Starting /dee2/code/volunteer_pipeline.sh SRR6958414 current disk space = 1548556955648 free memory = 1597492620 SRR6958414 SRAfilesize 9c0ce14cba9e096eb0447af4d6439949 SRR6958414.sra SRR6958414.sra file validated SRR6958414 is paired end SRR6958414 is conventional basespace SRR6958414 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958414_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.63425 31.0 18.0 33.0 18.0 34.0 2 30.723 31.0 28.0 33.0 27.0 34.0 3 31.96 33.0 31.0 33.0 29.0 34.0 4 32.33375 33.0 33.0 33.0 31.0 34.0 5 32.425 33.0 33.0 33.0 31.0 34.0 6 36.35425 38.0 36.0 38.0 34.0 38.0 7 37.10375 38.0 38.0 38.0 36.0 38.0 8 37.39125 38.0 38.0 38.0 37.0 38.0 9 37.5235 38.0 38.0 38.0 37.0 38.0 10-14 37.5434 38.0 38.0 38.0 37.6 38.0 15-19 37.569050000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.5753 38.0 38.0 38.0 37.8 38.0 25-29 37.376 38.0 38.0 38.0 37.4 38.0 30-34 37.62480000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.5707 38.0 38.0 38.0 38.0 38.0 40-44 37.3445 38.0 38.0 38.0 37.2 38.0 45-49 37.440250000000006 38.0 38.0 38.0 37.6 38.0 50-54 37.36395 38.0 38.0 38.0 37.0 38.0 55-59 37.24915 38.0 38.0 38.0 36.8 38.0 60-64 37.344550000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.2897 38.0 38.0 38.0 37.0 38.0 70-74 37.0462 38.0 38.0 38.0 35.8 38.0 75-79 37.204449999999994 38.0 38.0 38.0 36.0 38.0 80-84 37.105599999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.999900000000004 38.0 38.0 38.0 35.8 38.0 90-94 36.872299999999996 38.0 38.0 38.0 35.4 38.0 95-99 36.83355 38.0 38.0 38.0 35.0 38.0 100-104 36.672250000000005 38.0 38.0 38.0 34.6 38.0 105-109 36.50485 38.0 38.0 38.0 34.0 38.0 110-114 36.3257 38.0 38.0 38.0 34.0 38.0 115-119 36.12820000000001 38.0 37.0 38.0 33.0 38.0 120-124 36.078700000000005 38.0 37.0 38.0 33.2 38.0 125-129 35.76695 38.0 36.4 38.0 32.2 38.0 130-134 35.498450000000005 38.0 36.0 38.0 30.6 38.0 135-139 35.430099999999996 38.0 36.0 38.0 31.0 38.0 140-144 34.95035 38.0 34.8 38.0 30.0 38.0 145-149 33.8555 38.0 33.0 38.0 24.4 38.0 150-151 29.2785 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 2.0 19 0.0 20 1.0 21 3.0 22 2.0 23 5.0 24 7.0 25 6.0 26 7.0 27 18.0 28 23.0 29 29.0 30 25.0 31 45.0 32 64.0 33 105.0 34 164.0 35 291.0 36 818.0 37 2380.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.34443288241415 17.455775234131114 8.636836628511967 44.562955254942764 2 21.155288822205552 13.103275818954737 37.50937734433609 28.232058014503625 3 19.25 14.774999999999999 25.474999999999998 40.5 4 24.85 24.725 21.075 29.349999999999998 5 25.85 29.75 23.599999999999998 20.8 6 22.650000000000002 33.300000000000004 24.125 19.925 7 18.224999999999998 24.25 38.45 19.075 8 20.375 23.775 30.4 25.45 9 18.7 23.45 34.075 23.775 10-14 22.040000000000003 27.605 26.11 24.245 15-19 22.195 26.235000000000003 26.834999999999997 24.735 20-24 22.5 27.0 26.055 24.445 25-29 22.67 26.745 25.650000000000002 24.935 30-34 22.71 26.369999999999997 26.340000000000003 24.58 35-39 22.59 26.905 26.185000000000002 24.32 40-44 22.470000000000002 26.384999999999998 26.185000000000002 24.959999999999997 45-49 22.36 26.845000000000002 26.155 24.64 50-54 22.33 26.515 25.89 25.264999999999997 55-59 22.220000000000002 25.97 27.0 24.81 60-64 22.06 26.029999999999998 26.85 25.06 65-69 22.658398759813974 25.778866830024505 26.628994349152375 24.933740061009154 70-74 23.46969393878776 26.485297059411884 