Starting /dee2/code/volunteer_pipeline.sh SRR6958411 current disk space = 1548360724480 free memory = 1595100264 SRR6958411 SRAfilesize 2159c4b4d2d2212b34968e7a56b45208 SRR6958411.sra SRR6958411.sra file validated SRR6958411 is paired end SRR6958411 is conventional basespace SRR6958411 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958411_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.38325 32.0 25.0 33.0 18.0 34.0 2 30.093 31.0 28.0 33.0 25.0 34.0 3 31.67375 33.0 31.0 33.0 29.0 34.0 4 32.8425 33.0 33.0 34.0 32.0 34.0 5 33.053 33.0 33.0 34.0 32.0 34.0 6 36.86125 38.0 37.0 38.0 35.0 38.0 7 37.34525 38.0 38.0 38.0 37.0 38.0 8 37.60775 38.0 38.0 38.0 38.0 38.0 9 36.63575 38.0 38.0 38.0 35.0 38.0 10-14 37.3722 38.0 38.0 38.0 36.8 38.0 15-19 37.471199999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.48235 38.0 38.0 38.0 37.4 38.0 25-29 37.32525 38.0 38.0 38.0 36.8 38.0 30-34 37.58575 38.0 38.0 38.0 38.0 38.0 35-39 37.48445 38.0 38.0 38.0 37.4 38.0 40-44 37.54755 38.0 38.0 38.0 37.8 38.0 45-49 37.482150000000004 38.0 38.0 38.0 37.8 38.0 50-54 37.2996 38.0 38.0 38.0 37.0 38.0 55-59 36.9594 38.0 38.0 38.0 35.8 38.0 60-64 36.80395 38.0 38.0 38.0 35.2 38.0 65-69 37.15435 38.0 38.0 38.0 36.2 38.0 70-74 37.059999999999995 38.0 38.0 38.0 36.0 38.0 75-79 37.1095 38.0 38.0 38.0 36.0 38.0 80-84 37.0283 38.0 38.0 38.0 35.8 38.0 85-89 36.96755 38.0 38.0 38.0 35.6 38.0 90-94 36.870799999999996 38.0 38.0 38.0 35.2 38.0 95-99 36.845099999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.64925 38.0 38.0 38.0 34.4 38.0 105-109 36.642900000000004 38.0 38.0 38.0 34.4 38.0 110-114 36.3361 38.0 37.6 38.0 34.0 38.0 115-119 36.27204999999999 38.0 37.4 38.0 34.0 38.0 120-124 36.19045 38.0 37.2 38.0 33.6 38.0 125-129 35.838100000000004 38.0 36.6 38.0 32.4 38.0 130-134 35.61595 38.0 36.0 38.0 31.2 38.0 135-139 35.61605000000001 38.0 36.0 38.0 31.4 38.0 140-144 35.21045 38.0 35.4 38.0 30.6 38.0 145-149 34.6457 38.0 35.2 38.0 27.8 38.0 150-151 30.907625000000003 35.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 3.0 18 0.0 19 6.0 20 1.0 21 2.0 22 2.0 23 5.0 24 5.0 25 2.0 26 11.0 27 19.0 28 19.0 29 19.0 30 32.0 31 37.0 32 56.0 33 102.0 34 140.0 35 289.0 36 804.0 37 2442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.35907335907336 9.935649935649936 10.038610038610038 46.666666666666664 2 19.675 13.225000000000001 37.95 29.15 3 20.305076269067268 16.129032258064516 24.55613903475869 39.00975243810953 4 22.900000000000002 23.200000000000003 23.275000000000002 30.625000000000004 5 24.925 28.499999999999996 24.5 22.075 6 21.875 33.074999999999996 24.025 21.025 7 17.075000000000003 26.525 38.75 17.65 8 19.2 24.775 31.474999999999998 24.55 9 19.7 22.875 33.625 23.799999999999997 10-14 21.445 27.68 26.82 24.055 15-19 22.075 26.484999999999996 27.139999999999997 24.3 20-24 21.67 27.189999999999998 27.22 23.919999999999998 25-29 21.32 27.435 27.175 24.07 30-34 22.3 27.060000000000002 26.755000000000003 23.885 35-39 22.275 27.229999999999997 26.345000000000002 24.15 40-44 21.535 27.345000000000002 26.810000000000002 24.310000000000002 45-49 21.654999999999998 27.12 26.775 24.45 50-54 22.23722372237224 26.687668766876687 27.217721772177217 