Starting /dee2/code/volunteer_pipeline.sh SRR6958409 current disk space = 1548487168000 free memory = 1601815324 SRR6958409 SRAfilesize 9469760fe64aa2c7a109b771f7e929ce SRR6958409.sra SRR6958409.sra file validated SRR6958409 is paired end SRR6958409 is conventional basespace SRR6958409 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958409_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.90825 31.0 18.0 33.0 18.0 33.0 2 29.97025 31.0 28.0 33.0 25.0 33.0 3 30.69475 31.0 29.0 33.0 27.0 33.0 4 31.52475 33.0 31.0 33.0 29.0 33.0 5 32.1905 33.0 32.0 33.0 31.0 33.0 6 36.7575 38.0 37.0 38.0 35.0 38.0 7 37.284 38.0 38.0 38.0 36.0 38.0 8 36.79775 38.0 38.0 38.0 35.0 38.0 9 37.349 38.0 38.0 38.0 37.0 38.0 10-14 37.53105000000001 38.0 38.0 38.0 37.4 38.0 15-19 37.58675 38.0 38.0 38.0 37.8 38.0 20-24 37.527550000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.44985 38.0 38.0 38.0 37.6 38.0 30-34 37.1314 38.0 38.0 38.0 36.2 38.0 35-39 37.58865000000001 38.0 38.0 38.0 37.8 38.0 40-44 37.5212 38.0 38.0 38.0 38.0 38.0 45-49 37.5167 38.0 38.0 38.0 37.8 38.0 50-54 37.26255 38.0 38.0 38.0 37.0 38.0 55-59 37.299350000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.462900000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.173 38.0 38.0 38.0 36.2 38.0 70-74 36.37415 38.0 37.0 38.0 30.8 38.0 75-79 37.24865 38.0 38.0 38.0 36.4 38.0 80-84 37.3328 38.0 38.0 38.0 36.8 38.0 85-89 36.281549999999996 38.0 37.2 38.0 31.0 38.0 90-94 34.4873 38.0 34.6 38.0 22.6 38.0 95-99 35.9781 38.0 37.0 38.0 32.2 38.0 100-104 35.6725 38.0 36.6 38.0 30.0 38.0 105-109 35.8148 38.0 36.6 38.0 31.2 38.0 110-114 36.062599999999996 38.0 37.6 38.0 32.8 38.0 115-119 36.51025 38.0 38.0 38.0 34.0 38.0 120-124 36.5762 38.0 38.0 38.0 34.0 38.0 125-129 36.536199999999994 38.0 38.0 38.0 34.0 38.0 130-134 36.467200000000005 38.0 38.0 38.0 34.0 38.0 135-139 36.179700000000004 38.0 37.4 38.0 33.4 38.0 140-144 35.515100000000004 38.0 36.0 38.0 31.2 38.0 145-149 34.817600000000006 38.0 35.6 38.0 30.0 38.0 150-151 30.778125 35.5 29.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 0.0 19 0.0 20 2.0 21 2.0 22 2.0 23 0.0 24 7.0 25 8.0 26 9.0 27 21.0 28 29.0 29 20.0 30 34.0 31 52.0 32 80.0 33 103.0 34 172.0 35 313.0 36 891.0 37 2253.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.586855740387236 9.790019089173711 7.444777747477501 38.17834742296155 2 25.594195646735052 12.709532149111835 33.600200150112585 28.096072054040533 3 22.3 17.849999999999998 24.775 35.075 4 27.075 24.15 21.45 27.325 5 26.35 28.225 24.575 20.849999999999998 6 21.65 31.900000000000002 24.349999999999998 22.1 7 17.325 23.325000000000003 40.425 18.925 8 20.075000000000003 23.35 30.125 26.450000000000003 9 20.974999999999998 19.775000000000002 33.1 26.150000000000002 10-14 22.98 25.990000000000002 26.284999999999997 24.745 15-19 23.27 24.93 25.905 25.895000000000003 20-24 23.039607921584317 25.31006201240248 26.06021204240848 25.59011802360472 25-29 23.28116405820291 25.501275063753187 25.43127156357818 25.786289314465723 30-34 22.965 25.424999999999997 26.205000000000002 25.405 35-39 23.53617680884044 25.326266313315664 25.751287564378217 25.386269313465675 40-44 23.1911595579779 25.19625981299065 26.19130956547827 25.42127106355318 45-49 23.435 25.490000000000002 