25.58511702340468 24.459891978395678 75-79 22.63 26.32 26.02 25.03 80-84 22.175 25.955000000000002 26.545 25.324999999999996 85-89 22.5 26.085 26.150000000000002 25.264999999999997 90-94 23.13 26.235000000000003 25.665 24.97 95-99 22.96 25.814999999999998 26.56 24.665 100-104 23.214285714285715 25.850340136054424 26.000400160064025 24.93497398959584 105-109 23.23 25.835 25.885 25.05 110-114 23.198796690899975 26.437703685134117 25.966407620957632 24.39709200300827 115-119 23.35218457534658 26.164856613783094 25.739452479855863 24.743506331014466 120-124 22.9672254190643 26.034525894420817 26.029522141606204 24.96872654490868 125-129 23.084642014951584 25.74883347549044 26.391049119462146 24.77547539009583 130-134 23.956351987185904 25.55310841926119 25.623185504054458 24.86735408949845 135-139 23.485 25.924999999999997 25.895000000000003 24.695 140-144 23.215 25.319999999999997 26.325 25.14 145-149 23.135 26.090000000000003 25.245 25.53 150-151 23.3375 25.3 25.9625 25.4 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 3.5 28 4.5 29 5.5 30 9.5 31 12.0 32 16.5 33 23.5 34 29.0 35 42.0 36 62.5 37 73.5 38 93.0 39 124.0 40 135.5 41 168.0 42 207.5 43 217.0 44 214.5 45 217.5 46 228.0 47 224.0 48 203.5 49 189.5 50 175.5 51 160.0 52 146.5 53 130.5 54 107.0 55 85.0 56 81.5 57 71.0 58 59.0 59 56.5 60 57.0 61 50.0 62 42.0 63 39.5 64 41.0 65 34.0 66 24.5 67 23.5 68 28.0 69 22.0 70 13.0 71 15.0 72 10.5 73 6.5 74 5.0 75 3.0 76 2.5 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.9 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.015 70-74 0.02 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 0.0 110-114 0.27499999999999997 115-119 0.095 120-124 0.075 125-129 0.345 130-134 0.11 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42094662638469 98.725 2 0.4531722054380665 0.8999999999999999 3 0.12588116817724068 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 0.9125000000000001 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.5750000000000002 0.0 0.0 0.0 0.0 126-127 1.825 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.2874999999999996 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.7375 0.0 0.0 0.0 0.0 136-137 3.2 0.0 0.0 0.0 0.0 138-139 3.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCGCG 10 0.006577216 146.82278 1 CGTCAGA 10 0.006832588 144.9875 6 CCCGCGT 10 0.006832588 144.9875 2 TCAGAAA 10 0.006832588 144.9875 8 GCGTCAG 10 0.006832588 144.9875 5 CAGAAAA 10 0.006832588 144.9875 9 GTCAGAA 10 0.006832588 144.9875 7 CGCGTCA 10 0.006832588 144.9875 4 >>END_MODULE SRR6958414 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958414_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1585 33.0 33.0 34.0 33.0 34.0 2 33.30275 34.0 33.0 34.0 33.0 34.0 3 33.308 34.0 33.0 34.0 33.0 34.0 4 33.3295 34.0 33.0 34.0 33.0 34.0 5 33.06375 34.0 33.0 34.0 33.0 34.0 6 37.4735 38.0 38.0 38.0 37.0 38.0 7 37.59675 38.0 38.0 38.0 38.0 38.0 8 37.57775 38.0 38.0 38.0 38.0 38.0 9 37.49025 38.0 38.0 38.0 38.0 38.0 10-14 36.7522 38.0 37.0 38.0 33.6 38.0 15-19 37.192449999999994 38.0 37.8 38.0 36.0 38.0 20-24 37.5321 38.0 38.0 38.0 38.0 38.0 25-29 37.57695 38.0 38.0 38.0 38.0 38.0 30-34 37.5938 38.0 38.0 38.0 38.0 38.0 35-39 37.50175 38.0 38.0 38.0 38.0 38.0 40-44 36.812850000000005 38.0 37.8 38.0 34.4 38.0 45-49 37.102500000000006 38.0 38.0 38.0 35.8 38.0 50-54 37.4507 38.0 38.0 38.0 37.8 38.0 55-59 