Starting /dee2/code/volunteer_pipeline.sh SRR6958410 current disk space = 1548366135296 free memory = 1600931196 SRR6958410 SRAfilesize 5dd41ead8b82e336780cad44190ddfd0 SRR6958410.sra SRR6958410.sra file validated SRR6958410 is paired end SRR6958410 is conventional basespace SRR6958410 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958410_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.86925 18.0 18.0 30.0 18.0 33.0 2 24.8865 25.0 18.0 32.0 18.0 33.0 3 29.26825 30.0 27.0 33.0 25.0 33.0 4 29.679 31.0 29.0 33.0 25.0 33.0 5 30.7225 33.0 32.0 33.0 25.0 33.0 6 35.4615 37.0 36.0 38.0 29.0 38.0 7 36.1665 38.0 37.0 38.0 33.0 38.0 8 36.57275 38.0 37.0 38.0 34.0 38.0 9 37.01425 38.0 38.0 38.0 36.0 38.0 10-14 37.23525 38.0 38.0 38.0 36.2 38.0 15-19 37.1428 38.0 38.0 38.0 35.8 38.0 20-24 37.1455 38.0 38.0 38.0 36.2 38.0 25-29 37.01045 38.0 38.0 38.0 35.8 38.0 30-34 36.79395 38.0 38.0 38.0 35.0 38.0 35-39 36.8589 38.0 38.0 38.0 35.2 38.0 40-44 36.8402 38.0 38.0 38.0 35.0 38.0 45-49 36.78745 38.0 38.0 38.0 34.6 38.0 50-54 36.247350000000004 38.0 37.4 38.0 32.8 38.0 55-59 36.267999999999994 38.0 37.6 38.0 33.0 38.0 60-64 36.6129 38.0 37.6 38.0 34.2 38.0 65-69 36.60465000000001 38.0 38.0 38.0 34.2 38.0 70-74 36.1942 38.0 37.0 38.0 32.8 38.0 75-79 35.99815 38.0 37.0 38.0 31.8 38.0 80-84 35.7821 38.0 36.6 38.0 31.0 38.0 85-89 36.12645 38.0 37.0 38.0 33.0 38.0 90-94 35.8189 38.0 36.4 38.0 31.4 38.0 95-99 35.4363 38.0 35.8 38.0 29.8 38.0 100-104 34.716750000000005 38.0 35.0 38.0 26.2 38.0 105-109 34.316449999999996 38.0 34.4 38.0 24.2 38.0 110-114 34.1169 38.0 34.0 38.0 23.2 38.0 115-119 34.02355 38.0 34.0 38.0 22.8 38.0 120-124 33.681850000000004 38.0 33.6 38.0 22.2 38.0 125-129 33.92985 38.0 34.0 38.0 22.6 38.0 130-134 33.55525 37.8 33.8 38.0 21.0 38.0 135-139 32.8437 37.2 32.4 38.0 17.0 38.0 140-144 31.444399999999995 35.8 30.4 38.0 13.4 38.0 145-149 29.75895 34.8 27.2 38.0 6.4 38.0 150-151 25.491375 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 2.0 16 1.0 17 4.0 18 4.0 19 7.0 20 5.0 21 7.0 22 9.0 23 13.0 24 12.0 25 26.0 26 30.0 27 54.0 28 59.0 29 66.0 30 99.0 31 143.0 32 175.0 33 239.0 34 362.0 35 615.0 36 1127.0 37 940.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.00614480363345 12.209457654288004 5.6371894202511355 43.14720812182741 2 22.725 14.875 26.825 35.575 3 22.55 16.85 23.974999999999998 36.625 4 27.35 19.925 21.15 31.574999999999996 5 26.875 25.825 23.7 23.599999999999998 6 23.849999999999998 30.65 22.85 22.650000000000002 7 19.675 23.225 37.1 20.0 8 22.625 22.875 27.425 27.075 9 20.925 21.6 31.775 25.7 10-14 23.255 25.355 25.430000000000003 25.96 15-19 23.52 24.665 25.715 26.1 20-24 23.59 24.715 25.46 26.235000000000003 25-29 23.799999999999997 24.23 25.96 26.009999999999998 30-34 23.43 25.085 25.31 26.174999999999997 35-39 23.96 24.88 24.89 26.27 40-44 23.62 24.745 25.66 25.974999999999998 45-49 24.11 24.255 25.515 26.119999999999997 50-54 24.240000000000002 24.58 25.195 25.985000000000003 55-59 24.295 23.799999999999997 25.71 26.195 60-64 23.794999999999998 24.14 25.495 26.57 65-69 23.41 24.745 25.295 26.55 70-74 24.715 24.21 