Starting /dee2/code/volunteer_pipeline.sh SRR6958415 current disk space = 1548681551872 free memory = 1600617884 SRR6958415 SRAfilesize ab779f5df2a5cead61c70873090a3be0 SRR6958415.sra SRR6958415.sra file validated SRR6958415 is paired end SRR6958415 is conventional basespace SRR6958415 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958415_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.7625 32.0 27.0 33.0 18.0 33.0 2 29.66925 31.0 28.0 33.0 18.0 33.0 3 31.3425 33.0 31.0 33.0 27.0 34.0 4 31.0165 33.0 32.0 33.0 27.0 33.0 5 32.032 33.0 32.0 33.0 31.0 34.0 6 36.291 38.0 36.0 38.0 33.0 38.0 7 36.9015 38.0 37.0 38.0 35.0 38.0 8 37.2115 38.0 38.0 38.0 36.0 38.0 9 37.3565 38.0 38.0 38.0 37.0 38.0 10-14 37.26255 38.0 38.0 38.0 36.6 38.0 15-19 37.24725 38.0 38.0 38.0 36.6 38.0 20-24 37.3495 38.0 38.0 38.0 37.0 38.0 25-29 37.195350000000005 38.0 38.0 38.0 36.2 38.0 30-34 37.142649999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.98365 38.0 38.0 38.0 36.0 38.0 40-44 36.96319999999999 38.0 38.0 38.0 35.8 38.0 45-49 37.00775 38.0 38.0 38.0 36.0 38.0 50-54 36.950450000000004 38.0 38.0 38.0 35.4 38.0 55-59 36.69205 38.0 38.0 38.0 34.6 38.0 60-64 36.72080000000001 38.0 38.0 38.0 34.6 38.0 65-69 36.74765 38.0 38.0 38.0 34.6 38.0 70-74 36.8832 38.0 38.0 38.0 35.0 38.0 75-79 36.608850000000004 38.0 37.8 38.0 34.2 38.0 80-84 36.324400000000004 38.0 37.4 38.0 33.4 38.0 85-89 36.1586 38.0 37.0 38.0 33.0 38.0 90-94 36.278499999999994 38.0 37.2 38.0 33.4 38.0 95-99 36.191500000000005 38.0 37.2 38.0 33.2 38.0 100-104 36.0501 38.0 37.0 38.0 32.8 38.0 105-109 35.776300000000006 38.0 36.2 38.0 31.0 38.0 110-114 35.61135 38.0 36.0 38.0 30.6 38.0 115-119 35.63265 38.0 36.0 38.0 30.6 38.0 120-124 35.390750000000004 38.0 35.6 38.0 29.4 38.0 125-129 34.8563 38.0 35.0 38.0 27.4 38.0 130-134 34.74785000000001 38.0 35.0 38.0 27.0 38.0 135-139 34.526799999999994 38.0 34.8 38.0 25.8 38.0 140-144 34.02185 38.0 34.0 38.0 23.8 38.0 145-149 33.08775 38.0 33.6 38.0 18.8 38.0 150-151 28.65675 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 1.0 18 0.0 19 1.0 20 1.0 21 1.0 22 4.0 23 3.0 24 10.0 25 11.0 26 20.0 27 33.0 28 32.0 29 58.0 30 66.0 31 73.0 32 118.0 33 145.0 34 252.0 35 452.0 36 914.0 37 1803.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.91580041580042 9.095634095634097 8.341995841995843 44.646569646569645 2 22.650000000000002 12.85 37.9 26.6 3 18.825 15.475 26.400000000000002 39.300000000000004 4 23.724999999999998 21.95 22.45 31.874999999999996 5 25.362681340670335 28.96448224112056 24.462231115557778 21.210605302651324 6 23.625 32.875 23.375 20.125 7 17.025000000000002 25.7 38.15 19.125 8 20.474999999999998 24.125 30.475 24.925 9 19.675 22.55 33.125 24.65 10-14 21.765 26.86 27.065 24.310000000000002 15-19 22.405 25.3 26.77 25.525 20-24 22.375 26.1 26.905 24.62 25-29 22.705000000000002 26.314999999999998 26.265 24.715 30-34 22.55 25.855 26.619999999999997 24.975 35-39 22.735 26.36 26.419999999999998 24.485 40-44 22.715 25.735000000000003 26.665 24.884999999999998 45-49 22.555 25.655 26.784999999999997 25.005 50-54 22.93 25.865 25.935000000000002 25.27 55-59 22.93 25.929999999999996 26.195 24.945 60-64 22.445 25.655 26.715 25.185000000000002 65-69 22.8 25.564999999999998 26.369999999999997 25.264999999999997 70-74 22.025 25.455 26.755000000000003 25.765 75-79 22.455 25.77 