56 24.815 26.075 25.55 80-84 23.119999999999997 25.105 25.715 26.06 85-89 23.69 24.740000000000002 25.330000000000002 26.240000000000002 90-94 23.405 25.14 25.900000000000002 25.555 95-99 23.565 25.09 25.324999999999996 26.02 100-104 23.52 24.959999999999997 25.72 25.8 105-109 23.535 24.44 25.775 26.25 110-114 23.669999999999998 24.495 25.735000000000003 26.1 115-119 23.155 25.619999999999997 25.245 25.979999999999997 120-124 23.485 25.319999999999997 25.05 26.145000000000003 125-129 23.26 25.124999999999996 25.195 26.419999999999998 130-134 23.555 25.019999999999996 25.56 25.865 135-139 23.865 24.79 25.945 25.4 140-144 24.41 24.89 24.785 25.915 145-149 23.98 25.25 24.610000000000003 26.16 150-151 22.8 25.087500000000002 25.8 26.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 0.5 27 2.0 28 3.0 29 8.0 30 10.5 31 9.5 32 12.5 33 19.0 34 25.5 35 30.5 36 41.5 37 59.5 38 78.0 39 97.0 40 124.5 41 152.5 42 173.5 43 184.0 44 196.0 45 214.0 46 217.0 47 193.5 48 168.0 49 180.0 50 182.5 51 164.5 52 139.0 53 125.5 54 113.0 55 97.5 56 99.0 57 90.0 58 83.5 59 76.0 60 71.0 61 76.5 62 68.5 63 63.0 64 60.0 65 44.0 66 36.5 67 33.0 68 27.5 69 26.0 70 25.0 71 15.5 72 12.5 73 15.0 74 14.0 75 11.0 76 9.0 77 7.0 78 4.5 79 3.0 80 2.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.5 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7125 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.2375 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.8375 0.0 0.0 0.0 0.0 126-127 2.0 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.0875000000000004 0.0 0.0 0.0 0.0 134-135 3.425 0.0 0.0 0.0 0.0 136-137 3.7249999999999996 0.0 0.0 0.0 0.0 138-139 4.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958408 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958408_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0225 33.0 33.0 34.0 32.0 34.0 2 33.05475 34.0 33.0 34.0 32.0 34.0 3 33.0855 34.0 33.0 34.0 32.0 34.0 4 33.08475 34.0 33.0 34.0 33.0 34.0 5 32.87825 34.0 33.0 34.0 32.0 34.0 6 37.0535 38.0 38.0 38.0 37.0 38.0 7 37.1515 38.0 38.0 38.0 37.0 38.0 8 37.163 38.0 38.0 38.0 37.0 38.0 9 37.10675 38.0 38.0 38.0 37.0 38.0 10-14 36.706050000000005 38.0 37.8 38.0 34.8 38.0 15-19 36.7294 38.0 38.0 38.0 34.8 38.0 20-24 36.75045 38.0 38.0 38.0 35.6 38.0 25-29 36.8548 38.0 38.0 38.0 35.8 38.0 30-34 36.7115 38.0 38.0 38.0 35.0 38.0 35-39 37.10745 38.0 38.0 38.0 36.8 38.0 40-44 36.752449999999996 38.0 37.8 38.0 35.0 38.0 45-49 36.315149999999996 38.0 37.6 38.0 32.6 38.0 50-54 36.254599999999996 38.0 37.0 38.0 32.2 38.0 55-59 36.315599999999996 38.0 37.4 38.0 33.4 38.0 60-64 33.98380000000001 37.4 32.4 38.0 24.4 38.0 65-69 36.59885 38.0 37.8 38.0 34.6 38.0 70-74 35.83290000000001 38.0 37.6 38.0 30.8 38.0 75-79 36.1846 38.0 37.8 38.0 33.0 38.0 80-84 34.45435 37.8 33.8 38.0 25.8 38.0 85-89 35.86345 38.0 37.2 38.0 31.6 38.0 90-94 36.222300000000004 38.0 37.8 38.0 33.6 38.0 95-99 34.38335 37.0 31.6 38.0 28.4 38.0 100-104 36.23225 38.0 37.2 38.0 33.4 38.0 105-109 36.3959 38.0 38.0 38.0 34.2 38.0 110-114 35.979 38.0 38.0 38.0 33.2 38.0 115-119 35.8773 38.0 37.6 38.0 32.6 38.0 120-124 35.2924 38.0 36.4 38.0 29.6 38.0 125-129 34.163650000000004 38.0 34.0 38.0 24.0 38.0 130-134 34.386449999999996 38.0 34.6 38.0 24.4 38.0 135-139 35.2735 38.0 36.0 38.0 30.4 38.0 140-144 34.21775 38.0 34.2 38.0 24.4 38.0 145-149 34.5548 38.0 35.6 38.0 29.2 38.0 150-151 30.049374999999998 35.5 28.