24.845 26.229999999999997 75-79 24.169999999999998 24.959999999999997 25.085 25.785000000000004 80-84 23.875 24.425 25.195 26.505000000000003 85-89 24.18 23.895 24.875 27.05 90-94 24.834999999999997 24.065 25.3 25.8 95-99 24.675 24.52 25.19 25.615 100-104 24.7 24.43 25.2 25.669999999999998 105-109 24.725 23.97 25.080000000000002 26.224999999999998 110-114 24.375 24.884999999999998 25.05 25.69 115-119 24.33 24.154999999999998 25.35 26.165 120-124 24.765 24.125 25.185000000000002 25.924999999999997 125-129 24.68 23.62 25.505 26.195 130-134 25.45 23.955000000000002 24.825 25.77 135-139 24.575 24.525 24.834999999999997 26.064999999999998 140-144 24.555 24.775 24.675 25.995 145-149 24.985 24.495 25.05 25.47 150-151 24.1875 24.212500000000002 24.85 26.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 0.0 28 0.5 29 1.0 30 2.0 31 6.0 32 9.0 33 12.5 34 18.5 35 21.0 36 28.5 37 47.5 38 68.5 39 89.5 40 113.5 41 136.0 42 159.0 43 181.5 44 192.5 45 200.5 46 213.5 47 198.5 48 179.5 49 175.0 50 158.0 51 131.5 52 121.0 53 118.5 54 110.5 55 105.5 56 96.5 57 93.5 58 94.0 59 91.0 60 89.0 61 85.0 62 82.5 63 80.5 64 74.0 65 66.5 66 63.0 67 53.5 68 42.5 69 44.0 70 36.0 71 29.0 72 21.5 73 13.5 74 12.0 75 9.0 76 9.5 77 8.0 78 3.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8872028325746 97.75 2 1.062215477996965 2.1 3 0.05058168942842691 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.2625 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.7 0.0 0.0 0.0 0.0 128-129 1.9249999999999998 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.3875 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138-139 3.2249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958410 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958410_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.22975 33.0 33.0 34.0 31.0 34.0 2 32.27875 33.0 33.0 34.0 30.0 34.0 3 32.17025 33.0 33.0 34.0 30.0 34.0 4 32.0445 33.0 33.0 34.0 30.0 34.0 5 32.05225 33.0 33.0 34.0 31.0 34.0 6 35.965 38.0 38.0 38.0 31.0 38.0 7 36.0875 38.0 38.0 38.0 32.0 38.0 8 35.88075 38.0 38.0 38.0 31.0 38.0 9 35.59025 38.0 37.0 38.0 29.0 38.0 10-14 35.9615 38.0 38.0 38.0 31.8 38.0 15-19 36.20725 38.0 38.0 38.0 33.4 38.0 20-24 36.36545 38.0 38.0 38.0 34.0 38.0 25-29 36.20235 38.0 38.0 38.0 33.6 38.0 30-34 36.253499999999995 38.0 38.0 38.0 33.8 38.0 35-39 35.9803 38.0 37.6 38.0 32.6 38.0 40-44 35.8577 38.0 37.4 38.0 32.0 38.0 45-49 35.83305 38.0 37.2 38.0 31.4 38.0 50-54 35.93795 38.0 37.6 38.0 32.6 38.0 55-59 35.98325 38.0 37.8 38.0 32.6 38.0 60-64 35.67935 38.0 37.0 38.0 30.4 38.0 65-69 35.4719 38.0 36.8 38.0 29.4 38.0 70-74 35.24405 38.0 36.2 38.0 29.0 38.0 75-79 35.245850000000004 38.0 36.4 38.0 28.4 38.0 80-84 35.15125 38.0 36.2 38.0 28.4 38.0 85-89 35.002 38.0 36.0 38.0 28.0 38.0 90-94 34.6156 38.0 35.4 38.0 25.8 38.0 95-99 34.164 38.0 34.6 38.0 22.8 38.0 100-104 33.798199999999994 38.0 34.0 38.0 21.4 38.0 105-109 33.8126 38.0 34.0 38.0 20.6 38.0 110-114 33.499849999999995 38.0 34.0 38.0 18.2 38.0 115-119 32.7783 37.2 32.0 38.0 17.0 38.0 120-124 32.52505 37.4 32.4 38.0 14.6 38.0 125-129 31.86275 36.6 31.2 38.0 