23.857385738573857 55-59 22.0 27.37 26.5 24.13 60-64 21.821091054552728 26.706335316765838 26.991349567478373 24.48122406120306 65-69 21.89 27.16 26.735 24.215 70-74 22.145 26.615 27.015 24.224999999999998 75-79 21.985 26.51 27.275 24.23 80-84 21.52 26.700000000000003 27.055 24.725 85-89 22.0 26.47 26.784999999999997 24.745 90-94 21.9 26.985 26.055 25.06 95-99 21.95 26.685 26.790000000000003 24.575 100-104 22.561128056402822 26.94634731736587 26.906345317265863 23.58617930896545 105-109 22.516125806290315 26.776338816940846 26.681334066703332 24.026201310065503 110-114 22.790255615026762 27.047171227052175 26.481916862588168 23.6806562953329 115-119 22.290572643160793 26.76669167291823 27.016754188547136 23.925981495373843 120-124 22.015 26.575 26.790000000000003 24.62 125-129 22.732049036777582 26.099574681010758 26.815111333500123 24.353264948711534 130-134 22.73136568284142 25.887943971985994 27.073536768384194 24.307153576788394 135-139 22.165000000000003 26.47 26.795 24.57 140-144 22.35 26.63 26.75 24.27 145-149 22.12 26.815 26.534999999999997 24.529999999999998 150-151 21.85 26.1125 26.8375 25.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.5 27 2.5 28 4.0 29 6.5 30 10.0 31 14.5 32 19.5 33 26.5 34 33.0 35 44.5 36 63.0 37 77.5 38 90.0 39 111.5 40 152.5 41 190.5 42 213.5 43 226.0 44 252.0 45 268.0 46 247.5 47 240.0 48 225.5 49 203.5 50 192.5 51 158.5 52 132.5 53 116.0 54 96.0 55 87.0 56 79.5 57 68.5 58 51.0 59 41.5 60 37.5 61 37.5 62 32.0 63 28.5 64 23.5 65 15.5 66 13.0 67 13.5 68 12.0 69 10.0 70 8.5 71 4.0 72 3.0 73 1.0 74 2.5 75 3.0 76 1.5 77 1.0 78 2.0 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.875 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.01 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.005 110-114 0.045 115-119 0.025 120-124 0.0 125-129 0.075 130-134 0.05 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.528169014084507 1.05 3 0.0 0.0 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.1375 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.7625 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.0999999999999996 0.0 0.0 0.0 0.0 132-133 2.375 0.0 0.0 0.0 0.0 134-135 2.5375 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138-139 3.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATCTGT 10 0.006577216 146.82278 1 >>END_MODULE SRR6958411 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958411_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.243 34.0 33.0 34.0 33.0 34.0 2 33.3535 34.0 33.0 34.0 33.0 34.0 3 33.39125 34.0 33.0 34.0 33.0 34.0 4 33.37325 34.0 33.0 34.0 33.0 34.0 5 33.4305 34.0 33.0 34.0 33.0 34.0 6 37.528 38.0 38.0 38.0 38.0 38.0 7 37.60075 38.0 38.0 38.0 38.0 38.0 8 37.648 38.0 38.0 38.0 38.0 38.0 9 34.55525 38.0 36.0 38.0 16.0 38.0 10-14 37.341950000000004 38.0 37.8 38.0 36.6 38.0 15-19 36.303399999999996 38.0 37.2 38.0 31.8 38.0 20-24 37.552949999999996 38.0 38.0 38.0 37.8 38.0 25-29 37.58284999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.6051 38.0 38.0 38.0 38.0 38.0 35-39 37.62575 38.0 38.0 38.0 38.0 38.0 40-44 37.60065 38.0 38.0 38.0 38.0 38.0 45-49 37.57405 38.0 38.0 38.0 38.0 38.0 50-54 36.69815 38.0 38.0 38.0 33.6 38.0 