37.5055 38.0 38.0 38.0 37.8 38.0 60-64 37.46425 38.0 38.0 38.0 38.0 38.0 65-69 37.463849999999994 38.0 38.0 38.0 38.0 38.0 70-74 37.36755 38.0 38.0 38.0 37.6 38.0 75-79 36.974450000000004 38.0 38.0 38.0 35.4 38.0 80-84 36.41185 38.0 37.4 38.0 31.2 38.0 85-89 36.08389999999999 38.0 37.4 38.0 30.8 38.0 90-94 36.874399999999994 38.0 37.8 38.0 35.2 38.0 95-99 37.13905 38.0 38.0 38.0 36.6 38.0 100-104 37.117450000000005 38.0 38.0 38.0 36.2 38.0 105-109 36.995050000000006 38.0 38.0 38.0 36.0 38.0 110-114 36.917300000000004 38.0 38.0 38.0 35.6 38.0 115-119 36.84815 38.0 38.0 38.0 35.2 38.0 120-124 36.8273 38.0 38.0 38.0 35.2 38.0 125-129 36.76135000000001 38.0 38.0 38.0 35.0 38.0 130-134 36.524950000000004 38.0 38.0 38.0 34.8 38.0 135-139 33.56145 37.4 31.4 38.0 24.6 38.0 140-144 35.1514 38.0 36.2 38.0 30.4 38.0 145-149 34.6058 38.0 36.0 38.0 28.6 38.0 150-151 30.37175 35.5 28.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 3.0 18 2.0 19 3.0 20 3.0 21 3.0 22 5.0 23 2.0 24 10.0 25 8.0 26 9.0 27 17.0 28 21.0 29 27.0 30 19.0 31 33.0 32 40.0 33 72.0 34 109.0 35 210.0 36 738.0 37 2663.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.475 17.45 12.55 34.525 2 29.175 22.825 29.725 18.275 3 22.25 26.450000000000003 27.400000000000002 23.9 4 24.65 31.225 22.075 22.05 5 27.750000000000004 32.175 21.075 19.0 6 22.675 37.55 20.025000000000002 19.75 7 22.15 20.225 35.35 22.275 8 23.325000000000003 24.55 26.375 25.75 9 23.075000000000003 22.8 29.625 24.5 10-14 24.765 27.065 24.0 24.169999999999998 15-19 25.39 26.055 24.959999999999997 23.595 20-24 25.3 25.52 25.82 23.36 25-29 25.115 26.979999999999997 24.67 23.235 30-34 24.965 26.145000000000003 25.169999999999998 23.72 35-39 25.314999999999998 26.179999999999996 24.92 23.585 40-44 26.035000000000004 25.91 24.73 23.325000000000003 45-49 24.825 25.95 25.465 23.76 50-54 25.06 26.105 25.629999999999995 23.205000000000002 55-59 26.085 25.355 25.165 23.395 60-64 24.955 26.52 25.335 23.189999999999998 65-69 25.259999999999998 25.83 25.47 23.44 70-74 25.074999999999996 26.05 25.21 23.665 75-79 24.83 25.474999999999998 26.39 23.305 80-84 25.415 25.885 25.415 23.285 85-89 25.21 26.0 25.455 23.335 90-94 25.115 25.88 25.97 23.035 95-99 24.765 26.400000000000002 26.0 22.835 100-104 25.605 25.674999999999997 25.509999999999998 23.21 105-109 24.73 26.25 25.915 23.105 110-114 25.064999999999998 26.0 26.05 22.884999999999998 115-119 25.765 25.715 25.555 22.965 120-124 25.7 26.035000000000004 25.6 22.665 125-129 25.95 25.96 25.674999999999997 22.415 130-134 25.05 26.484999999999996 25.46 23.005 135-139 25.490000000000002 26.505000000000003 25.655 22.35 140-144 26.474999999999998 26.314999999999998 25.185000000000002 22.025 145-149 25.96 26.455000000000002 25.255 22.33 150-151 26.937499999999996 25.687500000000004 24.825 22.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 2.0 25 2.5 26 1.5 27 2.5 28 2.5 29 3.0 30 6.5 31 11.5 32 15.0 33 19.0 34 25.5 35 29.5 36 42.0 37 54.5 38 76.0 39 106.0 40 129.0 41 168.0 42 203.0 43 215.0 44 212.0 45 225.0 46 222.5 47 195.0 48 198.0 49 192.5 50 160.5 51 141.0 52 127.0 53 111.5 54 102.5 55 95.5 56 81.0 57 83.5 58 89.5 59 83.0 60 81.0 61 66.5 62 55.0 63 53.5 64 42.5 65 37.0 66 39.5 67 37.5 68 34.0 69 31.0 70 29.0 71 20.5 72 11.5 73 9.0 74 6.0 75 2.5 76 3.0 77 2.