14.0 38.0 130-134 31.055349999999997 36.0 29.6 38.0 13.2 38.0 135-139 30.215300000000003 35.4 27.8 38.0 13.0 38.0 140-144 29.34135 34.0 25.4 38.0 8.2 38.0 145-149 27.39825 33.2 18.6 38.0 2.0 38.0 150-151 21.140625 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 11.0 4 1.0 5 4.0 6 1.0 7 2.0 8 1.0 9 1.0 10 1.0 11 1.0 12 3.0 13 1.0 14 9.0 15 7.0 16 12.0 17 8.0 18 13.0 19 13.0 20 16.0 21 21.0 22 25.0 23 22.0 24 47.0 25 43.0 26 48.0 27 52.0 28 79.0 29 82.0 30 112.0 31 125.0 32 188.0 33 250.0 34 331.0 35 496.0 36 881.0 37 1073.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.0200100050025 18.659329664832416 11.430715357678839 29.889944972486244 2 28.849999999999998 23.724999999999998 25.624999999999996 21.8 3 23.3 26.950000000000003 26.900000000000002 22.85 4 25.7 30.475 19.425 24.4 5 26.775 32.525 19.400000000000002 21.3 6 24.099999999999998 35.15 20.424999999999997 20.325 7 24.05 20.05 31.7 24.2 8 23.599999999999998 23.525 22.3 30.575000000000003 9 23.525 23.400000000000002 26.125 26.950000000000003 10-14 26.179999999999996 25.509999999999998 22.42 25.89 15-19 25.66 24.6 24.22 25.52 20-24 25.740000000000002 25.540000000000003 23.77 24.95 25-29 25.82 25.535000000000004 23.87 24.775 30-34 25.635 25.235000000000003 23.9 25.230000000000004 35-39 26.650000000000002 24.985 23.13 25.235000000000003 40-44 26.515 25.380000000000003 23.355 24.75 45-49 25.740000000000002 25.290000000000003 23.53 25.44 50-54 26.575 25.14 23.665 24.62 55-59 27.150000000000002 24.310000000000002 23.355 25.185000000000002 60-64 26.02 24.665 23.955000000000002 25.36 65-69 26.14 25.245 23.71 24.905 70-74 27.075 23.98 24.16 24.785 75-79 25.650000000000002 24.44 24.560000000000002 25.35 80-84 26.640000000000004 25.25 23.315 24.795 85-89 26.155 24.895 23.655 25.295 90-94 26.150000000000002 24.95 23.82 25.080000000000002 95-99 26.479999999999997 24.845 23.94 24.735 100-104 26.76 24.555 24.035 24.65 105-109 26.355 24.59 24.15 24.905 110-114 26.745 25.46 23.544999999999998 24.25 115-119 26.415 24.905 23.925 24.755 120-124 27.235 25.14 23.22 24.404999999999998 125-129 26.685 25.09 24.18 24.044999999999998 130-134 26.834999999999997 24.94 23.799999999999997 24.425 135-139 27.235 24.92 24.05 23.794999999999998 140-144 27.47 24.73 24.085 23.715 145-149 26.87 25.624999999999996 24.099999999999998 23.405 150-151 27.525 25.7125 23.3375 23.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.0 27 1.0 28 1.5 29 2.0 30 1.5 31 5.0 32 7.5 33 9.0 34 14.5 35 21.0 36 26.0 37 31.0 38 53.5 39 86.5 40 112.0 41 133.0 42 150.5 43 154.0 44 166.5 45 188.5 46 183.0 47 178.5 48 176.5 49 167.5 50 157.0 51 154.5 52 145.5 53 124.0 54 111.5 55 101.5 56 99.0 57 107.0 58 108.5 59 104.5 60 102.0 61 91.5 62 90.0 63 87.0 64 69.5 65 67.5 66 68.0 67 56.5 68 53.5 69 52.0 70 43.5 71 38.5 72 32.0 73 21.0 74 12.5 75 8.5 76 6.0 77 4.0 78 4.0 79 2.5 80 1.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.55072463768117 96.89999999999999 2 1.1950165268243071 2.35 3 0.25425883549453343 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 1.1125 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.6 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 2.05 0.0 0.0 0.0 0.0 132-133 2.2125 0.0 0.0 0.0 0.0 134-135 2.4125 0.0 0.0 0.0 0.0 136-137 2.625 0.0 0.0 0.0 0.0 138-139 2.