55-59 37.4973 38.0 38.0 38.0 37.8 38.0 60-64 37.547549999999994 38.0 38.0 38.0 38.0 38.0 65-69 37.54 38.0 38.0 38.0 38.0 38.0 70-74 37.464 38.0 38.0 38.0 38.0 38.0 75-79 37.39885 38.0 38.0 38.0 37.2 38.0 80-84 37.4231 38.0 38.0 38.0 38.0 38.0 85-89 37.39265 38.0 38.0 38.0 37.6 38.0 90-94 37.34935 38.0 38.0 38.0 37.2 38.0 95-99 37.2919 38.0 38.0 38.0 37.2 38.0 100-104 35.9108 38.0 36.4 38.0 30.4 38.0 105-109 36.9692 38.0 38.0 38.0 35.8 38.0 110-114 34.429 37.8 33.6 38.0 25.0 38.0 115-119 36.794349999999994 38.0 38.0 38.0 35.2 38.0 120-124 35.489399999999996 38.0 36.2 38.0 29.0 38.0 125-129 36.66405 38.0 38.0 38.0 35.0 38.0 130-134 33.448800000000006 37.6 31.8 38.0 21.8 38.0 135-139 34.91955 38.0 35.2 38.0 26.4 38.0 140-144 35.44154999999999 38.0 36.4 38.0 31.0 38.0 145-149 35.4525 38.0 37.6 38.0 31.2 38.0 150-151 32.0925 36.0 33.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 3.0 17 0.0 18 1.0 19 3.0 20 3.0 21 4.0 22 1.0 23 4.0 24 9.0 25 4.0 26 8.0 27 18.0 28 17.0 29 17.0 30 23.0 31 30.0 32 52.0 33 68.0 34 111.0 35 249.0 36 872.0 37 2500.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.2 18.325 15.6 35.875 2 28.449999999999996 24.474999999999998 29.299999999999997 17.775 3 21.15 27.775 27.700000000000003 23.375 4 24.725 30.099999999999998 23.575 21.6 5 27.0 34.4 20.375 18.224999999999998 6 22.275 36.825 22.2 18.7 7 21.875 20.974999999999998 37.05 20.1 8 22.75 24.55 27.05 25.650000000000002 9 23.575 24.525 28.9 23.0 10-14 24.695 28.084999999999997 24.25 22.97 15-19 24.215 26.645000000000003 26.565 22.575 20-24 24.9 26.855 25.990000000000002 22.255 25-29 24.675 26.825 25.8 22.7 30-34 24.145 27.26 26.13 22.465 35-39 24.535 27.165 25.965 22.335 40-44 24.535 26.590000000000003 25.974999999999998 22.900000000000002 45-49 24.610000000000003 27.3 25.595000000000002 22.495 50-54 24.455 26.705000000000002 26.145000000000003 22.695 55-59 24.759999999999998 26.334999999999997 26.505000000000003 22.400000000000002 60-64 24.5 27.165 26.119999999999997 22.215 65-69 24.435000000000002 26.740000000000002 25.805 23.02 70-74 24.985 26.724999999999998 25.974999999999998 22.314999999999998 75-79 23.93 26.805 26.465 22.8 80-84 24.325 26.39 26.784999999999997 22.5 85-89 24.645 26.240000000000002 26.784999999999997 22.33 90-94 24.560000000000002 26.555 26.57 22.314999999999998 95-99 24.26 27.445000000000004 26.31 21.985 100-104 25.124999999999996 26.775 26.025 22.075 105-109 24.135 27.3 25.979999999999997 22.585 110-114 24.740000000000002 27.169999999999998 26.275 21.815 115-119 24.905 26.855 26.400000000000002 21.84 120-124 24.375 27.245 26.419999999999998 21.959999999999997 125-129 24.75 27.26 25.85 22.14 130-134 25.074999999999996 27.27 25.53 22.125 135-139 24.735 26.99 26.085 22.189999999999998 140-144 24.93 27.389999999999997 26.36 21.32 145-149 25.16 27.6 26.06 21.18 150-151 25.124999999999996 27.150000000000002 26.525 21.2 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 0.5 26 1.0 27 3.5 28 7.5 29 9.5 30 12.0 31 18.0 32 17.0 33 18.0 34 26.5 35 42.0 36 55.5 37 68.5 38 93.0 39 125.5 40 158.0 41 186.0 42 221.0 43 237.5 44 230.5 45 242.5 46 240.0 47 224.0 48 212.5 49 188.0 50 166.0 51 148.0 52 128.5 53 114.0 54 98.0 55 78.0 56 74.5 57 74.5 58 66.0 59 62.0 60 55.0 61 40.0 62 33.0 63 34.5 64 41.5 65 34.0 66 20.0 67 19.0 68 17.5 69 12.0 70 11.5 71 11.0 72 7.0 73 4.5 74 3.5 75 3.5 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0125 0.0 0.0 0.0 0.0 122-123 1.175 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.8375 0.0 0.0 0.0 0.0 132-133 2.0625 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.5250000000000004 0.0 0.0 0.0 0.0 138-139 2.