25.590000000000003 25.485000000000003 50-54 22.735 25.119999999999997 26.419999999999998 25.724999999999998 55-59 23.33116655832792 25.236261813090653 26.176308815440773 25.256262813140655 60-64 22.985 25.41 25.495 26.11 65-69 23.41 25.255 25.445 25.89 70-74 23.646182309115456 25.121256062803138 26.08130406520326 25.151257562878143 75-79 23.419999999999998 24.93 26.075 25.575 80-84 23.47 25.44 25.619999999999997 25.47 85-89 23.29 25.275 25.995 25.44 90-94 23.91 25.52 25.1 25.47 95-99 23.77 25.2 25.435000000000002 25.595000000000002 100-104 23.52 25.705 25.465 25.31 105-109 23.865 25.180000000000003 25.75 25.205 110-114 23.945 24.474999999999998 26.07 25.509999999999998 115-119 24.135 24.37 26.150000000000002 25.345000000000002 120-124 23.69 24.915000000000003 25.919999999999998 25.474999999999998 125-129 23.825 24.945 25.430000000000003 25.8 130-134 24.055 24.865000000000002 25.624999999999996 25.455 135-139 23.915 25.174999999999997 25.335 25.575 140-144 23.7 24.92 25.395 25.985000000000003 145-149 23.65 24.935 25.575 25.840000000000003 150-151 23.974999999999998 25.05 25.1875 25.7875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 3.0 28 3.0 29 6.0 30 7.5 31 11.0 32 18.0 33 19.0 34 20.0 35 29.5 36 46.0 37 65.5 38 87.5 39 107.0 40 124.5 41 164.0 42 192.5 43 193.5 44 208.0 45 206.0 46 203.0 47 198.0 48 193.0 49 189.0 50 152.5 51 139.0 52 136.5 53 108.5 54 95.0 55 90.5 56 85.0 57 81.0 58 74.5 59 76.5 60 77.5 61 74.5 62 72.0 63 67.0 64 56.0 65 44.0 66 45.5 67 48.5 68 44.5 69 38.5 70 27.0 71 17.5 72 12.5 73 13.0 74 12.0 75 7.0 76 3.5 77 1.5 78 1.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.325000000000001 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.02 25-29 0.005 30-34 0.0 35-39 0.005 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.4874999999999998 0.0 0.0 0.0 0.0 120-121 1.7625000000000002 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.5 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 3.05 0.0 0.0 0.0 0.0 132-133 3.45 0.0 0.0 0.0 0.0 134-135 3.725 0.0 0.0 0.0 0.0 136-137 4.225 0.0 0.0 0.0 0.0 138-139 4.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCACC 10 0.006841402 144.925 6 >>END_MODULE SRR6958409 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958409_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90125 33.0 33.0 34.0 32.0 34.0 2 33.1795 34.0 33.0 34.0 33.0 34.0 3 33.142 34.0 33.0 34.0 33.0 34.0 4 33.15175 34.0 33.0 34.0 33.0 34.0 5 33.1645 34.0 33.0 34.0 33.0 34.0 6 37.3555 38.0 38.0 38.0 37.0 38.0 7 37.43025 38.0 38.0 38.0 37.0 38.0 8 37.366 38.0 38.0 38.0 37.0 38.0 9 37.24275 38.0 38.0 38.0 37.0 38.0 10-14 37.1886 38.0 38.0 38.0 37.0 38.0 15-19 37.079800000000006 38.0 38.0 38.0 36.6 38.0 20-24 36.849199999999996 38.0 38.0 38.0 35.8 38.0 25-29 36.8964 38.0 38.0 38.0 36.0 38.0 30-34 37.15089999999999 38.0 38.0 38.0 36.6 38.0 35-39 37.033550000000005 38.0 38.0 38.0 35.8 38.0 40-44 36.0279 38.0 36.2 38.0 31.6 38.0 45-49 36.78724999999999 38.0 37.6 38.0 34.8 38.0 50-54 37.053 38.0 38.0 38.0 36.4 38.0 55-59 37.0446 38.0 38.0 38.0 36.4 38.0 60-64 35.50404999999999 37.8 35.4 38.0 30.4 38.0 65-69 35.7247 38.0 36.0 38.0 30.8 38.0 70-74 34.869 37.8 34.2 38.0 27.2 38.0 75-79 36.4289 38.0 38.0 38.0 34.2 38.0 80-84 36.34015000000001 38.0 38.0 38.0 34.2 38.0 85-89 