26.590000000000003 25.185000000000002 80-84 22.665 25.724999999999998 26.529999999999998 25.080000000000002 85-89 22.5 25.835 26.845000000000002 24.82 90-94 22.525000000000002 26.045 25.71 25.72 95-99 22.55 25.495 26.400000000000002 25.555 100-104 22.28 26.265 26.51 24.945 105-109 22.5 26.0 26.495 25.005 110-114 22.63 25.605 26.51 25.255 115-119 23.005 25.915 26.07 25.009999999999998 120-124 22.8 25.935000000000002 26.275 24.990000000000002 125-129 22.865 25.4 26.590000000000003 25.145 130-134 22.495 25.56 26.625 25.319999999999997 135-139 22.75 25.52 26.435 25.295 140-144 22.770000000000003 25.445 26.295 25.490000000000002 145-149 22.400000000000002 25.655 26.555 25.39 150-151 22.680670167541887 25.18129532383096 26.019004751187797 26.11902975743936 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 2.0 28 5.0 29 8.0 30 6.5 31 7.0 32 17.0 33 23.0 34 30.0 35 38.0 36 52.0 37 68.5 38 84.0 39 102.0 40 136.5 41 179.5 42 211.5 43 232.5 44 243.0 45 245.0 46 219.5 47 199.5 48 188.5 49 183.5 50 170.5 51 144.5 52 132.5 53 122.5 54 104.5 55 87.5 56 72.5 57 68.5 58 70.0 59 60.0 60 57.0 61 62.5 62 57.5 63 42.5 64 39.5 65 42.0 66 36.5 67 28.5 68 21.5 69 19.0 70 18.5 71 12.5 72 10.5 73 10.5 74 8.5 75 6.5 76 2.5 77 2.0 78 2.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93832153690597 97.85000000000001 2 1.0111223458038423 2.0 3 0.05055611729019212 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.36250000000000004 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7125 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 1.05 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.4875 0.0 0.0 0.0 0.0 132-133 1.7000000000000002 0.0 0.0 0.0 0.0 134-135 1.9 0.0 0.0 0.0 0.0 136-137 2.1125 0.0 0.0 0.0 0.0 138-139 2.4000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6958415 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6958415_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85525 33.0 33.0 34.0 32.0 34.0 2 32.7625 33.0 33.0 34.0 32.0 34.0 3 32.82625 33.0 33.0 34.0 32.0 34.0 4 32.64675 33.0 33.0 34.0 32.0 34.0 5 32.77475 33.0 33.0 34.0 32.0 34.0 6 36.85525 38.0 38.0 38.0 35.0 38.0 7 36.754 38.0 38.0 38.0 35.0 38.0 8 36.838 38.0 38.0 38.0 35.0 38.0 9 36.775 38.0 38.0 38.0 35.0 38.0 10-14 36.6475 38.0 38.0 38.0 34.6 38.0 15-19 36.57090000000001 38.0 38.0 38.0 34.2 38.0 20-24 36.74525 38.0 38.0 38.0 34.8 38.0 25-29 36.8594 38.0 38.0 38.0 35.6 38.0 30-34 36.852650000000004 38.0 38.0 38.0 35.8 38.0 35-39 36.8029 38.0 38.0 38.0 35.0 38.0 40-44 36.6919 38.0 38.0 38.0 34.8 38.0 45-49 36.5568 38.0 38.0 38.0 34.2 38.0 50-54 36.577999999999996 38.0 38.0 38.0 34.6 38.0 55-59 36.610949999999995 38.0 38.0 38.0 34.6 38.0 60-64 36.5035 38.0 38.0 38.0 34.0 38.0 65-69 36.27905 38.0 38.0 38.0 33.4 38.0 70-74 36.21515 38.0 37.8 38.0 33.2 38.0 75-79 36.1608 38.0 38.0 38.0 33.0 38.0 80-84 35.99385 38.0 37.2 38.0 32.4 38.0 85-89 35.81805 38.0 37.0 38.0 31.6 38.0 90-94 35.691250000000004 38.0 37.0 38.0 31.0 38.0 95-99 35.657349999999994 38.0 36.8 38.0 31.0 38.0 100-104 35.5783 38.0 36.8 38.0 30.4 38.0 105-109 35.286950000000004 38.0 36.0 38.0 29.0 38.0 110-114 34.8398 38.0 35.4 38.0 26.8 38.0 115-119 34.74175 38.0 35.0 38.0 27.0 38.0 120-124 34.5634 38.0 35.0 38.0 26.0 38.0 125-129 34.3737 38.0 35.0 38.0 25.4 38.0 130-134 34.02565 38.0 34.6 38.0 22.6 38.0 135-139 33.60475 38.0 34.0 38.0 21.0 38.0 140-144 33.093999999999994 38.0 33.4 38.0 17.0 38.0 145-149 32.1628 38.0 32.0 38.0 11.2 38.0 150-151 27.226125 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 1.0 5 3.0 6 1.0 7 1.0 8 3.0 9 0.0 10 1.0 11 1.0 12 5.0 13 1.0 14 3.0 15 2.0 16 5.0 17 3.0 18 3.0 19 7.0 20 11.0 21 7.0 22 9.0 23 8.0 24 19.0 25 27.0 26 20.0 27 29.0 28 45.0 29 53.0 30 70.0 31 98.0 32 130.0 33 166.0 34 235.0 35 379.0 36 810.0 37 1838.