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88551165146909 97.6 2 0.9878419452887538 1.95 3 0.07598784194528875 0.22499999999999998 4 0.025329280648429587 0.1 5 0.025329280648429587 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.025 0.0 0.0 88-89 0.0 0.0 0.025 0.0 0.0 90-91 0.037500000000000006 0.0 0.025 0.0 0.0 92-93 0.075 0.0 0.025 0.0 0.0 94-95 0.0875 0.0 0.025 0.0 0.0 96-97 0.1 0.0 0.025 0.0 0.0 98-99 0.16249999999999998 0.0 0.025 0.0 0.0 100-101 0.25 0.0 0.025 0.0 0.0 102-103 0.275 0.0 0.025 0.0 0.0 104-105 0.2875 0.0 0.025 0.0 0.0 106-107 0.3875 0.0 0.025 0.0 0.0 108-109 0.4375 0.0 0.025 0.0 0.0 110-111 0.55 0.0 0.025 0.0 0.0 112-113 0.6 0.0 0.025 0.0 0.0 114-115 0.6125 0.0 0.025 0.0 0.0 116-117 0.7875 0.0 0.025 0.0 0.0 118-119 0.9125000000000001 0.0 0.025 0.0 0.0 120-121 1.0750000000000002 0.0 0.025 0.0 0.0 122-123 1.2125 0.0 0.025 0.0 0.0 124-125 1.5125000000000002 0.0 0.025 0.0 0.0 126-127 1.75 0.0 0.025 0.0 0.0 128-129 1.95 0.0 0.025 0.0 0.0 130-131 2.1624999999999996 0.0 0.025 0.0 0.0 132-133 2.3375 0.0 0.025 0.0 0.0 134-135 2.5875000000000004 0.0 0.025 0.0 0.0 136-137 3.025 0.0 0.025 0.0 0.0 138-139 3.4125 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756227 spots for SRR6958414.sra Written 756227 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra Read 756225 spots for SRR6958414.sra Written 756225 spots for SRR6958414.sra SRR ids: ['SRR6958414.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5yi6yltp SRR6958414.sra spots: 15124502 blocks: [[1, 756225], [756226, 1512450], [1512451, 2268675], [2268676, 3024900], [3024901, 3781125], [3781126, 4537350], [4537351, 5293575], [5293576, 6049800], [6049801, 6806025], [6806026, 7562250], [7562251, 8318475], [8318476, 9074700], [9074701, 9830925], [9830926, 10587150], [10587151, 11343375], [11343376, 12099600], [12099601, 12855825], [12855826, 13612050], [13612051, 14368275], [14368276, 15124502]] SRR6958414 file size 5103497 SRR6958414 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958414 SRR6958414_1.fastq SRR6958414_2.fastq Input file: SRR6958414_1.fastq Paired file: SRR6958414_2.fastq trimmed: SRR6958414-trimmed-pair1.fastq, SRR6958414-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:30:21 2024 >> started Fri Dec 6 22:30:38 2024 >> done (17.394s) 15124502 read pairs processed; of these: 6836 ( 0.05%) short read pairs filtered out after trimming by size control 4927 ( 0.03%) empty read pairs filtered out after trimming by size control 15112739 (99.92%) read pairs available; of these: 4888063 (32.34%) trimmed read pairs available after processing 10224676 (67.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 6 0.00% 29 5 0.00% 30 3 0.00% 31 2 0.00% 32 1 0.00% 33 5 0.00% 34 1 0.00% 35 0 0.00% 36 3 0.00% 37 2 0.00% 38 4 0.00% 39 6 0.00% 40 5 0.00% 41 0 0.00% 42 0 0.00% 43 8 0.00% 44 9 0.00% 45 5 0.00% 46 9 0.00% 47 9 0.00% 48 13 0.00% 49 16 0.00% 50 17 0.00% 51 13 0.00% 52 17 0.00% 53 20 0.00% 54 22 0.00% 55 17 0.00% 56 27 0.00% 57 26 0.00% 58 33 0.00% 59 33 0.00% 60 32 0.00% 61 48 0.00% 62 44 0.00% 63 50 0.00% 64 73 0.00% 65 77 0.00% 66 77 0.00% 67 75 0.00% 68 83 0.00% 69 122 0.00% 70 130 0.00% 71 142 0.00% 72 158 0.00% 73 184 0.00% 74 205 0.00% 75 242 0.00% 76 307 0.00% 77 306 0.00% 78 349 0.00% 79 373 0.00% 80 416 0.00% 81 477 0.00% 82 665 0.00% 83 680 0.00% 84 1005 0.01% 85 1125 0.01% 86 1186 0.01% 87 1338 0.01% 88 1447 0.01% 89 1567 0.01% 90 1696 0.01% 91 1853 0.01% 92 2081 0.01% 93 2290 0.02% 94 2474 