36.27555 38.0 38.0 38.0 33.8 38.0 90-94 36.56485 38.0 38.0 38.0 34.6 38.0 95-99 36.598 38.0 38.0 38.0 34.8 38.0 100-104 36.6231 38.0 38.0 38.0 35.0 38.0 105-109 36.43775000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.34905 38.0 38.0 38.0 34.0 38.0 115-119 36.0944 38.0 38.0 38.0 33.6 38.0 120-124 35.33454999999999 38.0 36.6 38.0 29.8 38.0 125-129 35.3631 38.0 36.2 38.0 29.6 38.0 130-134 35.77225 38.0 37.2 38.0 32.8 38.0 135-139 35.4421 38.0 36.2 38.0 31.0 38.0 140-144 35.2735 38.0 36.0 38.0 31.0 38.0 145-149 34.89805 38.0 36.0 38.0 30.4 38.0 150-151 30.030625 35.5 28.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 2.0 5 4.0 6 0.0 7 1.0 8 2.0 9 1.0 10 1.0 11 2.0 12 2.0 13 1.0 14 0.0 15 1.0 16 1.0 17 3.0 18 4.0 19 2.0 20 5.0 21 6.0 22 7.0 23 3.0 24 12.0 25 15.0 26 24.0 27 27.0 28 24.0 29 34.0 30 53.0 31 47.0 32 89.0 33 100.0 34 162.0 35 255.0 36 718.0 37 2387.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.099999999999994 19.075 12.675 33.15 2 30.925000000000004 21.475 27.224999999999998 20.375 3 21.775 26.05 27.474999999999998 24.7 4 24.6 32.275 21.25 21.875 5 27.925 32.65 18.8 20.625 6 22.75 36.775000000000006 19.650000000000002 20.825 7 21.95 20.275000000000002 34.4 23.375 8 22.7 22.400000000000002 25.224999999999998 29.675 9 23.275000000000002 22.925 27.975 25.825 10-14 25.61 26.424999999999997 23.43 24.535 15-19 25.525 25.259999999999998 24.654999999999998 24.560000000000002 20-24 25.775 26.0 23.755000000000003 24.47 25-29 25.509999999999998 25.840000000000003 24.07 24.58 30-34 25.840000000000003 25.335 24.474999999999998 24.349999999999998 35-39 25.365 26.055 24.34 24.240000000000002 40-44 25.840000000000003 25.795 24.065 24.3 45-49 25.285000000000004 25.965 24.41 24.34 50-54 25.85 25.130000000000003 25.19 23.830000000000002 55-59 25.805 25.619999999999997 24.58 23.995 60-64 25.674999999999997 25.61 24.6 24.115000000000002 65-69 25.41 25.419999999999998 24.84 24.33 70-74 25.935000000000002 25.47 24.779999999999998 23.815 75-79 25.705 25.540000000000003 24.474999999999998 24.279999999999998 80-84 25.575 25.39 24.98 24.055 85-89 26.085 25.264999999999997 24.805 23.845 90-94 25.424999999999997 25.55 24.805 24.22 95-99 25.180000000000003 25.95 24.795 24.075 100-104 25.790000000000003 25.6 24.915000000000003 23.695 105-109 26.075 25.61 25.045 23.27 110-114 25.485000000000003 26.195 24.55 23.77 115-119 25.89 25.629999999999995 24.695 23.785 120-124 26.26 25.75 24.775 23.215 125-129 26.229999999999997 26.085 24.72 22.965 130-134 26.88 26.47 23.755000000000003 22.895 135-139 26.119999999999997 26.41 24.41 23.06 140-144 26.590000000000003 26.025 24.635 22.75 145-149 26.855 26.085 24.315 22.745 150-151 25.874999999999996 26.525 23.95 23.65 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.0 25 1.5 26 3.5 27 4.0 28 2.5 29 2.5 30 7.0 31 10.5 32 12.0 33 13.5 34 19.0 35 29.0 36 43.5 37 59.0 38 75.0 39 103.5 40 127.0 41 150.0 42 165.5 43 167.5 44 183.0 45 196.5 46 196.5 47 194.5 48 188.0 49 172.0 50 156.5 51 137.5 52 117.5 53 110.0 54 112.5 55 106.0 56 97.0 57 91.0 58 86.0 59 92.5 60 93.5 61 82.0 62 71.0 63 70.0 64 70.0 65 60.5 66 53.0 67 48.5 68 45.5 69 43.0 70 34.0 71 26.0 72 22.0 73 15.0 74 9.5 75 7.0 76 4.0 77 3.0 78 1.5 79 1.5 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06494819307557 