Starting /dee2/code/volunteer_pipeline.sh SRR6958412 current disk space = 1548547911680 free memory = 1602784100 SRR6958412 SRAfilesize fe50c827422be9236dc464f65b8e613f SRR6958412.sra SRR6958412.sra file validated SRR6958412 is paired end SRR6958412 is conventional basespace SRR6958412 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958412_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.13275 31.0 18.0 33.0 18.0 34.0 2 29.668 31.0 27.0 33.0 25.0 33.0 3 31.47825 33.0 31.0 33.0 27.0 33.0 4 32.746 33.0 33.0 33.0 32.0 34.0 5 33.16625 33.0 33.0 34.0 33.0 34.0 6 36.89575 38.0 37.0 38.0 36.0 38.0 7 37.405 38.0 38.0 38.0 37.0 38.0 8 37.5645 38.0 38.0 38.0 37.0 38.0 9 36.6875 38.0 38.0 38.0 35.0 38.0 10-14 37.3777 38.0 38.0 38.0 37.0 38.0 15-19 37.4496 38.0 38.0 38.0 37.2 38.0 20-24 37.4556 38.0 38.0 38.0 37.2 38.0 25-29 37.31885 38.0 38.0 38.0 37.2 38.0 30-34 37.60485 38.0 38.0 38.0 38.0 38.0 35-39 37.50565 38.0 38.0 38.0 37.6 38.0 40-44 37.591899999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.512950000000004 38.0 38.0 38.0 37.8 38.0 50-54 37.4096 38.0 38.0 38.0 37.2 38.0 55-59 37.07555 38.0 38.0 38.0 36.0 38.0 60-64 36.9423 38.0 38.0 38.0 35.4 38.0 65-69 37.253750000000004 38.0 38.0 38.0 36.2 38.0 70-74 37.138149999999996 38.0 38.0 38.0 36.0 38.0 75-79 37.2433 38.0 38.0 38.0 36.4 38.0 80-84 37.118399999999994 38.0 38.0 38.0 36.0 38.0 85-89 37.018950000000004 38.0 38.0 38.0 35.8 38.0 90-94 37.0587 38.0 38.0 38.0 35.6 38.0 95-99 36.93555 38.0 38.0 38.0 35.4 38.0 100-104 36.719500000000004 38.0 38.0 38.0 34.6 38.0 105-109 36.7147 38.0 38.0 38.0 34.6 38.0 110-114 36.4182 38.0 37.6 38.0 33.8 38.0 115-119 36.3643 38.0 37.4 38.0 34.0 38.0 120-124 36.268600000000006 38.0 37.8 38.0 34.0 38.0 125-129 36.00005 38.0 37.0 38.0 33.0 38.0 130-134 35.82535 38.0 36.2 38.0 32.6 38.0 135-139 35.760450000000006 38.0 36.2 38.0 32.2 38.0 140-144 35.2063 38.0 35.2 38.0 30.2 38.0 145-149 34.661649999999995 38.0 35.0 38.0 28.4 38.0 150-151 31.13675 35.5 30.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 6.0 22 7.0 23 2.0 24 4.0 25 8.0 26 6.0 27 6.0 28 16.0 29 17.0 30 32.0 31 42.0 32 57.0 33 89.0 34 163.0 35 318.0 36 761.0 37 2462.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.83204533745492 10.407006697578568 9.5311695002576 44.229778464708914 2 21.45 13.675 38.074999999999996 26.8 3 19.575 15.5 26.275 38.65 4 24.25 24.725 21.025 30.0 5 25.95 28.025 24.05 21.975 6 21.65 33.675 23.225 21.45 7 16.975 26.525 38.45 18.05 8 20.75 24.75 29.799999999999997 24.7 9 18.9 23.599999999999998 34.525 22.975 10-14 22.175 27.455000000000002 26.924999999999997 23.445 15-19 21.93 26.965 26.76 24.345 20-24 22.485 26.369999999999997 27.095000000000002 24.05 25-29 21.985 26.650000000000002 27.21 24.154999999999998 30-34 21.584999999999997 27.265 26.555 24.595 35-39 21.815 27.155 26.695 24.335 40-44 21.990000000000002 26.645000000000003 27.13 24.235 45-49 21.875 26.55 26.82 24.755 50-54 22.333350002500374 26.79401910286543 26.268940341051156 24.60369055358304 55-59 22.32111605580279 27.2013600680034 26.446322316115804 24.031201560078003 60-64 22.15110755537777 26.526326316315817 26.426321316065803 24.89624481224061 65-69 22.564999999999998 