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.09254627313656 16.558279139569784 12.38119059529765 35.967983991996 2 28.23911955977989 23.1615807903952 30.015007503751878 18.584292146073036 3 21.735867933966986 24.437218609304654 29.33966983491746 24.487243621810904 4 25.093820365273956 31.248436327245432 21.015761821366024 22.641981486114584 5 28.096072054040533 32.44933700275207 21.56617463097323 17.888416312234177 6 21.725 36.925000000000004 22.25 19.1 7 22.75 20.150000000000002 35.425000000000004 21.675 8 23.05 23.325000000000003 26.1 27.525 9 22.35 23.1 29.925 24.625 10-14 25.86 26.43 24.060000000000002 23.65 15-19 25.415 25.865 25.115 23.605 20-24 24.875 26.805 25.085 23.235 25-29 25.461273063653184 26.071303565178262 25.146257312865643 23.321166058302914 30-34 25.355 26.365 25.09 23.189999999999998 35-39 24.755 26.46 25.235000000000003 23.549999999999997 40-44 25.679999999999996 26.150000000000002 25.155 23.015 45-49 25.46 26.540000000000003 25.2 22.8 50-54 24.26 26.674999999999997 25.525 23.54 55-59 25.685000000000002 26.640000000000004 24.84 22.835 60-64 25.47 25.779999999999998 25.715 23.035 65-69 25.485000000000003 26.265 25.790000000000003 22.46 70-74 25.6 25.805 25.515 23.080000000000002 75-79 25.615 26.090000000000003 25.505 22.79 80-84 25.525 26.135 25.0 23.34 85-89 25.535000000000004 26.125 25.169999999999998 23.169999999999998 90-94 24.93 26.26 25.505 23.305 95-99 25.575 26.224999999999998 25.369999999999997 22.830000000000002 100-104 25.64 26.590000000000003 25.195 22.575 105-109 25.395 26.795 25.46 22.35 110-114 25.72 26.779999999999998 24.895 22.605 115-119 26.090000000000003 26.36 25.074999999999996 22.475 120-124 25.46 26.919999999999998 25.105 22.515 125-129 25.395 27.33 24.845 22.43 130-134 26.035000000000004 26.555 25.03 22.38 135-139 25.96 26.605 25.28 22.155 140-144 26.064999999999998 25.935000000000002 26.005 21.995 145-149 25.979999999999997 26.125 25.47 22.425 150-151 26.831707926981746 26.144036009002253 24.5311327831958 22.493123280820203 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 4.0 28 4.0 29 4.0 30 8.0 31 11.0 32 16.0 33 20.5 34 27.5 35 36.0 36 51.0 37 67.0 38 78.5 39 101.0 40 137.0 41 166.5 42 177.5 43 191.5 44 226.5 45 238.0 46 225.5 47 224.5 48 197.0 49 166.5 50 164.5 51 152.0 52 121.5 53 106.0 54 98.0 55 91.5 56 85.5 57 75.0 58 69.0 59 74.5 60 75.0 61 63.0 62 56.5 63 55.5 64 55.5 65 49.0 66 41.5 67 35.5 68 27.0 69 26.5 70 26.5 71 21.5 72 15.5 73 10.5 74 7.5 75 6.0 76 5.