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACCTGG 10 0.006830828 145.0 1 ATCAAAC 10 0.006830828 145.0 6 >>END_MODULE Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653644 spots for SRR6958411.sra Written 653644 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra Read 653625 spots for SRR6958411.sra Written 653625 spots for SRR6958411.sra SRR ids: ['SRR6958411.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7jy6_8we SRR6958411.sra spots: 13072519 blocks: [[1, 653625], [653626, 1307250], [1307251, 1960875], [1960876, 2614500], [2614501, 3268125], [3268126, 3921750], [3921751, 4575375], [4575376, 5229000], [5229001, 5882625], [5882626, 6536250], [6536251, 7189875], [7189876, 7843500], [7843501, 8497125], [8497126, 9150750], [9150751, 9804375], [9804376, 10458000], [10458001, 11111625], [11111626, 11765250], [11765251, 12418875], [12418876, 13072519]] SRR6958411 file size 4408147 SRR6958411 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958411 SRR6958411_1.fastq SRR6958411_2.fastq Input file: SRR6958411_1.fastq Paired file: SRR6958411_2.fastq trimmed: SRR6958411-trimmed-pair1.fastq, SRR6958411-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:23:07 2024 >> started Fri Dec 6 22:23:21 2024 >> done (14.751s) 13072519 read pairs processed; of these: 4104 ( 0.03%) short read pairs filtered out after trimming by size control 4841 ( 0.04%) empty read pairs filtered out after trimming by size control 13063574 (99.93%) read pairs available; of these: 5299163 (40.56%) trimmed read pairs available after processing 7764411 (59.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 2 0.00% 24 3 0.00% 25 2 0.00% 26 4 0.00% 27 1 0.00% 28 2 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 3 0.00% 33 4 0.00% 34 3 0.00% 35 1 0.00% 36 4 0.00% 37 2 0.00% 38 2 0.00% 39 3 0.00% 40 4 0.00% 41 3 0.00% 42 5 0.00% 43 6 0.00% 44 10 0.00% 45 8 0.00% 46 1 0.00% 47 8 0.00% 48 9 0.00% 49 12 0.00% 50 14 0.00% 51 9 0.00% 52 15 0.00% 53 16 0.00% 54 13 0.00% 55 17 0.00% 56 23 0.00% 57 27 0.00% 58 31 0.00% 59 33 0.00% 60 36 0.00% 61 38 0.00% 62 33 0.00% 63 34 0.00% 64 51 0.00% 65 61 0.00% 66 75 0.00% 67 55 0.00% 68 78 0.00% 69 85 0.00% 70 111 0.00% 71 112 0.00% 72 133 0.00% 73 177 0.00% 74 180 0.00% 75 218 0.00% 76 249 0.00% 77 299 0.00% 78 282 0.00% 79 305 0.00% 80 393 0.00% 81 410 0.00% 82 471 0.00% 83 597 0.00% 84 789 0.01% 85 987 0.01% 86 1068 0.01% 87 1126 0.01% 88 1233 0.01% 89 1322 0.01% 90 1430 0.01% 91 1587 0.01% 92 1750 0.01% 93 1867 0.01% 94 2060 0.02% 95 2345 0.02% 96 2346 0.02% 97 2683 0.02% 98 2946 0.02% 99 3667 0.03% 100 3768 0.03% 101 4395 0.03% 102 3851 0.03% 103 4049 0.03% 104 4321 0.03% 105 4530 0.03% 106 5137 0.04% 107 5494 0.04% 108 5787 0.04% 109 6180 0.05% 110 6427 0.05% 111 6819 0.05% 112 