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra Read 1014071 spots for SRR6958410.sra Written 1014071 spots for SRR6958410.sra Read 1014063 spots for SRR6958410.sra Written 1014063 spots for SRR6958410.sra SRR ids: ['SRR6958410.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3elszy1k SRR6958410.sra spots: 20281268 blocks: [[1, 1014063], [1014064, 2028126], [2028127, 3042189], [3042190, 4056252], [4056253, 5070315], [5070316, 6084378], [6084379, 7098441], [7098442, 8112504], [8112505, 9126567], [9126568, 10140630], [10140631, 11154693], [11154694, 12168756], [12168757, 13182819], [13182820, 14196882], [14196883, 15210945], [15210946, 16225008], [16225009, 17239071], [17239072, 18253134], [18253135, 19267197], [19267198, 20281268]] SRR6958410 file size 6850955 SRR6958410 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958410 SRR6958410_1.fastq SRR6958410_2.fastq Input file: SRR6958410_1.fastq Paired file: SRR6958410_2.fastq trimmed: SRR6958410-trimmed-pair1.fastq, SRR6958410-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:24:33 2024 >> started Fri Dec 6 22:24:54 2024 >> done (21.385s) 20281268 read pairs processed; of these: 36961 ( 0.18%) short read pairs filtered out after trimming by size control 27420 ( 0.14%) empty read pairs filtered out after trimming by size control 20216887 (99.68%) read pairs available; of these: 8897911 (44.01%) trimmed read pairs available after processing 11318976 (55.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 1 0.00% 21 6 0.00% 22 4 0.00% 23 3 0.00% 24 6 0.00% 25 9 0.00% 26 5 0.00% 27 8 0.00% 28 7 0.00% 29 6 0.00% 30 7 0.00% 31 8 0.00% 32 11 0.00% 33 9 0.00% 34 8 0.00% 35 10 0.00% 36 13 0.00% 37 10 0.00% 38 12 0.00% 39 17 0.00% 40 12 0.00% 41 19 0.00% 42 18 0.00% 43 12 0.00% 44 28 0.00% 45 30 0.00% 46 28 0.00% 47 31 0.00% 48 33 0.00% 49 48 0.00% 50 54 0.00% 51 54 0.00% 52 71 0.00% 53 71 0.00% 54 91 0.00% 55 78 0.00% 56 88 0.00% 57 100 0.00% 58 125 0.00% 59 125 0.00% 60 135 0.00% 61 138 0.00% 62 172 0.00% 63 187 0.00% 64 215 0.00% 65 221 0.00% 66 234 0.00% 67 281 0.00% 68 313 0.00% 69 314 0.00% 70 401 0.00% 71 387 0.00% 72 415 0.00% 73 503 0.00% 74 514 0.00% 75 658 0.00% 76 684 0.00% 77 804 0.00% 78 889 0.00% 79 971 0.00% 80 1047 0.01% 81 1241 0.01% 82 1469 0.01% 83 1706 0.01% 84 3139 0.02% 85 4043 0.02% 86 4079 0.02% 87 4238 0.02% 88 4196 0.02% 89 4239 0.02% 90 4486 0.02% 91 4823 0.02% 92 5018 0.02% 93 5404 0.03% 94 5653 0.03% 95 5823 0.03% 96 6280 0.03% 97 6873 0.03% 98 6988 0.03% 99 7393 0.04% 100 7954 0.04% 101 8499 0.04% 102 9024 0.04% 103 9806 0.05% 104 10308 0.05% 105 10902 0.05% 106 12016 0.06% 107 12205 0.06% 108 13013 0.06% 109 13948 0.07% 110 14897 0.07% 111 15577 0.08% 112 16865 0.08% 113 17801 0.09% 114 19091 0.09% 115 20152 0.10% 116 21447 0.11% 117 22436 0.11% 118 23357 0.12% 119 24420 0.12% 120 25772 0.13% 121 26927 0.13% 122 28384 0.14% 123 30232 0.15% 124 32080 0.16% 125 34142 0.17% 126 35608 0.18% 127 38077 0.19% 128 