0.02% 95 2669 0.02% 96 2857 0.02% 97 3210 0.02% 98 3364 0.02% 99 3680 0.02% 100 4046 0.03% 101 4361 0.03% 102 4654 0.03% 103 4831 0.03% 104 5354 0.04% 105 5509 0.04% 106 6061 0.04% 107 6368 0.04% 108 6946 0.05% 109 7310 0.05% 110 7676 0.05% 111 8347 0.06% 112 8749 0.06% 113 9452 0.06% 114 10059 0.07% 115 10578 0.07% 116 11084 0.07% 117 11638 0.08% 118 12310 0.08% 119 12706 0.08% 120 13428 0.09% 121 14206 0.09% 122 14805 0.10% 123 15561 0.10% 124 16894 0.11% 125 17337 0.11% 126 18135 0.12% 127 19225 0.13% 128 20043 0.13% 129 21156 0.14% 130 22749 0.15% 131 23232 0.15% 132 24415 0.16% 133 25842 0.17% 134 27072 0.18% 135 29398 0.19% 136 31154 0.21% 137 33267 0.22% 138 34284 0.23% 139 36354 0.24% 140 39739 0.26% 141 43068 0.28% 142 47452 0.31% 143 53093 0.35% 144 61505 0.41% 145 73054 0.48% 146 89983 0.60% 147 123303 0.82% 148 193832 1.28% 149 416506 2.76% 150 3090425 20.45% 151 10224676 67.66% 15112739 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=25 prefix-density=0.95 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=31.44 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.9 sequence=TCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=14 prefix-density=0.68 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=17.89 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR6958414 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:31:26 Started mapping on | Dec 06 22:31:26 Finished on | Dec 06 22:32:59 Mapping speed, Million of reads per hour | 585.01 Number of input reads | 15112739 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14786586 Uniquely mapped reads % | 97.84% Average mapped length | 298.01 Number of splices: Total | 18159988 Number of splices: Annotated (sjdb) | 17178657 Number of splices: GT/AG | 17914835 Number of splices: GC/AG | 207327 Number of splices: AT/AC | 7302 Number of splices: Non-canonical | 30524 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 160009 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 4890 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.87% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 169084 169084 169084 N_multimapping 160009 160009 160009 N_noFeature 501889 14332461 607101 N_ambiguous 401092 1713 53226 UnstrandedReadsAssigned:13883605 PositiveStrandReadsAssigned:452412 NegativeStrandReadsAssigned:14126259 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958414 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958414-trimmed-pair1.fastq SRR6958414-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,112,739 reads, 14,100,547 reads pseudoaligned [quant] estimated average fragment length: 253.922 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR6958414.ke.tsv 35125 SRR6958414.se.tsv 88098 total ==> SRR6958414.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.48 0 0 PNS24247 1044 791.078 34.6442 4.69224 PNS24249 1928 1675.08 10.8273 0.692553 PNS24246 1044 791.078 34.6442 4.69224 PNS24248 1044 791.078 34.6442 4.69224 PNS24244 1471 1218.08 19.2401 1.6924 PNS24243 293 80.6176 0 0 KQK14069 1603 1350.08 2034.22 161.439 KQK14071 474 227.764 45.744 21.5188 ==> SRR6958414.se.tsv <== BRADI_1g14170v3 2535 BRADI_1g53295v3 1215 BRADI_1g59795v3 76 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 241 BRADI_1g74790v3 70 BRADI_1g09890v3 0 BRADI_1g77505v3 173 BRADI_1g48960v3 0 SRR6958414 completed mapping pipeline successfully