7113 0.05% 113 7679 0.06% 114 8277 0.06% 115 8883 0.07% 116 9490 0.07% 117 9783 0.07% 118 10405 0.08% 119 10859 0.08% 120 11298 0.09% 121 11979 0.09% 122 12782 0.10% 123 13599 0.10% 124 14369 0.11% 125 15090 0.12% 126 15931 0.12% 127 16883 0.13% 128 17876 0.14% 129 19017 0.15% 130 20700 0.16% 131 21773 0.17% 132 23178 0.18% 133 24788 0.19% 134 26822 0.21% 135 29061 0.22% 136 31275 0.24% 137 33579 0.26% 138 35839 0.27% 139 39280 0.30% 140 43137 0.33% 141 47939 0.37% 142 54666 0.42% 143 62621 0.48% 144 73934 0.57% 145 91843 0.70% 146 118817 0.91% 147 167874 1.29% 148 271664 2.08% 149 566445 4.34% 150 3197857 24.48% 151 7764411 59.44% 13063574 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=24 prefix-density=0.82 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=56.00 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.5 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=20 prefix-density=0.58 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=75.54 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.2 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958411 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:24:00 Started mapping on | Dec 06 22:24:00 Finished on | Dec 06 22:25:03 Mapping speed, Million of reads per hour | 746.49 Number of input reads | 13063574 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12923695 Uniquely mapped reads % | 98.93% Average mapped length | 298.07 Number of splices: Total | 15533675 Number of splices: Annotated (sjdb) | 14626368 Number of splices: GT/AG | 15335642 Number of splices: GC/AG | 181764 Number of splices: AT/AC | 6112 Number of splices: Non-canonical | 10157 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 79907 % of reads mapped to multiple loci | 0.61% Number of reads mapped to too many loci | 5615 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.13% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 62591 62591 62591 N_multimapping 79907 79907 79907 N_noFeature 485238 12554482 599667 N_ambiguous 303627 1683 49432 UnstrandedReadsAssigned:12134830 PositiveStrandReadsAssigned:367530 NegativeStrandReadsAssigned:12274596 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958411 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958411-trimmed-pair1.fastq SRR6958411-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,063,574 reads, 12,291,530 reads pseudoaligned [quant] estimated average fragment length: 245.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52973 SRR6958411.ke.tsv 35125 SRR6958411.se.tsv 88098 total ==> SRR6958411.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.791 0 0 PNS24247 1044 799.525 35.8231 5.78182 PNS24249 1928 1683.53 22.4251 1.71889 PNS24246 1044 799.525 35.8231 5.78182 PNS24248 1044 799.525 35.8231 5.78182 PNS24244 1471 1226.53 22.1056 2.32573 PNS24243 293 80.831 0 0 KQK14069 1603 1358.53 3397 322.672 KQK14071 474 233.945 55.037 30.3581 ==> SRR6958411.se.tsv <== BRADI_1g14170v3 3895 BRADI_1g53295v3 179 BRADI_1g59795v3 188 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 142 BRADI_1g74790v3 60 BRADI_1g09890v3 0 BRADI_1g77505v3 162 BRADI_1g48960v3 0 SRR6958411 completed mapping pipeline successfully