39651 0.20% 129 41410 0.20% 130 44342 0.22% 131 46407 0.23% 132 49416 0.24% 133 52522 0.26% 134 56024 0.28% 135 59497 0.29% 136 64125 0.32% 137 67766 0.34% 138 72842 0.36% 139 79714 0.39% 140 85738 0.42% 141 94450 0.47% 142 105701 0.52% 143 120825 0.60% 144 142097 0.70% 145 172777 0.85% 146 218981 1.08% 147 300085 1.48% 148 462534 2.29% 149 932905 4.61% 150 4935306 24.41% 151 11318976 55.99% 20216887 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=18 prefix-density=0.92 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=40.03 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.8 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.81 fanout-score-rank=15 prefix-density=0.64 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=76.79 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.0 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR6958410 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:25:58 Started mapping on | Dec 06 22:25:59 Finished on | Dec 06 22:27:17 Mapping speed, Million of reads per hour | 933.09 Number of input reads | 20216887 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 18700924 Uniquely mapped reads % | 92.50% Average mapped length | 288.23 Number of splices: Total | 21274101 Number of splices: Annotated (sjdb) | 20077410 Number of splices: GT/AG | 20993847 Number of splices: GC/AG | 248056 Number of splices: AT/AC | 7399 Number of splices: Non-canonical | 24799 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.52 Insertion rate per base | 0.01% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 149105 % of reads mapped to multiple loci | 0.74% Number of reads mapped to too many loci | 14829 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.36% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1386248 1386248 1386248 N_multimapping 149105 149105 149105 N_noFeature 444831 18210118 563182 N_ambiguous 451951 2549 80656 UnstrandedReadsAssigned:17804142 PositiveStrandReadsAssigned:488257 NegativeStrandReadsAssigned:18057086 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=141 echo kmer=137 SRR6958410 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958410-trimmed-pair1.fastq SRR6958410-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,216,887 reads, 18,970,960 reads pseudoaligned [quant] estimated average fragment length: 251.963 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52973 SRR6958410.ke.tsv 35125 SRR6958410.se.tsv 88098 total ==> SRR6958410.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 685.382 0.452119 0.0502179 PNS24247 1044 793.037 59.9019 5.75024 PNS24249 1928 1677.04 52.7425 2.39418 PNS24246 1044 793.037 59.9019 5.75024 PNS24248 1044 793.037 59.9019 5.75024 PNS24244 1471 1220.04 23.0996 1.44136 PNS24243 293 86.777 0 0 KQK14069 1603 1352.04 5374.42 302.609 KQK14071 474 233.052 34.5359 11.2813 ==> SRR6958410.se.tsv <== BRADI_1g14170v3 5188 BRADI_1g53295v3 87 BRADI_1g59795v3 182 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 207 BRADI_1g74790v3 107 BRADI_1g09890v3 0 BRADI_1g77505v3 210 BRADI_1g48960v3 0 SRR6958410 completed mapping pipeline successfully