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85757806549886 97.35000000000001 2 0.8631632394008631 1.7000000000000002 3 0.17771007870017771 0.525 4 0.07616146230007616 0.3 5 0.02538715410002539 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.36250000000000004 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7125 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 1.0125 0.0 0.0 0.0 0.0 126-127 1.175 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.4625 0.0 0.0 0.0 0.0 132-133 1.6625 0.0 0.0 0.0 0.0 134-135 1.875 0.0 0.0 0.0 0.0 136-137 2.0875 0.0 0.0 0.0 0.0 138-139 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCTCT 10 0.006830828 145.0 1 >>END_MODULE Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248642 spots for SRR6958415.sra Written 1248642 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra Read 1248623 spots for SRR6958415.sra Written 1248623 spots for SRR6958415.sra SRR ids: ['SRR6958415.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gwtgyn_i SRR6958415.sra spots: 24972479 blocks: [[1, 1248623], [1248624, 2497246], [2497247, 3745869], [3745870, 4994492], [4994493, 6243115], [6243116, 7491738], [7491739, 8740361], [8740362, 9988984], [9988985, 11237607], [11237608, 12486230], [12486231, 13734853], [13734854, 14983476], [14983477, 16232099], [16232100, 17480722], [17480723, 18729345], [18729346, 19977968], [19977969, 21226591], [21226592, 22475214], [22475215, 23723837], [23723838, 24972479]] SRR6958415 file size 8440653 SRR6958415 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6958415 SRR6958415_1.fastq SRR6958415_2.fastq Input file: SRR6958415_1.fastq Paired file: SRR6958415_2.fastq trimmed: SRR6958415-trimmed-pair1.fastq, SRR6958415-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:34:42 2024 >> started Fri Dec 6 22:35:08 2024 >> done (25.552s) 24972479 read pairs processed; of these: 13031 ( 0.05%) short read pairs filtered out after trimming by size control 9519 ( 0.04%) empty read pairs filtered out after trimming by size control 24949929 (99.91%) read pairs available; of these: 9097697 (36.46%) trimmed read pairs available after processing 15852232 (63.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 3 0.00% 21 3 0.00% 22 9 0.00% 23 11 0.00% 24 9 0.00% 25 6 0.00% 26 6 0.00% 27 7 0.00% 28 7 0.00% 29 4 0.00% 30 4 0.00% 31 6 0.00% 32 8 0.00% 33 7 0.00% 34 9 0.00% 35 11 0.00% 36 17 0.00% 37 12 0.00% 38 11 0.00% 39 13 0.00% 40 15 0.00% 41 14 0.00% 42 15 0.00% 43 18 0.00% 44 18 0.00% 45 19 0.00% 46 18 0.00% 47 29 0.00% 48 23 0.00% 49 26 0.00% 50 16 0.00% 51 34 0.00% 52 42 0.00% 53 41 0.00% 54 37 0.00% 55 47 0.00% 56 56 0.00% 57 54 0.00% 58 68 0.00% 59 77 0.00% 60 82 0.00% 61 83 0.00% 62 107 0.00% 63 133 0.00% 64 128 0.00% 65 153 0.00% 66 158 0.00% 67 188 0.00% 68 187 0.00% 69 254 0.00% 70 238 0.00% 71 286 0.00% 72 313 0.00% 73 343 0.00% 74 406 0.00% 75 407 0.00% 76 475 0.00% 77 578 0.00% 78 596 0.00% 79 727 0.00% 80 783 0.00% 81 902 0.00% 82 998 0.00% 83 1120 0.00% 84 1743 0.01% 85 2226 0.01% 86 2474 0.01% 87 2625 0.01% 88 2756 0.01% 89 3051 0.01% 90 2979 0.01% 91 3211 0.01% 92 3256 0.01% 93 3548 0.01% 94 3840 0.02% 95 4685 0.02% 96 4498 0.02% 97 4868 0.02% 98 5217 0.02% 99 5521 0.02% 100 5943 0.02% 101 6395 0.03% 102 6718 0.03% 103 7337 0.03% 104 7842 0.03% 105 8334 0.03% 106 8908 0.04% 107 9572 0.04% 108 10207 0.04% 109 10947 0.04% 110 11633 0.05% 111 12178 0.05% 112 13342 0.05% 113 14676 0.06% 114 14741 0.06% 115 16262 0.07% 116 17158 0.07% 117 18199 0.07% 118 19328 0.08% 119 20348 0.08% 120 21698 0.09% 121 22616 0.09% 122 23998 0.10% 123 25528 0.10% 124 26824 0.11% 125 28564 0.11% 126 30072 0.12% 127 32345 0.13% 128 34109 0.14% 129 36113 0.14% 130 38433 0.15% 131 40951 0.16% 132 44065 0.18% 133 47182 0.19% 134 50399 0.20% 135 53668 0.22% 136 58109 