26.669999999999998 26.810000000000002 23.955000000000002 70-74 22.08 26.889999999999997 26.939999999999998 24.09 75-79 22.145 26.729999999999997 26.534999999999997 24.59 80-84 22.485 26.365 26.805 24.345 85-89 22.345000000000002 26.540000000000003 26.215 24.9 90-94 21.7 26.72 26.68 24.9 95-99 22.365 27.034999999999997 25.885 24.715 100-104 22.86114305715286 26.236311815590778 26.93134656732837 23.971198559928 105-109 22.276113805690283 27.2163608180409 26.151307565378268 24.356217810890545 110-114 21.98209014958227 27.154935214367903 26.629646305468007 24.23332833058182 115-119 22.70181054316295 26.93808142442733 26.738021406421925 23.622086625987794 120-124 22.68 26.235000000000003 26.724999999999998 24.36 125-129 22.755030533586947 26.37901691861047 26.664330763840223 24.20162178396236 130-134 22.637450597828806 26.259442693481418 26.13937665716144 24.96373005152834 135-139 22.220000000000002 26.32 26.529999999999998 24.93 140-144 22.8 25.36 27.175 24.665 145-149 22.365 26.46 26.834999999999997 24.34 150-151 22.325 25.687500000000004 26.375 25.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 1.5 28 2.5 29 6.0 30 9.5 31 11.5 32 21.0 33 26.0 34 26.5 35 50.0 36 72.5 37 75.0 38 89.0 39 113.5 40 146.0 41 194.5 42 227.0 43 244.0 44 241.5 45 235.0 46 244.0 47 237.0 48 213.0 49 180.5 50 164.5 51 154.5 52 132.0 53 117.5 54 105.5 55 86.5 56 75.0 57 71.0 58 61.5 59 53.5 60 46.5 61 39.5 62 34.5 63 31.5 64 30.5 65 27.0 66 22.5 67 20.5 68 16.5 69 10.0 70 5.5 71 6.5 72 6.0 73 3.5 74 3.5 75 3.0 76 1.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.015 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.005 110-114 0.055 115-119 0.03 120-124 0.0 125-129 0.11 130-134 0.055 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.55 0.0 0.0 0.0 0.0 124-125 1.9249999999999998 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.35 0.0 0.0 0.0 0.0 130-131 2.5250000000000004 0.0 0.0 0.0 0.0 132-133 2.7375 0.0 0.0 0.0 0.0 134-135 2.9124999999999996 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138-139 3.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 50 0.0013414092 17.3775 55-59 >>END_MODULE SRR6958412 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958412_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.23275 33.0 33.0 34.0 33.0 34.0 2 33.33875 34.0 33.0 34.0 33.0 34.0 3 33.327 34.0 33.0 34.0 33.0 34.0 4 33.27425 34.0 33.0 34.0 33.0 34.0 5 33.37225 34.0 33.0 34.0 33.0 34.0 6 37.54575 38.0 38.0 38.0 38.0 38.0 7 37.6145 38.0 38.0 38.0 38.0 38.0 8 37.564 38.0 38.0 38.0 38.0 38.0 9 34.59475 38.0 36.0 38.0 16.0 38.0 10-14 37.27864999999999 38.0 37.8 38.0 36.4 38.0 15-19 36.33540000000001 38.0 37.6 38.0 31.8 38.0 20-24 37.44475 38.0 38.0 38.0 37.8 38.0 25-29 37.520799999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.552200000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.548700000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.51935000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.5024 38.0 38.0 38.0 38.0 38.0 50-54 36.74295 38.0 38.0 38.0 34.4 38.0 55-59 37.392900000000004 38.0 38.0 38.0 37.6 38.0 60-64 37.4279 38.0 38.0 38.0 38.0 38.0 65-69 37.40075 38.0 38.0 38.0 38.0 38.0 70-74 