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 3.0 5 3.0 6 1.0 7 2.0 8 0.0 9 0.0 10 2.0 11 3.0 12 4.0 13 2.0 14 2.0 15 1.0 16 2.0 17 5.0 18 6.0 19 4.0 20 2.0 21 3.0 22 11.0 23 10.0 24 9.0 25 17.0 26 21.0 27 35.0 28 54.0 29 39.0 30 54.0 31 81.0 32 81.0 33 125.0 34 175.0 35 385.0 36 898.0 37 1952.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.5 17.525 12.1 32.875 2 30.875000000000004 23.875 26.650000000000002 18.6 3 23.474999999999998 26.35 27.275 22.900000000000002 4 25.25 30.825000000000003 20.625 23.3 5 26.674999999999997 31.95 20.200000000000003 21.175 6 24.725 33.15 21.2 20.925 7 22.5 20.275000000000002 34.825 22.400000000000002 8 26.375 22.525000000000002 24.0 27.1 9 23.075000000000003 23.1 27.325 26.5 10-14 26.295 25.585 23.255 24.865000000000002 15-19 25.36 25.865 24.2 24.575 20-24 25.85 25.7 24.12 24.33 25-29 26.179999999999996 25.705 23.68 24.435000000000002 30-34 25.495 25.685000000000002 24.44 24.38 35-39 26.275 25.21 24.08 24.435000000000002 40-44 26.169999999999998 25.165 24.255 24.41 45-49 26.029999999999998 25.575 24.265 24.13 50-54 26.375 25.83 23.64 24.154999999999998 55-59 26.72 25.215 23.89 24.175 60-64 25.655 25.455 25.055 23.835 65-69 26.314999999999998 25.45 24.37 23.865 70-74 26.245 25.03 24.62 24.104999999999997 75-79 26.415 25.5 24.335 23.75 80-84 26.27 25.215 25.05 23.465 85-89 26.85 24.715 24.265 24.169999999999998 90-94 26.015 25.6 24.805 23.580000000000002 95-99 26.005 24.91 25.155 23.93 100-104 26.27 25.564999999999998 24.685000000000002 23.48 105-109 26.38 25.35 24.615000000000002 23.655 110-114 26.064999999999998 25.945 24.42 23.57 115-119 26.424999999999997 25.415 24.44 23.72 120-124 25.480000000000004 25.955000000000002 24.44 24.125 125-129 26.325 25.75 23.69 24.235 130-134 26.74633731686584 25.83129156457823 24.026201310065503 23.396169808490423 135-139 26.715 25.775 24.175 23.335 140-144 26.985 25.380000000000003 24.185000000000002 23.45 145-149 26.555 26.125 24.44 22.88 150-151 27.125 25.9625 24.2875 22.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 4.0 28 5.0 29 4.5 30 6.0 31 5.5 32 5.0 33 16.5 34 27.0 35 30.0 36 40.5 37 50.0 38 66.0 39 97.0 40 119.5 41 130.0 42 162.0 43 175.0 44 172.5 45 173.0 46 174.5 47 181.0 48 190.5 49 187.0 50 162.5 51 155.0 52 136.5 53 119.5 54 125.0 55 108.5 56 97.0 57 109.5 58 91.0 59 82.5 60 79.5 61 75.5 62 78.5 63 74.0 64 71.5 65 68.0 66 60.0 67 54.0 68 51.0 69 43.0 70 36.5 71 29.0 72 23.0 73 14.5 74 9.5 75 9.0 76 5.0 77 1.0 78 1.5 79 1.