0.23% 137 63198 0.25% 138 67885 0.27% 139 73702 0.30% 140 81368 0.33% 141 90539 0.36% 142 101698 0.41% 143 117551 0.47% 144 138897 0.56% 145 169547 0.68% 146 217120 0.87% 147 302296 1.21% 148 471885 1.89% 149 969037 3.88% 150 5311248 21.29% 151 15852232 63.54% 24949929 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=19 prefix-density=0.74 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=78.68 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=10.6 sequence=CAGCTGCAGCTTCTTCTGTCACTTGGGACGCCTGCTGCAGAGTGCAGATAAGGTTGCGGTCCCCGTACACGTTGTCCACACGACATGTTGTTGGCCAGAACTTGGCACCCCGAAGCCAAGCCGCAGGGAACGCGGCGTACTCCCTAGAGTACGGCTTAGTCCATGCATCGCTCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTCTGCAATTTCTTCCCTGATTGAGATAAGGGCATCACAGAACCTGTCTAGTTCAGCCTTGCTTTCGCTTTCAGTGGGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCGTGGAATCCATAGTCCATCAAGCGCTTTGCCACATCCTCGGGCTCTATACCAGCAGTTGCCTTAAACCCTCTTAAGTCAATAATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTGCTTCTCCAG criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=26 prefix-density=0.55 prefix-fanout=2.4 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=80.98 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.3 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR6958415 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 22:35:56 Started mapping on | Dec 06 22:35:56 Finished on | Dec 06 22:38:57 Mapping speed, Million of reads per hour | 496.24 Number of input reads | 24949929 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 24231547 Uniquely mapped reads % | 97.12% Average mapped length | 297.73 Number of splices: Total | 29723799 Number of splices: Annotated (sjdb) | 28082112 Number of splices: GT/AG | 29314256 Number of splices: GC/AG | 345832 Number of splices: AT/AC | 12012 Number of splices: Non-canonical | 51699 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281583 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 12555 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.40% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 445086 445086 445086 N_multimapping 281583 281583 281583 N_noFeature 900091 23518670 1084049 N_ambiguous 617858 3009 90131 UnstrandedReadsAssigned:22713598 PositiveStrandReadsAssigned:709868 NegativeStrandReadsAssigned:23057367 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6958415 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6958415-trimmed-pair1.fastq SRR6958415-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,949,929 reads, 23,038,067 reads pseudoaligned [quant] estimated average fragment length: 276.747 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR6958415.ke.tsv 35125 SRR6958415.se.tsv 88098 total ==> SRR6958415.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 660.598 0 0 PNS24247 1044 768.253 58.6405 5.02356 PNS24249 1928 1652.25 44.6758 1.77957 PNS24246 1044 768.253 58.6405 5.02356 PNS24248 1044 768.253 58.6405 5.02356 PNS24244 1471 1195.25 33.4028 1.83925 PNS24243 293 75.9803 0 0 KQK14069 1603 1327.25 2666.02 132.199 KQK14071 474 213.731 39.2374 12.0824 ==> SRR6958415.se.tsv <== BRADI_1g14170v3 3109 BRADI_1g53295v3 1996 BRADI_1g59795v3 127 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 520 BRADI_1g74790v3 93 BRADI_1g09890v3 0 BRADI_1g77505v3 317 BRADI_1g48960v3 0 SRR6958415 completed mapping pipeline successfully