98.0 2 0.8339651250947688 1.6500000000000001 3 0.0758150113722517 0.22499999999999998 4 0.0 0.0 5 0.025271670457417232 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.4875 0.0 0.0 0.0 0.0 120-121 1.7374999999999998 0.0 0.0 0.0 0.0 122-123 1.925 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.475 0.0 0.0 0.0 0.0 128-129 2.6625 0.0 0.0 0.0 0.0 130-131 3.0250000000000004 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.675 0.0 0.0 0.0 0.0 136-137 4.15 0.0 0.0 0.0 0.0 138-139 4.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTCTG 10 0.006830828 145.0 9 TGACGAT 10 0.006830828 145.0 145 >>END_MODULE Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962750 spots for SRR6958409.sra Written 962750 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra Read 962742 spots for SRR6958409.sra Written 962742 spots for SRR6958409.sra SRR ids: ['SRR6958409.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tzqx7xvt SRR6958409.sra spots: 19254848 blocks: [[1, 962742], [962743, 1925484], [1925485, 2888226], [2888227, 3850968], [3850969, 4813710], [4813711, 5776452], [5776453, 6739194], [6739195, 7701936], [7701937, 8664678], [8664679, 9627420], [9627421, 10590162], [10590163, 11552904], [11552905, 12515646], [12515647, 13478388], [13478389, 14441130], [14441131, 15403872], [15403873, 16366614], [16366615, 17329356], [17329357, 18292098], [18292099, 19254848]] SRR6958409 file size 6503135 SRR6958409 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958409 SRR6958409_1.fastq SRR6958409_2.fastq Input file: SRR6958409_1.fastq Paired file: SRR6958409_2.fastq trimmed: SRR6958409-trimmed-pair1.fastq, SRR6958409-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:25:26 2024 >> started Fri Dec 6 22:25:47 2024 >> done (20.131s) 19254848 read pairs processed; of these: 11388 ( 0.06%) short read pairs filtered out after trimming by size control 10456 ( 0.05%) empty read pairs filtered out after trimming by size control 19233004 (99.89%) read pairs available; of these: 7342160 (38.17%) trimmed read pairs available after processing 11890844 (61.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 4 0.00% 21 4 0.00% 22 7 0.00% 23 6 0.00% 24 4 0.00% 25 4 0.00% 26 6 0.00% 27 9 0.00% 28 4 0.00% 29 5 0.00% 30 5 0.00% 31 10 0.00% 32 5 0.00% 33 11 0.00% 34 8 0.00% 35 9 0.00% 36 3 0.00% 37 8 0.00% 38 9 0.00% 39 8 0.00% 40 9 0.00% 41 15 0.00% 42 7 0.00% 43 12 0.00% 44 8 0.00% 45 9 0.00% 46 16 0.00% 47 13 0.00% 48 13 0.00% 49 14 0.00% 50 16 0.00% 51 24 0.00% 52 34 0.00% 53 24 0.00% 54 42 0.00% 55 29 0.00% 56 37 0.00% 57 54 0.00% 58 58 0.00% 59 78 0.00% 60 61 0.00% 61 76 0.00% 62 124 0.00% 63 111 0.00% 64 111 0.00% 65 137 0.00% 66 150 0.00% 67 159 0.00% 68 192 0.00% 69 220 0.00% 70 278 0.00% 71 319 0.00% 72 348 0.00% 73 419 0.00% 74 476 0.00% 75 533 0.00% 76 550 0.00% 77 716 0.00% 78 799 0.00% 79 907 0.00% 80 1009 0.01% 81 1136 0.01% 82 1305 0.01% 83 1555 0.01% 84 2216 0.01% 85 2714 0.01% 86 2811 0.01% 87 3077 0.02% 88 3165 0.02% 89 3387 0.02% 90 3962 0.02% 91 4006 0.02% 92 4500 0.02% 93 4963 0.03% 94 5461 0.03% 95 5849 0.03% 96 6420 0.03% 97 6761 0.04% 98 7028 0.04% 99 7668 0.04% 100 8315 0.04% 101 8905 0.05% 102 9709 0.05% 103 10694 0.06% 104 11398 0.06% 105 11923 0.06% 106 12691 0.07% 107 13234 0.07% 108 13998 0.07% 