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5291005291005291 1.05 3 0.12597631645250693 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0125 0.0 0.0 116-117 1.2625 0.0 0.025 0.0 0.0 118-119 1.3375 0.0 0.025 0.0 0.0 120-121 1.4875 0.0 0.025 0.0 0.0 122-123 1.625 0.0 0.025 0.0 0.0 124-125 1.7625000000000002 0.0 0.025 0.0 0.0 126-127 1.9 0.0 0.025 0.0 0.0 128-129 2.2249999999999996 0.0 0.025 0.0 0.0 130-131 2.625 0.0 0.025 0.0 0.0 132-133 2.925 0.0 0.025 0.0 0.0 134-135 3.2125 0.0 0.025 0.0 0.0 136-137 3.55 0.0 0.025 0.0 0.0 138-139 3.8625 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTCC 10 0.006830828 145.0 5 >>END_MODULE Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081886 spots for SRR6958408.sra Written 1081886 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra Read 1081884 spots for SRR6958408.sra Written 1081884 spots for SRR6958408.sra SRR ids: ['SRR6958408.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xtn5rlcb SRR6958408.sra spots: 21637682 blocks: [[1, 1081884], [1081885, 2163768], [2163769, 3245652], [3245653, 4327536], [4327537, 5409420], [5409421, 6491304], [6491305, 7573188], [7573189, 8655072], [8655073, 9736956], [9736957, 10818840], [10818841, 11900724], [11900725, 12982608], [12982609, 14064492], [14064493, 15146376], [15146377, 16228260], [16228261, 17310144], [17310145, 18392028], [18392029, 19473912], [19473913, 20555796], [20555797, 21637682]] SRR6958408 file size 7310600 SRR6958408 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958408 SRR6958408_1.fastq SRR6958408_2.fastq Input file: SRR6958408_1.fastq Paired file: SRR6958408_2.fastq trimmed: SRR6958408-trimmed-pair1.fastq, SRR6958408-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:26:15 2024 >> started Fri Dec 6 22:26:37 2024 >> done (22.004s) 21637682 read pairs processed; of these: 19461 ( 0.09%) short read pairs filtered out after trimming by size control 16919 ( 0.08%) empty read pairs filtered out after trimming by size control 21601302 (99.83%) read pairs available; of these: 6985216 (32.34%) trimmed read pairs available after processing 14616086 (67.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 4 0.00% 24 2 0.00% 25 7 0.00% 26 11 0.00% 27 7 0.00% 28 2 0.00% 29 7 0.00% 30 3 0.00% 31 8 0.00% 32 6 0.00% 33 9 0.00% 34 6 0.00% 35 7 0.00% 36 6 0.00% 37 11 0.00% 38 15 0.00% 39 6 0.00% 40 10 0.00% 41 13 0.00% 42 11 0.00% 43 9 0.00% 44 14 0.00% 45 14 0.00% 46 22 0.00% 47 18 0.00% 48 18 0.00% 49 18 0.00% 50 29 0.00% 51 27 0.00% 52 41 0.00% 53 27 0.00% 54 40 0.00% 55 36 0.00% 56 51 0.00% 57 51 0.00% 58 63 0.00% 59 66 0.00% 60 79 0.00% 61 79 0.00% 62 119 0.00% 63 110 0.00% 64 162 0.00% 65 148 0.00% 66 154 0.00% 67 175 0.00% 68 211 0.00% 69 254 0.00% 70 299 0.00% 71 334 0.00% 72 357 0.00% 73 441 0.00% 74 460 0.00% 75 559 0.00% 76 598 0.00% 77 767 0.00% 78 805 0.00% 79 863 0.00% 80 1036 0.00% 81 1117 0.01% 82 1403 0.01% 83 1618 0.01% 84 2465 0.01% 85 3222 0.01% 86 3356 0.02% 87 3464 0.02% 88 3725 0.02% 89 3863 0.02% 90 4149 0.02% 91 4440 0.02% 92 4833 0.02% 93 5333 0.02% 94 5689 0.03% 95 6065 0.03% 96 6446 0.03% 97 6991 0.03% 98 7250 0.03% 99 7837 0.04% 100 8304 0.04% 101 8917 0.04% 102 9906 0.05% 103 10766 0.05% 104 11638 0.05% 105 12247 0.06% 106 13133 0.06% 107 13666 0.06% 108 14401 0.07% 109 15284 0.07% 110 15934 0.07% 111 16734 0.08% 112 18140 0.08% 113 19231 0.09% 114 20284 0.09% 115 21798 0.10% 116 22862 0.11% 117 23580 0.11% 118 24541 0.11% 119 25379 