37.4331 38.0 38.0 38.0 38.0 38.0 75-79 37.32475 38.0 38.0 38.0 37.2 38.0 80-84 37.33375 38.0 38.0 38.0 37.0 38.0 85-89 37.31965 38.0 38.0 38.0 37.0 38.0 90-94 37.24785 38.0 38.0 38.0 37.2 38.0 95-99 37.19515 38.0 38.0 38.0 37.0 38.0 100-104 35.74945 38.0 36.0 38.0 30.2 38.0 105-109 36.8752 38.0 38.0 38.0 35.4 38.0 110-114 34.4374 37.8 33.6 38.0 25.0 38.0 115-119 36.73135 38.0 38.0 38.0 34.8 38.0 120-124 35.48535 38.0 36.2 38.0 29.0 38.0 125-129 36.6339 38.0 38.0 38.0 34.6 38.0 130-134 33.6017 37.6 32.4 38.0 21.8 38.0 135-139 34.91890000000001 38.0 35.4 38.0 25.8 38.0 140-144 35.37955 38.0 36.8 38.0 30.8 38.0 145-149 35.258599999999994 38.0 37.4 38.0 31.0 38.0 150-151 31.904875 36.0 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 3.0 19 1.0 20 2.0 21 5.0 22 1.0 23 3.0 24 9.0 25 10.0 26 13.0 27 13.0 28 21.0 29 16.0 30 37.0 31 36.0 32 48.0 33 83.0 34 132.0 35 229.0 36 793.0 37 2537.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.525 19.025 13.0 35.449999999999996 2 27.450000000000003 24.224999999999998 30.075000000000003 18.25 3 20.7 26.650000000000002 29.475 23.175 4 25.025 30.675 22.2 22.1 5 28.349999999999998 31.900000000000002 21.224999999999998 18.525 6 22.425 37.7 21.349999999999998 18.525 7 20.724999999999998 21.099999999999998 35.65 22.525000000000002 8 23.400000000000002 23.65 27.0 25.95 9 22.925 23.625 29.799999999999997 23.65 10-14 25.040000000000003 26.895000000000003 24.92 23.145 15-19 24.955 26.5 26.284999999999997 22.259999999999998 20-24 25.165 26.58 25.355 22.900000000000002 25-29 24.87 26.71 25.924999999999997 22.495 30-34 24.945 26.740000000000002 25.264999999999997 23.05 35-39 24.54 26.729999999999997 25.47 23.26 40-44 24.715 26.77 25.255 23.26 45-49 24.88 26.445 25.779999999999998 22.895 50-54 25.095 27.54 24.455 22.91 55-59 24.735 26.384999999999998 26.14 22.74 60-64 24.58 27.025 25.94 22.455 65-69 24.83 26.195 26.015 22.96 70-74 25.180000000000003 26.625 25.974999999999998 22.220000000000002 75-79 24.805 26.125 26.229999999999997 22.84 80-84 24.945 26.545 25.835 22.675 85-89 25.365 26.640000000000004 25.83 22.165000000000003 90-94 24.57 27.275 25.86 22.295 95-99 24.315 26.945000000000004 26.224999999999998 22.515 100-104 24.805 26.200000000000003 26.400000000000002 22.595000000000002 105-109 24.195 26.534999999999997 26.700000000000003 22.57 110-114 25.115 26.884999999999998 25.81 22.189999999999998 115-119 25.040000000000003 26.640000000000004 26.279999999999998 22.040000000000003 120-124 24.79 26.87 26.07 22.27 125-129 25.185000000000002 26.935 25.919999999999998 21.959999999999997 130-134 25.380000000000003 27.305 25.509999999999998 21.805 135-139 24.654999999999998 27.01 26.540000000000003 21.795 140-144 25.069999999999997 27.33 25.86 21.740000000000002 145-149 26.179999999999996 27.334999999999997 25.185000000000002 21.3 150-151 25.1 26.55 26.987499999999997 21.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 0.5 26 0.5 27 2.0 28 2.5 29 4.0 30 8.5 31 11.5 32 15.5 33 22.5 34 25.5 35 33.0 36 55.5 37 74.0 38 94.5 39 116.0 40 148.0 41 165.5 42 190.5 43 221.0 44 225.0 45 240.0 46 230.0 47 198.0 48 201.0 49 206.5 50 195.5 51 164.0 52 135.5 53 123.0 54 104.0 55 92.0 56 73.0 57 74.5 58 73.0 59 62.5 60 64.5 61 58.0 62 50.5 63 45.5 64 37.0 65 29.0 66 24.5 67 19.5 68 19.0 69 16.5 70 11.5 71 11.0 72 8.5 73 5.0 74 2.0 75 1.5 76 3.0 77 2.