109 14590 0.08% 110 15455 0.08% 111 16371 0.09% 112 17643 0.09% 113 18824 0.10% 114 20124 0.10% 115 21262 0.11% 116 21951 0.11% 117 22870 0.12% 118 23614 0.12% 119 24506 0.13% 120 25556 0.13% 121 26393 0.14% 122 28035 0.15% 123 29731 0.15% 124 31317 0.16% 125 32692 0.17% 126 34002 0.18% 127 35652 0.19% 128 36523 0.19% 129 37919 0.20% 130 38925 0.20% 131 40960 0.21% 132 43567 0.23% 133 45878 0.24% 134 48020 0.25% 135 50402 0.26% 136 53287 0.28% 137 55418 0.29% 138 58567 0.30% 139 62375 0.32% 140 65963 0.34% 141 70820 0.37% 142 77335 0.40% 143 85663 0.45% 144 96711 0.50% 145 112196 0.58% 146 137550 0.72% 147 183113 0.95% 148 278907 1.45% 149 578789 3.01% 150 4435490 23.06% 151 11890844 61.83% 19233004 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=19 prefix-density=0.94 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=26.90 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.2 sequence=ATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=15 prefix-density=0.61 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=27.75 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=4.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958409 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:26:42 Started mapping on | Dec 06 22:26:42 Finished on | Dec 06 22:28:33 Mapping speed, Million of reads per hour | 623.77 Number of input reads | 19233004 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18759484 Uniquely mapped reads % | 97.54% Average mapped length | 297.02 Number of splices: Total | 21488544 Number of splices: Annotated (sjdb) | 20216782 Number of splices: GT/AG | 21210317 Number of splices: GC/AG | 253713 Number of splices: AT/AC | 8017 Number of splices: Non-canonical | 16497 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 121981 % of reads mapped to multiple loci | 0.63% Number of reads mapped to too many loci | 16122 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.22% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 358580 358580 358580 N_multimapping 121981 121981 121981 N_noFeature 722536 18231724 878277 N_ambiguous 444970 2543 73929 UnstrandedReadsAssigned:17591978 PositiveStrandReadsAssigned:525217 NegativeStrandReadsAssigned:17807278 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958409 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958409-trimmed-pair1.fastq SRR6958409-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,233,004 reads, 17,825,201 reads pseudoaligned [quant] estimated average fragment length: 265.552 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52973 SRR6958409.ke.tsv 35125 SRR6958409.se.tsv 88098 total ==> SRR6958409.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.899 0 0 PNS24247 1044 779.448 67.9051 7.46832 PNS24249 1928 1663.45 31.7978 1.63868 PNS24246 1044 779.448 67.9051 7.46832 PNS24248 1044 779.448 67.9051 7.46832 PNS24244 1471 1206.45 33.4871 2.37945 PNS24243 293 86.3773 0 0 KQK14069 1603 1338.45 4415.38 282.797 KQK14071 474 226.068 72.4539 27.4746 ==> SRR6958409.se.tsv <== BRADI_1g14170v3 4951 BRADI_1g53295v3 303 BRADI_1g59795v3 259 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 259 BRADI_1g74790v3 74 BRADI_1g09890v3 0 BRADI_1g77505v3 229 BRADI_1g48960v3 0 SRR6958409 completed mapping pipeline successfully