0.12% 120 26799 0.12% 121 27634 0.13% 122 29243 0.14% 123 30876 0.14% 124 32565 0.15% 125 34599 0.16% 126 35720 0.17% 127 37345 0.17% 128 38500 0.18% 129 39534 0.18% 130 41120 0.19% 131 42843 0.20% 132 45049 0.21% 133 47454 0.22% 134 50233 0.23% 135 52487 0.24% 136 55537 0.26% 137 57707 0.27% 138 60572 0.28% 139 64216 0.30% 140 68291 0.32% 141 73496 0.34% 142 79244 0.37% 143 88610 0.41% 144 99707 0.46% 145 115263 0.53% 146 139284 0.64% 147 180887 0.84% 148 267956 1.24% 149 523010 2.42% 150 4080702 18.89% 151 14616086 67.66% 21601302 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=21 prefix-density=0.73 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=155.40 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.1 sequence=CATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=24 prefix-density=0.54 prefix-fanout=2.6 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=67.90 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=12.7 sequence=GCCGCCGCCGCCAAGGAAGGC SRR6958408 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:27:17 Started mapping on | Dec 06 22:27:17 Finished on | Dec 06 22:29:06 Mapping speed, Million of reads per hour | 713.44 Number of input reads | 21601302 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20753535 Uniquely mapped reads % | 96.08% Average mapped length | 297.38 Number of splices: Total | 23720789 Number of splices: Annotated (sjdb) | 22359451 Number of splices: GT/AG | 23412207 Number of splices: GC/AG | 280725 Number of splices: AT/AC | 9374 Number of splices: Non-canonical | 18483 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226503 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 38695 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.55% % of reads unmapped: other | 1.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 633411 633411 633411 N_multimapping 226503 226503 226503 N_noFeature 815088 20203723 969135 N_ambiguous 476045 2684 81777 UnstrandedReadsAssigned:19462402 PositiveStrandReadsAssigned:547128 NegativeStrandReadsAssigned:19702623 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958408 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958408-trimmed-pair1.fastq SRR6958408-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,601,302 reads, 19,771,245 reads pseudoaligned [quant] estimated average fragment length: 265.659 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52973 SRR6958408.ke.tsv 35125 SRR6958408.se.tsv 88098 total ==> SRR6958408.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.829 0 0 PNS24247 1044 779.341 67.8461 6.5685 PNS24249 1928 1663.34 52.6819 2.38973 PNS24246 1044 779.341 67.8461 6.5685 PNS24248 1044 779.341 67.8461 6.5685 PNS24244 1471 1206.34 39.7798 2.48806 PNS24243 293 84.7542 0 0 KQK14069 1603 1338.34 3651.29 205.849 KQK14071 474 226.306 57.6348 19.2158 ==> SRR6958408.se.tsv <== BRADI_1g14170v3 4049 BRADI_1g53295v3 379 BRADI_1g59795v3 358 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 319 BRADI_1g74790v3 133 BRADI_1g09890v3 0 BRADI_1g77505v3 271 BRADI_1g48960v3 0 SRR6958408 completed mapping pipeline successfully