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62321024868123 99.15 2 0.30143180105501133 0.6 3 0.050238633509168545 0.15 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.7625 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.075 0.0 0.0 0.0 0.0 130-131 2.2249999999999996 0.0 0.0 0.0 0.0 132-133 2.3875 0.0 0.0 0.0 0.0 134-135 2.5125 0.0 0.0 0.0 0.0 136-137 2.8 0.0 0.0 0.0 0.0 138-139 3.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615966 spots for SRR6958412.sra Written 615966 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra Read 615965 spots for SRR6958412.sra Written 615965 spots for SRR6958412.sra SRR ids: ['SRR6958412.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4n17okmq SRR6958412.sra spots: 12319301 blocks: [[1, 615965], [615966, 1231930], [1231931, 1847895], [1847896, 2463860], [2463861, 3079825], [3079826, 3695790], [3695791, 4311755], [4311756, 4927720], [4927721, 5543685], [5543686, 6159650], [6159651, 6775615], [6775616, 7391580], [7391581, 8007545], [8007546, 8623510], [8623511, 9239475], [9239476, 9855440], [9855441, 10471405], [10471406, 11087370], [11087371, 11703335], [11703336, 12319301]] SRR6958412 file size 4152906 SRR6958412 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958412 SRR6958412_1.fastq SRR6958412_2.fastq Input file: SRR6958412_1.fastq Paired file: SRR6958412_2.fastq trimmed: SRR6958412-trimmed-pair1.fastq, SRR6958412-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:27:36 2024 >> started Fri Dec 6 22:27:49 2024 >> done (12.371s) 12319301 read pairs processed; of these: 3338 ( 0.03%) short read pairs filtered out after trimming by size control 2506 ( 0.02%) empty read pairs filtered out after trimming by size control 12313457 (99.95%) read pairs available; of these: 5048234 (41.00%) trimmed read pairs available after processing 7265223 (59.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 4 0.00% 25 0 0.00% 26 2 0.00% 27 1 0.00% 28 3 0.00% 29 4 0.00% 30 2 0.00% 31 3 0.00% 32 3 0.00% 33 4 0.00% 34 2 0.00% 35 3 0.00% 36 2 0.00% 37 3 0.00% 38 6 0.00% 39 8 0.00% 40 6 0.00% 41 9 0.00% 42 6 0.00% 43 4 0.00% 44 6 0.00% 45 6 0.00% 46 6 0.00% 47 10 0.00% 48 11 0.00% 49 8 0.00% 50 9 0.00% 51 7 0.00% 52 13 0.00% 53 9 0.00% 54 13 0.00% 55 23 0.00% 56 25 0.00% 57 16 0.00% 58 32 0.00% 59 38 0.00% 60 30 0.00% 61 47 0.00% 62 46 0.00% 63 55 0.00% 64 62 0.00% 65 63 0.00% 66 58 0.00% 67 94 0.00% 68 102 0.00% 69 109 0.00% 70 134 0.00% 71 140 0.00% 72 188 0.00% 73 168 0.00% 74 197 0.00% 75 251 0.00% 76 258 0.00% 77 288 0.00% 78 326 0.00% 79 404 0.00% 80 418 0.00% 81 529 0.00% 82 559 0.00% 83 667 0.01% 84 794 0.01% 85 975 0.01% 86 1064 0.01% 87 1144 0.01% 88 1365 0.01% 89 1443 0.01% 90 1552 0.01% 91 1701 0.01% 92 1895 0.02% 93 1993 0.02% 94 2313 0.02% 95 2493 0.02% 96 2618 0.02% 97 2952 0.02% 98 3281 0.03% 99 3833 0.03% 100 4062 0.03% 101 4576 0.04% 102 4121 0.03% 103 4483 0.04% 104 4717 0.04% 105 4991 0.04% 106 5380 0.04% 107 6043 0.05% 108 6291 0.05% 109 6674 0.05% 110 7122 0.06% 111 7626 0.06% 112 7802 0.06% 113 8255 0.07% 114 9026 0.07% 115 9495 0.08% 116 10220 0.08% 117 10462 0.08% 118 11110 0.09% 119 11612 0.09% 120 12083 0.10% 121 13122 0.11% 122 13792 0.11% 123 14336 0.12% 124 15492 0.13% 125 16130 0.13% 126 16761 0.14% 127 17648 0.14% 128 18784 0.15% 129 19905 0.16% 130 21158 0.17% 131 22609 0.18% 132 23692 0.19% 133 25631 0.21% 134 27402 0.22% 135 29397 0.24% 136 31952 0.26% 137 33891 0.28% 138 35868 0.29% 139 39545 0.32% 140 43212 0.35% 141 48236 0.39% 142 54153 0.44% 143 61287 0.50% 144 72244 0.59% 145 88287 0.72% 146 114085 0.93% 147 160007 1.30% 148 255334 2.07% 149 529331 4.30% 150 2991865 24.30% 151 7265223 59.00% 12313457 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=26 prefix-density=0.80 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=69.95 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.2 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=22 prefix-density=0.55 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=67.43 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.0 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR6958412 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:28:28 Started mapping on | Dec 06 22:28:28 Finished on | Dec 06 22:29:18 Mapping speed, Million of reads per hour | 886.57 Number of input reads | 12313457 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12162382 Uniquely mapped reads % | 98.77% Average mapped length | 297.75 Number of splices: Total | 14480091 Number of splices: Annotated (sjdb) | 13641743 Number of splices: GT/AG | 14298060 Number of splices: GC/AG | 166716 Number of splices: AT/AC | 5611 Number of splices: Non-canonical | 9704 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 79898 % of reads mapped to multiple loci | 0.65% Number of reads mapped to too many loci | 6497 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.19% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 73512 73512 73512 N_multimapping 79898 79898 79898 N_noFeature 431315 11823845 528644 N_ambiguous 286548 1444 46331 UnstrandedReadsAssigned:11444519 PositiveStrandReadsAssigned:337093 NegativeStrandReadsAssigned:11587407 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958412 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958412-trimmed-pair1.fastq SRR6958412-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,313,457 reads, 11,606,161 reads pseudoaligned [quant] estimated average fragment length: 243.213 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52973 SRR6958412.ke.tsv 35125 SRR6958412.se.tsv 88098 total ==> SRR6958412.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.308 0 0 PNS24247 1044 801.787 38.2495 6.38781 PNS24249 1928 1685.79 17.9012 1.42188 PNS24246 1044 801.787 38.2495 6.38781 PNS24248 1044 801.787 38.2495 6.38781 PNS24244 1471 1228.79 25.3505 2.76246 PNS24243 293 82.6732 0 0 KQK14069 1603 1360.79 3339.69 328.626 KQK14071 474 236.338 47.7884 27.0754 ==> SRR6958412.se.tsv <== BRADI_1g14170v3 3791 BRADI_1g53295v3 159 BRADI_1g59795v3 107 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 136 BRADI_1g74790v3 51 BRADI_1g09890v3 0 BRADI_1g77505v3 143 BRADI_1g48960v3 0 SRR6958412 completed mapping pipeline successfully